Evan D. Brutinel

发表

Genome-Scale Metabolic Network Validation of Shewanella oneidensis Using Transposon Insertion Frequency Analysis

Hong Yang, Andrew M. Odlyzko, Michael J. Sadowsky, 2014, PLoS Comput. Biol..

Control of gene expression by type III secretory activity.

Evan D. Brutinel, T. Yahr, 2008, Current opinion in microbiology.

Shuttling happens: soluble flavin mediators of extracellular electron transfer in Shewanella

Jeffrey A. Gralnick, Evan D. Brutinel, J. Gralnick, 2011, Applied Microbiology and Biotechnology.

The Distal ExsA-Binding Site in Pseudomonas aeruginosa Type III Secretion System Promoters Is the Primary Determinant for Promoter-Specific Properties

Evan D. Brutinel, T. Yahr, J. King, 2012, Journal of bacteriology.

Characterization of ExsA and of ExsA‐dependent promoters required for expression of the Pseudomonas aeruginosa type III secretion system

Evan D. Brutinel, Christopher A. Vakulskas, T. Yahr, 2008, Molecular microbiology.

NosP signaling modulates the NO/H-NOX-mediated multicomponent c-di-GMP network and biofilm formation in Shewanella oneidensis.

Elizabeth M. Boon, Evan D. Brutinel, K. Thormann, 2019, Biochemistry.

The Pseudomonas aeruginosa Vfr Regulator Controls Global Virulence Factor Expression through Cyclic AMP-Dependent and -Independent Mechanisms

Evan D. Brutinel, M. Urbanowski, Nanette B. Fulcher, 2010, Journal of bacteriology.

Global Regulatory Pathways Converge To Control Expression of Pseudomonas aeruginosa Type IV Pili

Evan D. Brutinel, M. Wolfgang, M. Koomey, 2022, mBio.

In Vitro and In Vivo Characterization of the Pseudomonas aeruginosa Cyclic AMP (cAMP) Phosphodiesterase CpdA, Required for cAMP Homeostasis and Virulence Factor Regulation

Evan D. Brutinel, Anthony R. Fehr, M. Wolfgang, 2010, Journal of bacteriology.

Formate Metabolism in Shewanella oneidensis Generates Proton Motive Force and Prevents Growth without an Electron Acceptor

Evan D. Brutinel, J. Gralnick, C. VanDrisse, 2016, Journal of bacteriology.

Orientation of Pseudomonas aeruginosa ExsA Monomers Bound to Promoter DNA and Base-Specific Contacts with the PexoT Promoter

Evan D. Brutinel, T. Yahr, F. Schubot, 2012, Journal of bacteriology.

On the role of endogenous electron shuttles in extracellular electron transfer

Evan D. Brutinel, J. Gralnick, 2013 .

Anomalies of the anaerobic tricarboxylic acid cycle in Shewanella oneidensis revealed by Tn‐seq

Evan D. Brutinel, J. Gralnick, 2012, Molecular microbiology.

Description of a Riboflavin Biosynthetic Gene Variant Prevalent in the Phylum Proteobacteria

Evan D. Brutinel, A. Dean, J. Gralnick, 2013, Journal of bacteriology.

Shuttling happens: soluble flavin mediators of extracellular electron transfer in Shewanella

Evan D. Brutinel, J. Gralnick, 2011, Applied Microbiology and Biotechnology.

Translocation of ExsE into Chinese Hamster Ovary Cells Is Required for Transcriptional Induction of the Pseudomonas aeruginosa Type III Secretion System

Evan D. Brutinel, M. Urbanowski, T. Yahr, 2007, Infection and Immunity.

Biochemical Characterization of a Regulatory Cascade Controlling Transcription of the Pseudomonas aeruginosa Type III Secretion System*

Evan D. Brutinel, Lingling Chen, T. Yahr, 2007, Journal of Biological Chemistry.

ExsD Inhibits Expression of the Pseudomonas aeruginosa Type III Secretion System by Disrupting ExsA Self-Association and DNA Binding Activity

Evan D. Brutinel, Christopher A. Vakulskas, T. Yahr, 2009, Journal of bacteriology.

Characterization of ExsC and ExsD Self-Association and Heterocomplex Formation

Evan D. Brutinel, Lingling Chen, T. Yahr, 2006, Journal of bacteriology.

A Ferrous Iron Exporter Mediates Iron Resistance in Shewanella oneidensis MR-1

Evan D. Brutinel, J. Gralnick, B. Bennett, 2015, Applied and Environmental Microbiology.

Functional Domains of ExsA, the Transcriptional Activator of the Pseudomonas aeruginosa Type III Secretion System

Evan D. Brutinel, Christopher A. Vakulskas, T. Yahr, 2009, Journal of bacteriology.

ExsA Recruits RNA Polymerase to an Extended −10 Promoter by Contacting Region 4.2 of Sigma-70

Evan D. Brutinel, Christopher A. Vakulskas, T. Yahr, 2010, Journal of bacteriology.

A Ferrous Iron Exporter Mediates Iron Resistance in Shewanella oneidensis MR-1

Evan D. Brutinel, J. Gralnick, B. Bennett, 2015, Applied and Environmental Microbiology.

The Distal ExsA-Binding Site in Pseudomonas aeruginosa Type III Secretion System Promoters Is the Primary Determinant for Promoter-Specific Properties

Evan D. Brutinel, T. Yahr, J. King, 2012, Journal of bacteriology.

Functional Domains of ExsA, the Transcriptional Activator of the Pseudomonas aeruginosa Type III Secretion System

Evan D. Brutinel, Christopher A. Vakulskas, T. Yahr, 2009, Journal of bacteriology.

CompR GTACACTAGTGGCATAACCACTCCTTTGATTG SpeI ECfieFUSF GATCACTAGTCGATACCATTTTTCTTCGGC SpeI ECfieFUSR GATCCCGCGGCATAAATACTCCCGCTATCAAC SacII ECfieFDSF GATCCCGCGGCGGTCTATGCTTTCATAATCAG SacII ECfieFDSR GATCGGATCCCATACGGGAAGCCAGAATAC BamHI ECfiefF GTACGGATCCCAATTTGCCTGCTGCTTAATGC BamHI ECfiefR GTACACTAGT

Evan D. Brutinel, J. Gralnick, B. Bennett, 2015 .