Kevin J. Kauffman

发表

Delivery technologies for genome editing

Hao Yin, Daniel G. Anderson, Kevin J. Kauffman, 2017, Nature Reviews Drug Discovery.

Barcoded nanoparticles for high throughput in vivo discovery of targeted therapeutics

Eric T. Wang, Robert Langer, Daniel G. Anderson, 2017, Proceedings of the National Academy of Sciences.

Rapid, Single-Cell Analysis and Discovery of Vectored mRNA Transfection In Vivo with a loxP-Flanked tdTomato Reporter Mouse

Robert Langer, Ana Jaklenec, Daniel G. Anderson, 2017, Molecular therapy. Nucleic acids.

Uremic Toxin Indoxyl Sulfate Promotes Proinflammatory Macrophage Activation Via the Interplay of OATP2B1 and Dll4-Notch Signaling: Potential Mechanism for Accelerated Atherogenesis in Chronic Kidney Disease

Daniel G. Anderson, Kevin J. Kauffman, A. Barabasi, 2019, Circulation.

Structure-guided chemical modification of guide RNA enables potent non-viral in vivo genome editing

Daniel G. Anderson, Kevin J. Kauffman, R. Langer, 2017, Nature Biotechnology.

Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in Vivo with Fractional Factorial and Definitive Screening Designs.

Daniel G. Anderson, Kevin J. Kauffman, Owen S. Fenton, 2015, Nano letters.

RNAi targeting multiple cell adhesion molecules reduces immune cell recruitment and vascular inflammation after myocardial infarction

Daniel G. Anderson, James E. Dahlman, Kevin J. Kauffman, 2016, Science Translational Medicine.

Cancer nanotherapeutics in clinical trials.

Kevin J. Kauffman, R. Langer, A. Lytton-Jean, 2015, Cancer treatment and research.

Nanotechnology for in vivo targeted siRNA delivery.

Daniel G. Anderson, James E. Dahlman, Kevin J. Kauffman, 2014, Advances in genetics.

Endothelial TGF-β signalling drives vascular inflammation and atherosclerosis

Nicholas A Cilfone, Daniel G. Anderson, James E. Dahlman, 2019, Nature Metabolism.

NAD depletion mediates cytotoxicity in human neurons with autophagy deficiency.

Elsje G. Otten, Kevin J. Kauffman, R. Jaenisch, 2023, Cell reports.

Optimization of rapamycin-loaded acetalated dextran microparticles for immunosuppression.

Samantha A. Meenach, Kevin J. Kauffman, K. Ainslie, 2012, International journal of pharmaceutics.

Optimization of a Degradable Polymer-Lipid Nanoparticle for Potent Systemic Delivery of mRNA to the Lung Endothelium and Immune Cells.

Kaitlyn Sadtler, Daniel G Anderson, Daniel G. Anderson, 2018, Nano letters.

Materials for non-viral intracellular delivery of messenger RNA therapeutics.

Daniel G. Anderson, Kevin J. Kauffman, M. Webber, 2016, Journal of controlled release : official journal of the Controlled Release Society.

Optimization and analysis of lipid nanoparticles for in vivo mRNA delivery

Kevin John Kauffman, Kevin J. Kauffman, K. Kauffman, 2017 .

Customizable Lipid Nanoparticle Materials for the Delivery of siRNAs and mRNAs.

Daniel G. Anderson, Kevin J. Kauffman, Owen S. Fenton, 2018, Angewandte Chemie.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Daniel G. Anderson, Kevin J. Kauffman, D. Brenner, 2017, Molecular therapy. Nucleic acids.

Therapeutic efficacy in a hemophilia B model using a biosynthetic mRNA liver depot system

Kevin J. Kauffman, L. Smith, B. Guild, 2016, Gene Therapy.

Efficacy and immunogenicity of unmodified and pseudouridine-modified mRNA delivered systemically with lipid nanoparticles in vivo.

Daniel G. Anderson, Kevin J. Kauffman, M. Webber, 2016, Biomaterials.

Polymer-Lipid Nanoparticles for Systemic Delivery of mRNA to the Lungs.

Daniel G Anderson, Daniel G. Anderson, Owen S Fenton, 2016, Angewandte Chemie.

Synthesis and Biological Evaluation of Ionizable Lipid Materials for the In Vivo Delivery of Messenger RNA to B Lymphocytes

Mark W. Tibbitt, Daniel G. Anderson, Kevin J. Kauffman, 2017, Advanced materials.

In Vivo RNAi-Mediated eIF3m Knockdown Affects Ribosome Biogenesis and Transcription but Has Limited Impact on mRNA-Specific Translation

Patrick B. F. O'Connor, Daniel G. Anderson, Kevin J. Kauffman, 2019, Molecular therapy. Nucleic acids.

Inhaled Nanoformulated mRNA Polyplexes for Protein Production in Lung Epithelium

Robert Langer, Suman Bose, Daniel G Anderson, 2019, Advanced materials.

Synthesis and characterization of acetalated dextran polymer and microparticles with ethanol as a degradation product.

Kevin J. Kauffman, Sadhana Sharma, K. Ainslie, 2012, ACS applied materials & interfaces.

Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery

Mark W. Tibbitt, Daniel G. Anderson, Kevin J. Kauffman, 2016, Advanced materials.

AUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGU UCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAU CGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCC GUGUUGGGUGCCCUGUUCAUCGGUGUGGCUGUGGCCCCAGCUAAC GACAUCUACAACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCC AGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUCCU CAACGUGCAAAAGAAGCUAC

Daniel G. Anderson, Kevin J. Kauffman, M. Webber, 2016 .

Cell-Cycle-Targeting MicroRNAs as Therapeutic Tools against Refractory Cancers.

Daniel G. Anderson, Kevin J. Kauffman, K. Polyak, 2017, Cancer cell.