J. Joung

发表

A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions

Ahmad S. Khalil, J. Collins, C. Bashor, 2012, Cell.

Open-source guideseq software for analysis of GUIDE-seq data

Martin J Aryee, J Keith Joung, Shengdar Q Tsai, 2016, Nature Biotechnology.

High-fidelity CRISPR-Cas9 variants with undetectable genome-wide off-targets

J. Joung, V. Pattanayak, S. Tsai, 2015, Nature.

Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition

J. Joung, S. Tsai, V. Topkar, 2015, Nature Biotechnology.

Efficient In Vivo Genome Editing Using RNA-Guided Nucleases

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013, Nature Biotechnology.

GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases

Martin J. Aryee, J. Joung, A. Iafrate, 2014, Nature Biotechnology.

An affinity-based scoring scheme for predicting DNA-binding activities of modularly assembled zinc-finger proteins

Drena Dobbs, Daniel F. Voytas, J. Keith Joung, 2008, Nucleic acids research.

CRISPR-Cas systems for editing, regulating and targeting genomes

Jeffry D. Sander, J. Joung, 2014, Nature Biotechnology.

Broad Specificity Profiling of TALENs Results in Engineered Nucleases With Improved DNA Cleavage Specificity

J. Keith Joung, David R. Liu, John P. Guilinger, 2014, Nature Methods.

Fanconi anemia gene editing by the CRISPR/Cas9 system.

Christof von Kalle, Jakub Tolar, Richard Gabriel, 2015, Human gene therapy.

Rapid Mutation of Endogenous Zebrafish Genes Using Zinc Finger Nucleases Made by Oligomerized Pool ENgineering (OPEN)

Jonathan E. Foley, Jeffry D. Sander, Morgan L. Maeder, 2009, PloS one.

Technologies and Computational Analysis Strategies for CRISPR Applications.

Matthew C. Canver, Jonathan Y. Hsu, J. Joung, 2020, Molecular cell.

Revealing Off-Target Cleavage Specificities of Zinc Finger Nucleases by In Vitro Selection

David R. Liu, C. L. Ramirez, J. Joung, 2011, Nature Methods.

CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off-targets

J. Joung, A. Bassuk, S. Tsai, 2017, Nature Methods.

Response to “Unexpected mutations after CRISPR–Cas9 editing in vivo”

Jonathan Y. Hsu, J. Joung, C. Lareau, 2018, Nature Methods.

Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells

J. Joung, S. Seneca, J. Vermeesch, 2018, Nucleic acids research.

In vivo CRISPR editing with no detectable genome-wide off-target mutations

Martin J. Aryee, J. Joung, M. Firth, 2018, Nature.

Impact of Genetic Variation on CRISPR-Cas Targeting.

Matthew C. Canver, J. Joung, L. Pinello, 2018, The CRISPR journal.

CRISPResso2 provides accurate and rapid genome editing sequence analysis

Matthew C. Canver, David R. Liu, Jason M. Gehrke, 2019, Nature Biotechnology.

Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors

Martin J. Aryee, J. Joung, C. Lareau, 2019, Nature.

CRISPR-SURF: discovering regulatory elements by deconvolution of CRISPR tiling screen data

Luca Pinello, Luca Biasco, Matthew C. Canver, 2018, bioRxiv.

Defining and improving the genome-wide specificities of CRISPR–Cas9 nucleases

J. Joung, S. Tsai, J. K. Joung, 2016, Nature Reviews Genetics.

Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing

Martin J. Aryee, Mathew J. Goodwin, J. Joung, 2014, Nature Biotechnology.

Heritable and Precise Zebrafish Genome Editing Using a CRISPR-Cas System

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013, PloS one.

Locus-specific editing of histone modifications at endogenous enhancers using programmable TALE-LSD1 fusions

J. Joung, B. Bernstein, James Y. Zou, 2013, Nature Biotechnology.

Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification.

Ronnie J Winfrey, Jonathan E. Foley, Jeffry D. Sander, 2008, Molecular cell.

High frequency modification of plant genes using engineered zinc finger nucleases

Ronnie J Winfrey, Morgan L. Maeder, J. Joung, 2009, Nature.

Comparison of zinc finger nucleases for use in gene targeting in mammalian cells.

Morgan L. Maeder, Shondra M. Pruett-Miller, J. Joung, 2008, Molecular therapy : the journal of the American Society of Gene Therapy.

Highly specific zinc finger proteins obtained by directed domain shuffling and cell-based selection

J. Joung, C. Pabo, J. Hurt, 2003, Proceedings of the National Academy of Sciences of the United States of America.

CRISPR RNA-guided activation of endogenous human genes

Morgan L. Maeder, J. Joung, Yanfang Fu, 2013, Nature Methods.

Allosteric inhibition of zinc-finger binding in the major groove of DNA by minor-groove binding ligands.

Christina M. Taylor, J. Joung, C. Pabo, 2004, Biochemistry.

Toddler: An Embryonic Signal That Promotes Cell Movement via Apelin Receptors

Jiao Ma, James A. Gagnon, Alan Saghatelian, 2014, Science.

Enhanced proofreading governs CRISPR-Cas9 targeting accuracy

Jennifer A. Doudna, J. Keith Joung, Benjamin P. Kleinstiver, 2017, Nature.

Zebrafish dscaml1 Deficiency Impairs Retinal Patterning and Oculomotor Function

James A. Gagnon, Alexandro D. Ramirez, J. Joung, 2020, The Journal of Neuroscience.

Zebrafish Dscaml1 is Essential for Retinal Patterning and Function of Oculomotor Subcircuits

James A. Gagnon, J. Joung, David Schoppik, 2019, bioRxiv.

Interactome Maps of Mouse Gene Regulatory Domains Reveal Basic Principles of Transcriptional Regulation

J. Keith Joung, Yijun Ruan, Zhonghui Tang, 2013, Cell.

FLASH Assembly of TALENs Enables High-Throughput Genome Editing

J. Keith Joung, Jeffry D. Sander, J. Joung, 2012, Nature Biotechnology.

Robust, synergistic regulation of human gene expression using TALE activators

J. Keith Joung, Jeffry D. Sander, Morgan L. Maeder, 2013, Nature Methods.

FLAsH assembly of TALeNs for high-throughput genome editing

Jeffry D Sander, J Keith Joung, Jeffry D. Sander, 2022 .

TALENs: a widely applicable technology for targeted genome editing

J. Keith Joung, Jeffry D. Sander, J. Joung, 2012, Nature Reviews Molecular Cell Biology.

Improving CRISPR-Cas nuclease specificity using truncated guide RNAs

J. Keith Joung, Jeffry D. Sander, J. Joung, 2014, Nature Biotechnology.

Synergistic activation of transcription by bacteriophage lambda cI protein and E. coli cAMP receptor protein.

J. Joung, D. Koepp, A. Hochschild, 1994, Science.

Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2009, Nature Protocols.

Engineering zinc finger nucleases for targeted mutagenesis of zebrafish.

Jeffry D. Sander, J. Joung, R. Peterson, 2011, Methods in cell biology.

In vivo CRISPR-Cas gene editing with no detectable genome-wide off-target mutations

J. Joung, M. Firth, S. Tsai, 2018, bioRxiv.

Engineered Zinc Finger Nucleases for Targeted Genome Editing

C. L. Ramirez, J. Joung, J. Keith Joung, 2013 .

Targeted mutagenesis in zebrafish using customized zinc-finger nucleases

Jonathan E. Foley, Morgan L. Maeder, J. Joung, 2009, Nature Protocols.

Mutant Allele-Specific CRISPR Disruption in DYT1 Dystonia Fibroblasts Restores Cell Function

J. Joung, X. Breakefield, Osmar Norberto de Souza, 2020, Molecular therapy. Nucleic acids.

Genome Editing Technologies: Defining a Path to Clinic: Genomic Editing: Establishing Preclinical Toxicology Standards, Bethesda, Maryland 10 June 2014.

F. Bushman, C. von Kalle, J. Joung, 2015, Molecular therapy : the journal of the American Society of Gene Therapy.

A dual-deaminase CRISPR base editor enables concurrent adenine and cytosine editing

Martin J. Aryee, Jonathan Y. Hsu, J. Joung, 2020, Nature Biotechnology.

Identifying and modifying protein–DNA and protein–protein interactions using a bacterial two‐hybrid selection system

J. Joung, 2001, Journal of cellular biochemistry. Supplement.

Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize

Martin J. Aryee, Carolyn J. Lawrence-Dill, J. Joung, 2018, Plant biotechnology journal.

Allele-Specific CRISPR-Cas9 Genome Editing of the Single-Base P23H Mutation for Rhodopsin-Associated Dominant Retinitis Pigmentosa.

J. Joung, B. Kleinstiver, Michelle S Prew, 2018, The CRISPR journal.

Genome-wide specificity profiles of CRISPR-Cas Cpf1 nucleases in human cells

Moira M. Welch, J. Joung, S. Tsai, 2016, bioRxiv.

Cholangiocarcinoma Hypersensitivity and SRC Dependence in Intrahepatic Isocitrate Dehydrogenase Mutations Confer Dasatinib

James T. Webber, J. Joung, K. Shokat, 2016 .

Targeted DNA Demethylation and Endogenous Gene Activation Using Programmable TALE-TET1 Fusions

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013, Nature biotechnology.

Genome editing of factor X in zebrafish reveals unexpected tolerance of severe defects in the common pathway.

J. Joung, D. Reyon, J. Shavit, 2017, Blood.

Disruption of the kringle 1 domain of prothrombin leads to late onset mortality in zebrafish

J. Joung, D. Reyon, J. Shavit, 2019, Scientific Reports.

Camptothecin resistance is determined by the regulation of topoisomerase I degradation mediated by ubiquitin proteasome pathway

Moira M. Welch, J. Joung, F. White, 2017, Oncotarget.

A bacterial two-hybrid selection system for studying protein-DNA and protein-protein interactions.

J. Joung, C. Pabo, E. Ramm, 2000, Proceedings of the National Academy of Sciences of the United States of America.

High-throughput β-galactosidase assay for bacterial cell-based reporter systems

J. Joung, S. A. Thibodeau, R. Fang, 2004 .

Methodes et compositions de dosage de piegeage par interaction

J. Joung, C. Pabo, Jeffrey C. Miller, 2001 .

CRISPR-Cas9 treatment partially restores amyloid-β 42/40 in human fibroblasts with the Alzheimer’s disease PSEN1 M146L mutation

Martin J. Aryee, J. Joung, V. Pattanayak, 2022, Molecular therapy. Nucleic acids.

Genetic strategy for analyzin specificity of dimer formation: Escheric a ia coli vclic AMP receptor .s dimeriz protein mutant ation specificity

J. Joung, Channing Yu, A. Hirsh, 2011 .

A Code of Ethics for Gene Drive Research

Chase L. Beisel, Ahmad S. Khalil, J. Joung, 2021, The CRISPR journal.

Enhanced proofreading governs CRISPR-Cas9 targeting accuracy Please share how this access benefits you. Your story matters

Alexander A. Sousa, Moira M. Welch, Lucas B. Harrington, 2018 .

Engineered CRISPR prime editors with compact, untethered reverse transcriptases

J. Joung, Julian Grünewald, Bret R. Miller, 2022, Nature Biotechnology.

CRISPR-Cas systems for genome editing, regulation and targeting

Jeffry D. Sander, J. Joung, 2015 .

Efficient In Vivo Genome Editing Using RNA-Guided Nucleases

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013, Nature Biotechnology.

ZFNGenome: A comprehensive resource for locating zinc finger nuclease target sites in model organisms

Jeffry D. Sander, J. Joung, D. Voytas, 2011, BMC Genomics.

A Zebrafish Model of Myelodysplastic Syndrome Produced through tet2 Genomic Editing

Jeffry D. Sander, J. Joung, L. Zon, 2014, Molecular and Cellular Biology.

Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells

Martin J Aryee, Zachary R McCaw, J Keith Joung, 2016, Nature Biotechnology.

Therapeutic base editing of human hematopoietic stem cells

Jason M. Gehrke, J. Joung, J. Manis, 2019, Nature Medicine.

Corrigendum: CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR–Cas9 nuclease off-targets

J. Joung, S. Tsai, V. Topkar, 2018, Nature Methods.

Multidimensional control of therapeutic human cell function with synthetic gene circuits

Ahmad S. Khalil, Jeffry D. Sander, Divya V. Israni, 2022, Science.

Gene therapy comes of age

Michel Sadelain, J Keith Joung, Donald B Kohn, 2018, Science.

Genome Editing: A Tool For Research and Therapy: Towards a functional understanding of variants for molecular diagnostics using genome editing

J Keith Joung, Shengdar Q Tsai, J. Joung, 2014, Nature Medicine.

High frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells

J. Keith Joung, Jeffry D. Sander, Morgan L. Maeder, 2013, Nature Biotechnology.

731. High-Fidelity CRISPR-Cas9 Nucleases with No Detectable Genome-Wide Off-Target Effects

J. Keith Joung, Benjamin P. Kleinstiver, Vikram Pattanayak, 2016 .

Engineered CRISPR-Cas9 nucleases with altered PAM specificities

Martin J. Aryee, J. Keith Joung, Benjamin P. Kleinstiver, 2015, Nature.

CRISPR prime editing with ribonucleoprotein complexes in zebrafish and primary human cells

Jonathan Y. Hsu, J. Joung, J.-R. Joanna Yeh, 2021, Nature Biotechnology.

CRISPR prime editing with ribonucleoprotein complexes in zebrafish and primary human cells

Jonathan Y. Hsu, J. Joung, J.-R. Joanna Yeh, 2021, Nature Biotechnology.

PrimeDesign software for rapid and simplified design of prime editing guide RNAs

Kin Chung Lam, David R. Liu, Andrew V. Anzalone, 2020, Nature Communications.

Targeted disruption of DNMT1, DNMT3A and DNMT3B in human embryonic stem cells

J. Rinn, A. Gnirke, J. Joung, 2015, Nature Genetics.

Rescue of DNA-PK Signaling and T-Cell Differentiation by Targeted Genome Editing in a prkdc Deficient iPSC Disease Model

Morgan L. Maeder, J. Joung, A. Schambach, 2015, PLoS genetics.

Repression of phase-variable cup gene expression by H-NS-like proteins in Pseudomonas aeruginosa.

J. Joung, S. Dove, Isabelle Vallet-Gely, 2005, Proceedings of the National Academy of Sciences of the United States of America.

In Situ Genetic Correction of the Sickle Cell Anemia Mutation in Human Induced Pluripotent Stem Cells Using Engineered Zinc Finger Nucleases

Morgan L. Maeder, Mathew J. Goodwin, C. L. Ramirez, 2011, Stem cells.

Dimeric CRISPR RNA-Guided FokI-dCas9 Nucleases Directed by Truncated gRNAs for Highly Specific Genome Editing.

J. Joung, S. Tsai, V. Topkar, 2015, Human gene therapy.

Targeted gene disruption in somatic zebrafish cells using engineered TALENs

J. Keith Joung, Jeffry D. Sander, J. Joung, 2011, Nature Biotechnology.

Context influences on TALE–DNA binding revealed by quantitative profiling

Jeffry D. Sander, Manolis Kellis, J. Joung, 2015, Nature Communications.

High levels of AAV vector integration into CRISPR-induced DNA breaks

Martin J. Aryee, Alexander A. Sousa, J. Joung, 2019, Nature Communications.

Program in Gene Function and Expression Publications and Presentations Program in Gene Function and Expression 4-2014 An improved predictive recognition model for Cys 2-His 2 zinc finger proteins

Gary D. Stormo, J. Keith Joung, Ryan G. Christensen, 2014 .

Efficient Delivery of Genome-Editing Proteins In Vitro and In Vivo

J. Keith Joung, David R. Liu, John P. Guilinger, 2014, Nature Biotechnology.

Enhanced proofreading governs CRISPR-Cas9 targeting accuracy

Jennifer A. Doudna, J. Keith Joung, Benjamin P. Kleinstiver, 2017, Nature.

CRISPResso2 provides accurate and rapid genome editing sequence analysis

Matthew C. Canver, David R. Liu, Jason M. Gehrke, 2019, Nature Biotechnology.

Gene targeting of a disease-related gene in human induced pluripotent stem and embryonic stem cells.

Prashant Mali, Linzhao Cheng, J Keith Joung, 2009, Cell stem cell.

Prediction of off-target activities for the end-to-end design of CRISPR guide RNAs

Alexander A. Sousa, J. Joung, J. Listgarten, 2017, Nature Biomedical Engineering.

ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering tool

Drena Dobbs, Daniel F. Voytas, J. Keith Joung, 2010, Nucleic Acids Res..

Targeted DNA demethylation and activation of endogenous genes using programmable TALE-TET1 fusion proteins

Jeffry D Sander, J Keith Joung, Jeffry D. Sander, 2013, Nature Biotechnology.

Targeted disruption of DNMT1, DNMT3A and DNMT3B in human embryonic stem cells

J. Rinn, A. Gnirke, J. Joung, 2015, Nature Genetics.

CAUSEL: An epigenome and genome editing pipeline for establishing function of non-coding GWAS variants

Z. Szallasi, J. Joung, I. Csabai, 2015, Nature Medicine.

Highly efficient generation of heritable zebrafish gene mutations using homo- and heterodimeric TALENs

J. Keith Joung, Jeffry D. Sander, J. Joung, 2012, Nucleic acids research.

Chromatin regulation at the frontier of synthetic biology

James J. Collins, Albert J. Keung, J. Keith Joung, 2015, Nature Reviews Genetics.

Hypoxia drives transient site-specific copy gain and drug-resistant gene expression

Capucine Van Rechem, G. Getz, J. Joung, 2015, Genes & development.

Isocitrate Dehydrogenase Mutations Confer Dasatinib Hypersensitivity and SRC Dependence in Intrahepatic Cholangiocarcinoma.

James T. Webber, J. Joung, K. Shokat, 2016, Cancer discovery.

Selection-Free Zinc-Finger Nuclease Engineering by Context-Dependent Assembly (CoDA)

Feng Zhang, Drena Dobbs, Daniel F. Voytas, 2010, Nature Methods.

Scalable characterization of the PAM requirements of CRISPR–Cas enzymes using HT-PAMDA

Jonathan Y. Hsu, J. Joung, B. Kleinstiver, 2021, Nature Protocols.

Cell-based artificial APC resistant to lentiviral transduction for efficient generation of CAR-T cells from various cell sources

Matthew J. Frigault, J. Joung, B. Kleinstiver, 2020, Journal for ImmunoTherapy of Cancer.

Optimization of AsCas12a for combinatorial genetic screens in human cells

Peter C. DeWeirdt, Kendall R. Sanson, Annabel K. Sangree, 2020, Nature Biotechnology.

Optimization of AsCas12a for combinatorial genetic screens in human cells

Teng Teng, John G. Doench, J. Keith Joung, 2019, bioRxiv.

Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing

Luca Pinello, Martin J. Aryee, J. Keith Joung, 2018, Nature Biotechnology.

Discovery of widespread type I and type V CRISPR-Cas inhibitors

J. Keith Joung, Benjamin P. Kleinstiver, Alexander A. Sousa, 2018, Science.

Inducible and multiplex gene regulation using CRISPR-Cpf1-based transcription factors

Jonathan Y. Hsu, J. Joung, J. Weissman, 2017, Nature Methods.

Profiling the DNA-binding specificities of engineered Cys2His2 zinc finger domains using a rapid cell-based method

J. Joung, S. Wolfe, Xiangdong Meng, 2007, Nucleic acids research.

Synthetic protein–protein interaction domains created by shuffling Cys2His2 zinc-fingers

J. Joung, Astrid V Giesecke, R. Fang, 2006, Molecular systems biology.

Augmenting and directing long-range CRISPR-mediated activation in human cells

Martin J. Aryee, Luli S. Zou, J. Joung, 2021, Nature Methods.

Improved Somatic Mutagenesis in Zebrafish Using Transcription Activator-Like Effector Nucleases (TALENs)

J. Keith Joung, Jeffry D. Sander, C. L. Ramirez, 2012, PloS one.

CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells

J. Keith Joung, Sowmya Iyer, Sara P. Garcia, 2020, Nature Biotechnology.

Zinc Finger Targeter (ZiFiT): an engineered zinc finger/target site design tool

Daniel F. Voytas, J. Keith Joung, Jeffry D. Sander, 2007, Nucleic Acids Res..

An APOBEC3A-Cas9 base editor with minimized bystander and off-target activities

Luca Pinello, Jason M. Gehrke, Daniel E Bauer, 2018, Nature Biotechnology.

Induction of Stable Drug Resistance in Human Breast Cancer Cells Using a Combinatorial Zinc Finger Transcription Factor Library

Sridhar Ramaswamy, J. Keith Joung, Dennis C. Sgroi, 2011, PloS one.

Versatile Polymer-Based Nanocarriers for Targeted Therapy and Immunomodulation

J. Joung, F. Eichler, N. Artzi, 2021 .

Targeted Mutagenesis of Duplicated Genes in Soybean with Zinc-Finger Nucleases1[W][OA]

Feng Zhang, Drena Dobbs, Daniel F. Voytas, 2011, Plant Physiology.

Engineered zinc finger nickases induce homology-directed repair with reduced mutagenic effects

Claudio Mussolino, Toni Cathomen, J. Keith Joung, 2012, Nucleic acids research.

Zinc-finger nucleases: the next generation emerges.

Toni Cathomen, J Keith Joung, J. Joung, 2008, Molecular therapy : the journal of the American Society of Gene Therapy.

Targeted mutagenesis of zebrafish antithrombin III triggers disseminated intravascular coagulation and thrombosis, revealing insight into function.

Morgan L. Maeder, Andy H. Vo, J. Joung, 2014, Blood.

THROMBOSIS AND HEMOSTASIS Targeted mutagenesis of zebra fi sh antithrombin III triggers disseminated intravascular coagulation and thrombosis , revealing insight into function

Morgan L. Maeder, Andy H. Vo, J. Joung, 2014 .

Systematic screening reveals a role for BRCA1 in the response to transcription-associated DNA damage

J. Joung, M. Vidal, S. Gaudet, 2014, Genes & development.

Analysis of off-target effects in CRISPR-based gene drives in the human malaria mosquito

J. Joung, V. Pattanayak, A. Crisanti, 2021, Proceedings of the National Academy of Sciences.

High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases

Feng Zhang, Drena Dobbs, Erica Unger-Wallace, 2010, Proceedings of the National Academy of Sciences.

CRISPR/Cas9 Mediated Disruption of the Swedish APP Allele as a Therapeutic Approach for Early-Onset Alzheimer’s Disease

J. Keith Joung, Bradley T. Hyman, Lars Lannfelt, 2018, Molecular therapy. Nucleic acids.

IκB Kinase β (IKBKB) Mutations in Lymphomas That Constitutively Activate Canonical Nuclear Factor κB (NFκB) Signaling*

J. Joung, D. Reyon, S. Pillai, 2014, The Journal of Biological Chemistry.

Efficient Delivery of Genome-Editing Proteins In Vitro and In Vivo

David R. Liu, Morgan L. Maeder, David B. Thompson, 2014, Nature biotechnology.

Autonomous zinc-finger nuclease pairs for targeted chromosomal deletion

Toni Cathomen, J. Keith Joung, Morgan L. Maeder, 2010, Nucleic acids research.

DNA-binding specificity is a major determinant of the activity and toxicity of zinc-finger nucleases.

Toni Cathomen, Tatjana I Cornu, J Keith Joung, 2008, Molecular therapy : the journal of the American Society of Gene Therapy.

piggyBac transposase tools for genome engineering

J. Keith Joung, Sarah J. Wheelan, Frederic D. Bushman, 2013, Proceedings of the National Academy of Sciences.

Genome-wide functional perturbation of human microsatellite repeats using engineered zinc finger transcription factors

Jeffry D. Sander, J. Joung, M. Rivera, 2022, Cell genomics.

Pathways disrupted in human ALS motor neurons identified through genetic correction of mutant SOD1.

Morgan L. Maeder, Derek H. Oakley, Mathew J. Goodwin, 2014, Cell stem cell.

Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State

R. Young, J. Joung, J. Maris, 2023, bioRxiv.

Publisher Correction: Engineered CRISPR–Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing

Alexander A. Sousa, Jonathan Y. Hsu, Moira M. Welch, 2020, Nature Biotechnology.

Continuous directed evolution of DNA-binding proteins to improve TALEN specificity

David R. Liu, Jeffry D Sander, J Keith Joung, 2015, Nature Methods.

Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly

J. Joung, B. Kleinstiver, Chien-Wei Lin, 2018, Arteriosclerosis, thrombosis, and vascular biology.

Allele-specific gene editing prevents deafness in a model of dominant progressive hearing loss

J. R. Holt, K. D. Karavitaki, J. Joung, 2019, Nature Medicine.

Counter-selectable marker for bacterial-based interaction trap systems.

J. Joung, S. Wolfe, Xiangdong Meng, 2006, BioTechniques.

Engineering Designer Nucleases with Customized Cleavage Specificities

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2011, Current Protocols in Molecular Biology.

Engineering single Cys2His2 zinc finger domains using a bacterial cell-based two-hybrid selection system.

Morgan L. Maeder, J. Joung, Stacey Thibodeau-Beganny, 2010, Methods in molecular biology.

Standardized reagents and protocols for engineering zinc finger nucleases by modular assembly

Drena Dobbs, David A Wright, Ronnie J Winfrey, 2006, Nature Protocols.

Predicting success of oligomerized pool engineering (OPEN) for zinc finger target site sequences

Xiaohong Li, Drena Dobbs, Daniel F. Voytas, 2010, BMC Bioinformatics.

Zinc Finger Database (ZiFDB): a repository for information on C2H2 zinc fingers and engineered zinc-finger arrays

Drena Dobbs, Daniel F. Voytas, Leslie L. Miller, 2008, Nucleic Acids Res..

TALEN-based gene correction for epidermolysis bullosa.

Christof von Kalle, Jakub Tolar, Richard Gabriel, 2013, Molecular therapy : the journal of the American Society of Gene Therapy.

Targeted Mutagenesis in Zebrafish Using CRISPR RNA-Guided Nucleases.

J. Joung, Woong Y. Hwang, Yanfang Fu, 2015, Methods in molecular biology.

Zinc-finger nucleases for somatic gene therapy: the next frontier.

Toni Cathomen, J. Keith Joung, Morgan L. Maeder, 2011, Human gene therapy.

DNA-binding Specificity Is a Major Determinant of the Activity and Toxicity of Zinc-finger Nucleases.

J. Joung, T. Cathomen, Stacey Thibodeau-Beganny, 2008, Molecular therapy : the journal of the American Society of Gene Therapy.

Synergistic Activation of Transcription in E. coli

J. Joung, Ann Hochschild, 1997 .

Activation of prokaryotic transcription through arbitrary protein–protein contacts

J. Keith Joung, J. Joung, A. Hochschild, 1997, Nature.

Genome Editing Technologies: Defining a Path to Clinic: Genomic Editing: Establishing Preclinical Toxicology Standards, Bethesda, Maryland 10 June 2014.

Jacqueline Corrigan-Curay, Marina O'Reilly, Donald B Kohn, 2015, Molecular therapy : the journal of the American Society of Gene Therapy.

Targeted Deletion and Inversion of Tandemly Arrayed Genes in Arabidopsis thaliana Using Zinc Finger Nucleases

Jeffry D. Sander, J. Joung, D. Voytas, 2013, G3: Genes, Genomes, Genetics.

Title ( 47 characters ) : Using FokI-dCas 9 nucleases with truncated gRNAs

J. Joung, S. Tsai, V. Topkar, 2015 .

Defining CRISPR–Cas9 genome-wide nuclease activities with CIRCLE-seq

Martin J. Aryee, Martin J Aryee, J Keith Joung, 2018, Nature Protocols.

“Unexpected mutations after CRISPR-Cas9 editing in vivo” are most likely pre-existing sequence variants and not nuclease-induced mutations

Jonathan Y. Hsu, J. Joung, C. Lareau, 2017, bioRxiv.

GGTGTTGGGGAACACAGACCGTCATTCGATTAAAAAGAATCTTATCGGTGCCCTCCTATTCGATAGTGGCGAAACGGCAGAGGCGACTCGCCTGA AACGAACCGCTCGGAGAAGGTATACACGTCGCAAGAACCGAATATGTTACTTACAAGAAATTTTTAGCAATGAGATGGCCAAAGTTGACGATTCTTT CTTTCACCGTTTGGAAGAGTCCTTCCTTGTCGAAGAGGACAAGAAACATGAACGGCACCCCATCTTTGGAAACATAGTAGATGAGGTGGCATATCA TGAAAAGTA

J. Joung, V. Pattanayak, S. Tsai, 2015 .

Unexpected failure rates for modular assembly of engineered zinc fingers

Toni Cathomen, Cherie L Ramirez, Jonathan E Foley, 2008, Nature Methods.

Correction of the Crb1rd8 allele and retinal phenotype in C57BL/6N mice via TALEN-mediated homology-directed repair.

J Keith Joung, Shengdar Q Tsai, Patsy M Nishina, 2014, Investigative ophthalmology & visual science.

Translating the Genomics Revolution: The Need for an International Gene Therapy Consortium for Monogenic Diseases

J. Joung, C. Barbas, A. Bogdanove, 2013, Molecular therapy : the journal of the American Society of Gene Therapy.

Targeted genome editing in human cells using CRISPR/Cas nucleases and truncated guide RNAs.

Ken W. Y. Cho, J Keith Joung, Margaret B. Fish, 2014, Methods in enzymology.

Synergistic activation of transcription by Escherichia coli cAMP receptor protein.

J. Joung, A. Hochschild, L. Le, 1993, Proceedings of the National Academy of Sciences of the United States of America.

High-precision CRISPR-Cas9 base editors with minimized bystander and off-target mutations

Jason M. Gehrke, J. Joung, M. K. Clement, 2018, bioRxiv.

Engineering Designer Transcription Activator‐‐Like Effector Nucleases (TALENs) by REAL or REAL‐Fast Assembly

Jeffry D. Sander, J. Joung, D. Reyon, 2012, Current protocols in molecular biology.

Evaluation of OPEN Zinc Finger Nucleases for Direct Gene Targeting of the ROSA26 Locus in Mouse Embryos

Morgan L. Maeder, J. Joung, B. Becher, 2012, PloS one.

CRISPR DNA base editors with reduced RNA off-target and self-editing activities

Martin J. Aryee, Martin J Aryee, Caleb A Lareau, 2019, Nature Biotechnology.

What's changed with genome editing?

J. Joung, S. Tsai, 2014, Cell stem cell.

Engineering customized TALE nucleases (TALENs) and TALE transcription factors by fast ligation-based automatable solid-phase high-throughput (FLASH) assembly.

Jonathan E Foley, Jeffry D Sander, J Keith Joung, 2013, Current protocols in molecular biology.

High-throughput beta-galactosidase assay for bacterial cell-based reporter systems.

J Keith Joung, Stacey A Thibodeau, J. Joung, 2004, BioTechniques.

Nodal patterning without Lefty inhibitory feedback is functional but fragile

James A. Gagnon, J. Joung, A. Schier, 2017, eLife.

Carbon statistics: China should come clean on emissions

J. Joung, Angel Hsu, Kaiyang Xu, 2015, Nature.

Defining genome-wide CRISPR–Cas genome-editing nuclease activity with GUIDE-seq

Martin J. Aryee, J. Joung, A. Iafrate, 2021, Nature Protocols.

Prediction of off-target activities for the end-to-end design of CRISPR guide RNAs

Jennifer Listgarten, Melih Elibol, Luong Hoang, 2018, Nature Biomedical Engineering.

In silico abstraction of zinc finger nuclease cleavage profiles reveals an expanded landscape of off-target sites

Bradley E. Bernstein, J. Keith Joung, David R. Liu, 2013, Nucleic acids research.

Genetic predisposition to neuroblastoma results from a regulatory polymorphism that promotes the adrenergic cell state

R. Young, J. Joung, J. Maris, 2023, The Journal of clinical investigation.

Gene editing without ex vivo culture evades genotoxicity in human hematopoietic stem cells

Shondra M. Pruett-Miller, J. Joung, V. Pattanayak, 2023, bioRxiv.

Impact of Genetic Variation on CRISPR-Cas Targeting.

Matthew C. Canver, J. Joung, C. CanverMatthew, 2018, The CRISPR journal.

DNA Binding Made Easy

J. Joung, D. Voytas, 2009, Science.

Analysis and comparison of genome editing using CRISPResso2

Luca Pinello, Matthew C. Canver, David R. Liu, 2018, bioRxiv.

CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells

J. Joung, Julian Grünewald, Ronghao Zhou, 2020, Nature Biotechnology.

Enhancing CRISPR prime editing by reducing misfolded pegRNA interactions

J. Joung, J.-R. Joanna Yeh, Karl Petri, 2023, bioRxiv.

Engineering Cys2His2 zinc finger domains using a bacterial cell-based two-hybrid selection system.

J. Joung, Stacey Thibodeau-Beganny, 2007, Methods in molecular biology.

Gene therapy comes of age

J. Joung, M. Sadelain, K. Ozawa, 2018, Science.

FLASH Assembly of TALENs Enables High-Throughput Genome Editing

Jeffry D. Sander, J. Joung, S. Tsai, 2012, Nature Biotechnology.

CRISPR-Cas systems for editing, regulating and targeting genomes

Jeffry D. Sander, J. Joung, 2014, Nature Biotechnology.

Engineering Designer Transcription Activator‐‐Like Effector Nucleases (TALENs) by REAL or REAL‐Fast Assembly

Jeffry D. Sander, J. Joung, D. Reyon, 2012, Current protocols in molecular biology.

Zinc-finger Nucleases: The Next Generation Emerges.

J. Joung, T. Cathomen, 2008, Molecular therapy : the journal of the American Society of Gene Therapy.

Efficient In Vivo Genome Editing Using RNA-Guided Nucleases

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013 .

Genome Editing in Human Cells Using CRISPR/Cas Nucleases

J. Joung, S. Tsai, Nicolas Wyvekens, 2015, Current protocols in molecular biology.

Chromatin regulation at the frontier of synthetic biology

Albert J. Keung, Ahmad S. Khalil, J. Joung, 2015, Nature Reviews Genetics.

A Combined Yeast/Bacteria Two-hybrid System

J. Joung, E. Golemis, C. Vinson, 2005, Molecular & Cellular Proteomics.

A combined yeast / bacterial two-hybrid system ( YBTH ) : development and evaluation

J. Joung, E. Golemis, C. Vinson, 2009 .

Targeted DNA Demethylation and Endogenous Gene Activation Using Programmable TALE-TET1 Fusions

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013, Nature Biotechnology.

Zinc-finger nucleases for somatic gene therapy: the next frontier.

Morgan L. Maeder, J. Joung, T. Cathomen, 2011, Human gene therapy.

Genetic strategy for analyzing specificity of dimer formation: Escherichia coli cyclic AMP receptor protein mutant altered in its dimerization specificity.

J. Joung, C. Yu, A. Hochschild, 1995, Genes & development.

Targeted DNA Demethylation and Endogenous Gene Activation Using Programmable TALE-TET1 Fusions

Jeffry D. Sander, Morgan L. Maeder, J. Joung, 2013 .

Targeted mutagenesis of zebrafish antithrombin III triggers disseminated intravascular coagulation and thrombosis, revealing insight into function.

Morgan L. Maeder, Andy H. Vo, J. Joung, 2014, Blood.

Zinc Finger Targeter (ZiFiT): an engineered zinc finger/target site design tool

Jeffry D. Sander, J. Joung, D. Voytas, 2007, Nucleic Acids Res..

Therapeutic base editing of human hematopoietic stem cells

Chunyan Ren, Luca Pinello, J. Keith Joung, 2020, Nature Medicine.