D. Brenner

D. Brenner, D. Nelson, J. Teckman, 2012, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Expression by Inhibiting Inhibitory Factor I-Activation and Proinflammatory Gene B κ Curcumin Blocks Cytokine-Mediated NF-Balfour Sartor

D. Brenner, M. Russo, R. Sartor, 1999 .

Jun kinase modulates tumor necrosis factor–dependent apoptosis in liver cells

M. Manns, C. Trautwein, D. Brenner, 2002, Hepatology.

Mediation by NF-κB of cytokine induced expression of intercellular adhesion molecule 1 (ICAM-1) in an intestinal epithelial cell line, a process blocked by proteasome inhibitors

D. Brenner, C. Hellerbrand, D. Brenner, 1998, Gut.

IkappaBalpha gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-alpha-mediated cell death.

D. Brenner, A. Baldwin, D. Guttridge, 1999, American journal of respiratory cell and molecular biology.

I κ B α Gene Transfer Is Cytotoxic to Squamous-Cell Lung Cancer Cells and Sensitizes Them to Tumor Necrosis Factor- α –Mediated Cell Death

D. Brenner, A. Baldwin, D. Guttridge, 1999 .

Liver fibrogenesis: a new role for the renin-angiotensin system.

D. Brenner, R. Bataller, P. Sancho-Bru, 2005, Antioxidants & redox signaling.

Systemic infusion of angiotensin II exacerbates liver fibrosis in bile duct–ligated rats

Christopher J. Parsons, D. Brenner, R. Bataller, 2005, Hepatology.

Development of a new, simple rat model of early alcohol‐induced liver injury based on sensitization of kupffer cells

D. Brenner, P. Schemmer, R. Thurman, 1999, Hepatology.

Intestinal FXR: A New Therapeutic Target for Nonalcoholic Fatty Liver Disease

D. Brenner, J. M. Suh, R. Evans, 2015 .

Regular Articlec-Jun Does Not Mediate Hepatocyte Apoptosis Following NFκB Inhibition and Partial Hepatectomy☆

D. Brenner, R. Rippe, L. Schrum, 2000 .

Hepatitis C virus–induced oxidative stress suppresses hepcidin expression through increased histone deacetylase activity

D. Brenner, Kouichi Miura, B. Schnabl, 2008, Hepatology.

Differential regulation of hepatocyte DNA synthesis by cAMP in vitro in vivo.

D. Brenner, J. Westwick, C. Bradham, 1996, The American journal of physiology.

Inactivation of plasmid reporter gene expression by one benzo(a)pyrene diol-epoxide DNA adduct in adult rat hepatocytes.

D. Brenner, H. Leffert, K. Koch, 1993, Cancer research.

Gastric bypass surgery improves metabolic and hepatic abnormalities associated with nonalcoholic fatty liver disease.

D. Brenner, S. Klein, E. Seki, 2006, Gastroenterology.

Migration of fibrocytes in fibrogenic liver injury.

D. Brenner, C. Glass, Y. Paik, 2011, The American journal of pathology.

DNA methylation represses the murine alpha 1(I) collagen promoter by an indirect mechanism

D. Brenner, M. Nehls, R. Rippe, 1994 .

Identification of c-fos-responsive elements downstream of TAR in the long terminal repeat of human immunodeficiency virus type-1.

D. Brenner, M. Kagnoff, K. Roebuck, 1993, The Journal of clinical investigation.

Transcription factors nuclear factor I and Sp1 interact with the murine collagen alpha 1 (I) promoter

D. Brenner, M. Nehls, R. Rippe, 1991, Molecular and cellular biology.

Murine Collagen (xl(I) Promoter

D. Brenner, M. Nehls, R. Rippe, 2022 .

c‐Jun N‐terminal kinase signaling in the pathogenesis of nonalcoholic fatty liver disease: Multiple roles in multiple steps

D. Brenner, Y. Kodama, 2009, Hepatology.

c-Jun N-terminal kinase-1 from hematopoietic cells mediates progression from hepatic steatosis to steatohepatitis and fibrosis in mice.

K. Iwaisako, D. Brenner, Kouichi Miura, 2009, Gastroenterology.

Association between Serum Interleukin-6 Concentrations and Mortality in Older Adults: The Rancho Bernardo Study

D. Brenner, E. Barrett-Connor, R. Loomba, 2012, PloS one.

Sp1 binding activity increases in activated Ito cells

D. Brenner, R. Rippe, G. Almounajed, 1995, Hepatology.

Mithramycin selectively inhibits collagen-alpha 1(I) gene expression in human fibroblast.

D. Brenner, M. Nehls, F. Herrmann, 1993, The Journal of clinical investigation.

Correlation between liver histology and novel magnetic resonance imaging in adult patients with non‐alcoholic fatty liver disease – MRI accurately quantifies hepatic steatosis in NAFLD

D. Brenner, C. Sirlin, M. Peterson, 2012, Alimentary pharmacology & therapeutics.

Prevents Apoptosis and Liver Dysfunction during Liver Regeneration

D. Brenner, C. Hellerbrand, J. Grisham, 1998 .

What's new in liver fibrosis? The origin of myofibroblasts in liver fibrosis

K. Iwaisako, D. Brenner, T. Kisseleva, 2012, Journal of gastroenterology and hepatology.

Fibrogenesis of parenchymal organs.

D. Brenner, T. Kisseleva, 2008, Proceedings of the American Thoracic Society.

Genetic and nongenetic factors associated with fibrosis progression in different types of chronic liver diseases

D. Brenner, R. Bataller, 2005 .

Analysis of Signaling Protein Kinases in Human Colon or Colorectal Carcinomas

D. Brenner, L. Licato, 1998, Digestive Diseases and Sciences.

Hydrogen peroxide-induced liver cell necrosis is dependent on AP-1 activation.

D. Brenner, M. Czaja, C. Bradham, 1997, The American journal of physiology.

Reperfusion after liver transplantation in rats differentially activates the mitogen‐activated protein kinases

D. Brenner, Y. Hannun, C. Bradham, 1997, Hepatology.

Immunosuppression, hepatitis B virus variants: Synergistic role in hepatic fibrogenesis.

D. Brenner, Y. Paik, 2006, Gastroenterology.

Decreasing fibrogenesis: an immunohistochemical study of paired liver biopsies following lamivudine therapy for chronic hepatitis B.

D. Brenner, E. Schiff, Z. Goodman, 2001, Journal of hepatology.

YIPF6 controls sorting of FGF21 into COPII vesicles and promotes obesity

D. Brenner, R. Evans, M. Downes, 2019, Proceedings of the National Academy of Sciences.

Serum γ-glutamyltranspeptidase predicts all-cause, cardiovascular and liver mortality in older adults.

D. Brenner, E. Barrett-Connor, R. Loomba, 2013, Journal of clinical and experimental hepatology.

Mechanisms of liver fibrosis and its role in liver cancer

D. Brenner, D. Dhar, T. Kisseleva, 2020, Experimental biology and medicine.

Increased Risk of Death, in the Hospital and Outside the Intensive Care Unit, for Patients With Cirrhosis After Cardiac Arrest

D. Brenner, T. Savides, R. Loomba, 2017, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Collagen remodeling dictates pancreatic cancer bioenergetics and outcome through DDR1 activation or degradation

Christian M. Metallo, R. Schwabe, D. Brenner, 2022, bioRxiv.

IL-17 signaling in steatotic hepatocytes and macrophages promotes hepatocellular carcinoma in alcohol-related liver disease.

Y. Koyama, D. Brenner, L. Alexandrov, 2019, Journal of hepatology.

Fibrocyte-like cells recruited to the spleen support innate and adaptive immune responses to acute injury or infection

V. Nizet, D. Brenner, C. Glass, 2011, Journal of Molecular Medicine.

Collagen Formation Assessed by N‐Terminal Propeptide of Type 3 Procollagen Is a Heritable Trait and Is Associated With Liver Fibrosis Assessed by Magnetic Resonance Elastography

M. Karsdal, D. Brenner, C. Sirlin, 2019, Hepatology.

Liver Regeneration Is Suppressed in Small-for-Size Liver Grafts after Transplantation: Involvement of c-Jun N-terminal Kinase, Cyclin D1, and Defective Energy Supply

R. Schwabe, D. Brenner, Lihua He, 2006, Transplantation.

Differential requirement for NF-κB-inducing kinase in the induction of NF-κB by IL-1β, TNF-α, and Fas

D. Brenner, A. Manning, M. Russo, 2002 .

running title: Role of NIK in NF-κB signaling.

D. Brenner, A. Manning, M. Russo, 2002 .

In Vivo Pattern of Lipopolysaccharide and Anti-CD3-Induced NF-κB Activation Using a Novel Gene-Targeted Enhanced GFP Reporter Gene Mouse1

D. Brenner, C. Jobin, S. Magness, 2004, The Journal of Immunology.

TNF Receptor-Associated Factor-2 Is Involved in Both IL-1β and TNF-α Signaling Cascades Leading to NF-κB Activation and IL-8 Expression in Human Intestinal Epithelial Cells

D. Brenner, R. Sartor, C. Jobin, 1999, The Journal of Immunology.

Growth inhibitory properties of endothelin-1 in activated human hepatic stellate cells: a cyclic adenosine monophosphate-mediated pathway. Inhibition of both extracellular signal-regulated kinase and c-Jun kinase and upregulation of endothelin B receptors.

D. Brenner, D. Dhumeaux, A. Mallat, 1996, The Journal of clinical investigation.

NADPH Oxidase 1 in Liver Macrophages Promotes Inflammation and Tumor Development in Mice.

Y. Koyama, D. Brenner, M. Karin, 2019, Gastroenterology.

JNK mediates hepatic ischemia reperfusion injury.

D. Brenner, G. K. Bilter, J. Westwick, 2005, Journal of hepatology.

Different mechanisms decrease hepatic collagen and albumin production in fasted rats

D. Brenner, M. Chojkier, B. Peterkofsky, 1988, Hepatology.

Tumor Necrosis Factor-a Inhibits Albumin

D. Brenner, M. Buck, M. Chojkier, 2022 .

Kupffer cell-derived prostaglandin E(2) is involved in alcohol-induced fat accumulation in rat liver.

D. Brenner, N. Enomoto, K. Ikejima, 2000, American journal of physiology. Gastrointestinal and liver physiology.

Corn oil rapidly activates nuclear factor-kappaB in hepatic Kupffer cells by oxidant-dependent mechanisms.

I. Rusyn, D. Brenner, J. Swenberg, 1999, Carcinogenesis.

Estrogen increases sensitivity of hepatic Kupffer cells to endotoxin

D. Brenner, N. Enomoto, K. Ikejima, 1998 .

Alcohol causes both tolerance and sensitization of rat Kupffer cells via mechanisms dependent on endotoxin.

D. Brenner, N. Enomoto, K. Ikejima, 1998, Gastroenterology.

Estrogen increases sensitivity of hepatic Kupffer cells to endotoxin.

D. Brenner, N. Enomoto, K. Ikejima, 1998, American journal of physiology. Gastrointestinal and liver physiology.

Hydrogen peroxide-induced liver cell necrosis is dependent on AP-1 activation.

D. Brenner, M. Czaja, C. Bradham, 1997, American journal of physiology. Gastrointestinal and liver physiology.

Cytokines induce NF-kappaB in activated but not in quiescent rat hepatic stellate cells.

D. Brenner, C. Hellerbrand, R. Sartor, 1998, The American journal of physiology.

Role of Gut Microbiota in Liver Disease.

D. Brenner, Y. Paik, B. Schnabl, 2015, Journal of clinical gastroenterology.

Of Mice and Men and Nonalcoholic Steatohepatitis

D. Brenner, 2018, Hepatology.

Of mice and men and NASH

D. Brenner, 2018 .

Serum levels of alanine aminotransferase decrease with age in longitudinal analysis.

D. Brenner, E. Barrett-Connor, R. Loomba, 2012, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Association between novel MRI‐estimated pancreatic fat and liver histology‐determined steatosis and fibrosis in non‐alcoholic fatty liver disease

D. Brenner, C. Sirlin, M. Peterson, 2013, Alimentary pharmacology & therapeutics.

Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression

D. Brenner, J. Olefsky, Hiroyasu Ito, 2011, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Daniel G. Anderson, Kevin J. Kauffman, D. Brenner, 2017, Molecular therapy. Nucleic acids.

Salicylate enhances necrosis and apoptosis mediated by the mitochondrial permeability transition.

D. Brenner, J. Lemasters, T. Qian, 2003, Toxicological sciences : an official journal of the Society of Toxicology.

Enhanced sensitivity to DSS colitis caused by a hypomorphic Mbtps1 mutation disrupting the ATF6-driven unfolded protein response

D. Brenner, B. Beutler, Xiaohong Li, 2009, Proceedings of the National Academy of Sciences.

The Role of NADPH Oxidases (NOXs) in Liver Fibrosis and the Activation of Myofibroblasts

D. Brenner, T. Kisseleva, Shuang Liang, 2016, Front. Physiol..

Gut Microbiome-Based Metagenomic Signature for Non-invasive Detection of Advanced Fibrosis in Human Nonalcoholic Fatty Liver Disease.

J. Venter, S. Yooseph, N. Schork, 2019, Cell metabolism.

Serum bile acid patterns are associated with the presence of NAFLD in twins, and dose‐dependent changes with increase in fibrosis stage in patients with biopsy‐proven NAFLD

D. Brenner, M. Valasek, R. Loomba, 2018, Alimentary pharmacology & therapeutics.

Weight Loss Decreases Magnetic Resonance Elastography Estimated Liver Stiffness in Nonalcoholic Fatty Liver Disease

D. Brenner, C. Sirlin, R. Loomba, 2017, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Minimizing oxidative stress by gene delivery of superoxide dismutase accelerates regeneration after transplantation of reduced‐size livers in the rat

T. Luedde, R. Schwabe, D. Brenner, 2006, Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society.

Fibroblast growth factor inducible 14 as potential target in patients with alcoholic hepatitis

D. Brenner, B. Schnabl, 2012, Gut.

Long-term alcohol exposure changes sensitivity of rat Kupffer cells to lipopolysaccharide

D. Brenner, N. Enomoto, Y. Takei, 2001 .

Role of Kupffer cells and gut‐derived endotoxins in alcoholic liver injury1

D. Brenner, N. Enomoto, Y. Takei, 2000, Journal of gastroenterology and hepatology.

Moderate alcohol drinking: effects on the heart and liver.

D. Brenner, 2000, Gastroenterology.

Pronase destroys the lipopolysaccharide receptor CD14 on Kupffer cells.

D. Brenner, N. Enomoto, K. Ikejima, 1999, The American journal of physiology.

Pronase destroys the lipopolysaccharide receptor CD14 on Kupffer cells.

D. Brenner, N. Enomoto, K. Ikejima, 1999, American journal of physiology. Gastrointestinal and liver physiology.

I. TNF-induced liver injury.

M. Manns, C. Trautwein, D. Brenner, 1998, American journal of physiology. Gastrointestinal and liver physiology.

themes Mechanisms of Hepatic Toxicity I . TNF-induced liver injury

M. Manns, C. Trautwein, D. Brenner, 1998 .

INCREASED LIVER INJURY IN FEMALE RATS IS DUE TO HYPOXIA‐REOXYGENATION TRIGGERED BY ENDOTOXIN AND KUPFFER CELLS

D. Brenner, B. Stefanovic, N. Enomoto, 1998 .

PNPLA3 downregulation exacerbates the fibrotic response in human hepatic stellate cells

D. Brenner, M. Erion, Brian Rady, 2021, PloS one.

Akt activation protects rat liver from ischemia/reperfusion injury.

D. Brenner, E. Hatano, Y. Yamaoka, 2004, The Journal of surgical research.

Immortal Activated Human Hepatic Stellate Cells Generated by Ectopic Telomerase Expression

D. Brenner, C. Hagedorn, J. Olsen, 2002, Laboratory Investigation.

Analysis of RNA transcripts for HLA class II genes in human small intestinal biopsies.

D. Brenner, M. Kagnoff, B. Volk, 1989, Gut.

Mechanisms of hepatic toxicity. I. TNF-induced liver injury.

M. Manns, C. Trautwein, D. Brenner, 1998, The American journal of physiology.

Tumor necrosis factor-alpha inhibits albumin gene expression in a murine model of cachexia.

D. Brenner, M. Buck, M. Chojkier, 1990, The Journal of clinical investigation.

Toll‐like receptor 2 and palmitic acid cooperatively contribute to the development of nonalcoholic steatohepatitis through inflammasome activation in mice

D. Brenner, N. Van Rooijen, Kouichi Miura, 2013, Hepatology.

[35] Methods for analyzing c-Jun kinase

D. Brenner, J. Westwick, 1995 .

Regulation of TNF-α- and Fas-Induced Hepatic Apoptosis by NF-κB

R. Schwabe, D. Brenner, E. Hatano, 2002 .

Tumor necrosis factor α prevents tumor necrosis factor receptor—mediated mouse hepatocyte apoptosis, but not fas‐mediated apoptosis: Role of nuclear factor‐κB

D. Brenner, S. Nakashima, Y. Banno, 2000 .

Proto-oncogenes/ transcription factors

D. Brenner, J. Westwick, 1998 .

DNase I–hypersensitive sites enhance α1(I) collagen gene expression in hepatic stellate cells

D. Brenner, Y. Yata, R. Rippe, 2003 .

L-glutamine stimulates intestinal cell proliferation and activates mitogen-activated protein kinases.

D. Brenner, J. Westwick, A. Cox, 1997, The American journal of physiology.

Insulin-like growth factor-I and epidermal growth factor interact to regulate growth and gene expression in IEC-6 intestinal epithelial cells.

D. Brenner, J. Westwick, P. Lund, 1995, Molecular endocrinology.

NF-κB activation in Kupffer cells after partial hepatectomy

D. Brenner, R. Bataller, R. Rippe, 2005 .

Expression of intracellular adhesion molecule 1 by activated hepatic stellate cells

D. Brenner, C. Hellerbrand, R. Rippe, 1996, Hepatology.

Nonalcoholic fatty liver disease with cirrhosis increases familial risk for advanced fibrosis

N. Schork, D. Brenner, C. Sirlin, 2017, The Journal of clinical investigation.

TRAIL‐mediated apoptosis requires NF‐kB inhibition and the mitochondrial permeability transition in human hepatoma cells

R. Schwabe, D. Brenner, J. Lemasters, 2002 .

Angiotensin‐converting‐enzyme 2 inhibits liver fibrosis in mice

D. Brenner, J. Penninger, E. Seki, 2009, Hepatology.

Heme content of normal and porphyric cultured skin fibroblasts

D. Brenner, J. Bloomer, 1977, Biochemical Genetics.

Long-term alcohol exposure changes sensitivity of rat Kupffer cells to lipopolysaccharide.

D. Brenner, N. Enomoto, Y. Takei, 2000, Alcoholism: Clinical and Experimental Research.

Toll-like receptor 2-mediated intestinal injury and enteric tumor necrosis factor receptor I contribute to liver fibrosis in mice.

D. Brenner, M. Haimerl, B. Schnabl, 2012, Gastroenterology.

Roles of AKT and sphingosine kinase in the antiapoptotic effects of bile duct ligation in mouse liver

D. Brenner, Y. Hannun, R. Proia, 2005, Hepatology.

TNF α is required for cholestasis-induced liver fibrosis in the mouse

D. Brenner, J. Schölmerich, G. Arteel, 2016 .

Metabolic Injury of Hepatocytes Promotes Progression of NAFLD and AALD.

Lei Zhang, D. Brenner, M. Karin, 2022, Seminars in liver disease.

Inhibition of prolyl hydroxylases increases hepatic insulin and decreases glucagon sensitivity by an HIF-2α-dependent mechanism

D. Brenner, M. Riopel, Y. S. Lee, 2020, Molecular metabolism.

Pericytes and perivascular fibroblasts are the primary source of collagen-producing cells in obstructive fibrosis of the kidney.

D. Brenner, J. Duffield, Shuei-Liong Lin, 2008, The American journal of pathology.

Magnetic resonance elastography vs. transient elastography in detection of fibrosis and noninvasive measurement of steatosis in patients with biopsy-proven nonalcoholic fatty liver disease

D. Brenner, C. Sirlin, M. Valasek, 2017 .

Aberrant iron distribution via hepatocyte-stellate cell axis drives liver lipogenesis and fibrosis.

D. Brenner, Gaowei Wang, T. Kisseleva, 2022, Cell metabolism.

κby Inhibiting Inhibitory Factor I- Activation and Proinflammatory Gene B κ Curcumin Blocks Cytokine-Mediated NF-

D. Brenner, M. Russo, C. Bradham, 2013 .

Inhibition of NFκB in activated rat hepatic stellate cells by proteasome inhibitors and an IκB super‐repressor

D. Brenner, C. Hellerbrand, R. Sartor, 1998 .

24. NF-κB

D. Brenner, Ekihiro Seki and, 2015 .

Deletion of IKK2 in hepatocytes does not sensitize these cells to TNF-induced apoptosis but protects from ischemia/reperfusion injury.

T. Luedde, M. Manns, C. Trautwein, 2005, The Journal of clinical investigation.

c‐Jun‐N‐terminal kinase drives cyclin D1 expression and proliferation during liver regeneration

R. Schwabe, D. Brenner, E. Hatano, 2003, Hepatology.

Nuclear factor κB in proliferation, activation, and apoptosis in rat hepatic stellate cells

D. Brenner, R. Rippe, A. Lang, 2000 .

Nuclear factor kappaB in proliferation, activation, and apoptosis in rat hepatic stellate cells.

D. Brenner, R. Rippe, A. Lang, 2000, Journal of hepatology.

Concanavalin A-induced liver cell damage: activation of intracellular pathways triggered by tumor necrosis factor in mice.

M. Manns, C. Trautwein, D. Brenner, 1998, Gastroenterology.

Origin of myofibroblasts in liver fibrosis

K. Iwaisako, D. Brenner, Y. Paik, 2012, Fibrogenesis & tissue repair.

Inhibition of nuclear factor κB and phosphatidylinositol 3‐kinase/Akt is essential for massive hepatocyte apoptosis induced by tumor necrosis factor α in mice

D. Brenner, T. Asano, Y. Osawa, 2003, Liver international : official journal of the International Association for the Study of the Liver.

Gastrointestinal basic science 2002-2003: the year in review.

D. Brenner, 2004, Clinical Gastroenterology and Hepatology.

c-Jun N-Terminal Kinase Mediates Hepatic Injury after Rat Liver Transplantation

D. Brenner, B. Bennett, J. Lemasters, 2004, Transplantation.

Role of hepatic stellate cells in fibrogenesis and the reversal of fibrosis

D. Brenner, T. Kisseleva, 2007, Journal of gastroenterology and hepatology.

Activation of activating protein 1 during hepatic acute phase response.

D. Brenner, M. Karin, J. Westwick, 1993, The American journal of physiology.

The role of human cytochrome P450 2E1 in liver inflammation and fibrosis

Y. Koyama, D. Brenner, E. Dennis, 2017, Hepatology communications.

Tumor necrosis factor alpha inhibits collagen gene transcription and collagen synthesis in cultured human fibroblasts.

D. Brenner, M. Chojkier, J. Solís-Herruzo, 1988, The Journal of biological chemistry.

Anandamide induces necrosis in primary hepatic stellate cells

R. Schwabe, D. Brenner, Y. Osawa, 2005, Hepatology.

From biochemical analysis to targeted therapies

D. Brenner, P. Petrides, 2012, Fibrogenesis & Tissue Repair.

Methods for analyzing c-Jun kinase.

D. Brenner, J. Westwick, 1995, Methods in enzymology.

Targeting the Wnt signaling pathway through R-spondin 3 identifies an anti-fibrosis treatment strategy for multiple organs

D. Brenner, J. Lachowicz, A. Gurney, 2020, PloS one.

Hepatocytes Pathways Inhibits Cell Apoptosis in Human Phosphatidylinositol 3-Kinase / Akt B and κ Interleukin-8 Production via NF-Tumor Necrosis Factor Alpha-Induced

D. Brenner, T. Asano, S. Nakashima, 2002 .

Expression of small heat shock protein alphaB-crystallin is induced after hepatic stellate cell activation.

D. Brenner, L. Schrum, R. Rippe, 2000, American journal of physiology. Gastrointestinal and liver physiology.

Recent advances in liver stem cell therapy

D. Brenner, T. Kisseleva, E. Gigante, 2010, Current opinion in gastroenterology.

HIV-1 infection and expression in human colonic cells: infection and expression in CD4+ and CD4- cell lines.

D. Richman, D. Brenner, M. Omary, 1991, AIDS.

Up‐regulated eotaxin plasma levels in chronic liver disease patients indicate hepatic inflammation, advanced fibrosis and adverse clinical course

F. Tacke, C. Trautwein, D. Brenner, 2007, Journal of gastroenterology and hepatology.

Delivery of matrix metalloproteinase-1 attenuates established liver fibrosis in the rat.

D. Brenner, B. Stefanovic, Y. Yamaoka, 2003, Gastroenterology.

Estriol sensitizes rat Kupffer cells via gut-derived endotoxin.

D. Brenner, N. Enomoto, P. Schemmer, 1999, American journal of physiology. Gastrointestinal and liver physiology.

Systemic mediators induce fibrogenic effects in normal liver after partial bile duct ligation

R. Schwabe, D. Brenner, M. Adachi, 2006, Liver international : official journal of the International Association for the Study of the Liver.

Cellular Differentiation Causes a Selective Down-regulation of Interleukin (IL)-1β-mediated NF-κB Activation and IL-8 Gene Expression in Intestinal Epithelial Cells*

D. Brenner, A. Schottelius, R. Sartor, 2000, The Journal of Biological Chemistry.

New Developments on the Treatment of Liver Fibrosis

Y. Koyama, D. Brenner, Jun Xu, 2016, Digestive Diseases.

Promising Therapy Candidates for Liver Fibrosis

Y. Koyama, D. Brenner, I. Kim, 2016, Front. Physiol..

New therapies for hepatic fibrosis.

Y. Koyama, D. Brenner, 2015, Clinics and research in hepatology and gastroenterology.

Human Hepatocytes Phosphatidylinositol 3-Kinase / Akt Pathway Inhibits Apoptosis Through a-Induced Sphingosine 1-Phosphate

D. Brenner, S. Nakashima, Y. Banno, 2001 .

toll-like receptors their downstream molecules in the development of nonalcoholic Fatty liver disease.

D. Brenner, E. Seki, H. Ohnishi, 2011 .

MiR-690 treatment causes decreased fibrosis and steatosis and restores specific Kupffer cell functions in NASH.

D. Brenner, J. Olefsky, Soheil Pourshahian, 2022, Cell metabolism.

Molecular pathogenesis of liver fibrosis.

D. Brenner, 2009, Transactions of the American Clinical and Climatological Association.

In vivo activation of mitogen-activated protein kinases in rat intestinal neoplasia.

D. Brenner, J. Woosley, R. Sandler, 1997, Gastroenterology.

Inhibition of Collagen α1(I) Expression by the 5′ Stem-Loop as a Molecular Decoy*

D. Brenner, B. Stefanovic, B. Schnabl, 2002, The Journal of Biological Chemistry.

Inhibition of collagen alpha 1(I) expression by the 5' stem-loop as a molecular decoy.

D. Brenner, B. Stefanovic, B. Schnabl, 2002, The Journal of biological chemistry.

Characterization of the interaction between alphaCP(2) and the 3'-untranslated region of collagen alpha1(I) mRNA.

D. Brenner, B. Stefanovic, J. Lindquist, 2000, Nucleic acids research.

Sphingosine kinase 1 promotes liver fibrosis by preventing miR‐19b‐3p‐mediated inhibition of CCR2

D. Brenner, Guizhi Yang, Yue Sun, 2018, Hepatology.

IL-17 Signaling in Steatotic Hepatocytes and Macrophages Promotes Alcoholic Liver Disease-induced Hepatocellular Carcinoma

Pnina, Y. Koyama, D. Brenner, 2020 .

Traditional Chinese Medicine Fuzheng Huayu Prevents Development of Liver Fibrosis in Mice

K. Iwaisako, D. Brenner, T. Hassanein, 2020, Archives of clinical and biomedical research.

Non‐alcoholic steatohepatitis‐induced fibrosis: Toll‐like receptors, reactive oxygen species and Jun N‐terminal kinase

K. Iwaisako, D. Brenner, Y. Paik, 2011, Hepatology research : the official journal of the Japan Society of Hepatology.

Previous liver regeneration induces fibro-protective mechanisms during thioacetamide-induced chronic liver injury.

D. Brenner, R. Carlessi, J. Olynyk, 2021, The international journal of biochemistry & cell biology.

Oxidative stress in alcoholic liver disease: Role of NADPH oxidase complex

D. Brenner, S. de Minicis, 2008, Journal of gastroenterology and hepatology.

NADPH oxidase in the liver: defensive, offensive, or fibrogenic?

D. Brenner, R. Bataller, S. de Minicis, 2006, Gastroenterology.

Three distinct cell populations express extracellular matrix proteins and increase in number during skeletal muscle fibrosis.

D. Brenner, R. Lieber, S. Subramaniam, 2017, American journal of physiology. Cell physiology.

Curcumin Blocks Cytokine-Mediated NF-κB Activation and Proinflammatory Gene Expression by Inhibiting Inhibitory Factor I-κB Kinase Activity

D. Brenner, M. Russo, R. Sartor, 1999, The Journal of Immunology.

Effects of losartan on hepatic expression of nonphagocytic NADPH oxidase and fibrogenic genes in patients with chronic hepatitis C.

D. Brenner, R. Bataller, X. Forns, 2009, American journal of physiology. Gastrointestinal and liver physiology.

A Universal Gut-Microbiome-Derived Signature Predicts Cirrhosis.

D. Brenner, C. Sirlin, R. Evans, 2020, Cell Metabolism.

Hepatic stellate cells secrete angiopoietin 1 that induces angiogenesis in liver fibrosis.

K. Iwaisako, D. Brenner, E. Hatano, 2008, Gastroenterology.

Toll-like receptor signaling in the liver.

R. Schwabe, D. Brenner, E. Seki, 2006, Gastroenterology.

I B (cid:97) Gene Transfer Is Cytotoxic to Squamous-Cell Lung Cancer Cells and Sensitizes Them to Tumor Necrosis Factor- (cid:97) –Mediated Cell Death

D. Brenner, A. Baldwin, D. Guttridge, 1999 .

A molecular defect in human protoporphyria.

D. Brenner, G. Evans, H. Dailey, 1992, American journal of human genetics.

Comparison of cathepsin L synthesized by normal and transformed cells at the gene, message, protein, and oligosaccharide levels.

D. Brenner, G. Sahagian, N. A. Stearns, 1990, Archives of biochemistry and biophysics.

Heterogeneity of HSCs in a Mouse Model of NASH

D. Brenner, C. Glass, S. Rosenthal, 2021, Hepatology.

DNA methylation represses the murine alpha 1(I) collagen promoter by an indirect mechanism

D. Brenner, M. Nehls, R. Rippe, 1994, Molecular and cellular biology.

Differential requirement for NF-kappaB-inducing kinase in the induction of NF-kappaB by IL-1beta, TNF-alpha, and Fas.

D. Brenner, A. Manning, M. Russo, 2002, American journal of physiology. Cell physiology.

Deficiency of NOX1 or NOX4 Prevents Liver Inflammation and Fibrosis in Mice through Inhibition of Hepatic Stellate Cell Activation

D. Brenner, T. Lan, T. Kisseleva, 2015, PloS one.

Mechanisms of alcohol‐induced hepatic fibrosis: A summary of the Ron Thurman Symposium

D. Brenner, V. Purohit, 2006, Hepatology.

Expression of Intercellular Adhesion Molecule 1 by Activated Hepatic Stellate Cells

D. Brenner, C. Hellerbrand, R. Rippe, 1998 .

NF-kappaB inactivation converts a hepatocyte cell line TNF-alpha response from proliferation to apoptosis.

D. Brenner, M. Czaja, R. Kitsis, 1998, The American journal of physiology.

TAK1/JNK and p38 have opposite effects on rat hepatic stellate cells

D. Brenner, B. Stefanovic, A. Manning, 2001, Hepatology.

Cytokines induce NF- (cid:107) B in activated but not in quiescent rat hepatic stellate cells

D. Brenner, C. Hellerbrand, R. Sartor, 1998 .

IL-17 Signaling Promotes Excessive Alcoholic Liver Disease and Excessive Alcohol Drinking in Mice

D. Brenner, K. Ikejima, 2021, Juntendo Medical Journal.

Cytokines induce NF-κB in activated but not in quiescent rat hepatic stellate cells.

D. Brenner, C. Hellerbrand, R. Sartor, 1998, American journal of physiology. Gastrointestinal and liver physiology.

NF- k B Stimulates Inducible Nitric Oxide Synthase to Protect Mouse Hepatocytes From TNF- a – and Fas-Mediated Apoptosis

D. Brenner, A. Manning, E. Hatano, 2001 .

d-alpha-tocopherol inhibits collagen alpha 1(I) gene expression in cultured human fibroblasts. Modulation of constitutive collagen gene expression by lipid peroxidation.

D. Brenner, M. Chojkier, K. Houglum, 1991, The Journal of clinical investigation.

Transforming Growth Factor-α Stimulates Proto-Oncogene c-jun Expression and a Mitogenic Program in Primary Cultures of Adult Rat Hepatocytes

D. Brenner, H. Leffert, K. Koch, 1989 .

d-a-Tocopherol Inhibits Collagen a . ( l ) Gene Expression in Cultured Human Fibroblasts Modulation of Constitutive Collagen Gene Expression by Lipid Peroxidation

D. Brenner, M. Chojkier, K. Houglum, 2022 .

Interleukin-17 signaling in inflammatory, Kupffer cells, and hepatic stellate cells exacerbates liver fibrosis in mice.

K. Iwaisako, D. Brenner, K. Ley, 2012, Gastroenterology.

Lipopolysaccharide-binding protein modulates hepatic damage and the inflammatory response after hemorrhagic shock and resuscitation.

D. Brenner, I. Marzi, J. Lemasters, 2006, American journal of physiology. Gastrointestinal and liver physiology.

Activated Human Hepatic Stellate Cells Kinase and Enhances Chemokine Secretion on B and c-Jun N-Terminal κ CD40 Activates NF-

R. Schwabe, D. Brenner, Y. Kweon, 2011 .

Regulatory elements in the 5'-flanking region and the first intron contribute to transcriptional control of the mouse alpha 1 type I collagen gene

D. Brenner, R. Rippe, M. Breindl, 1989, Molecular and cellular biology.

Expression of human immunodeficiency virus-1 in human colonic cells

D. Richman, D. Brenner, M. Omary, 1991, Immunologic research.

DNA-mediated gene transfer into adult rat hepatocytes in primary culture

D. Brenner, H. Leffert, R. Rippe, 1990, Molecular and cellular biology.

Inhibition of NFkappaB in activated rat hepatic stellate cells by proteasome inhibitors and an IkappaB super-repressor.

D. Brenner, C. Hellerbrand, R. Sartor, 1998, Hepatology.

Semaphorin 7A contributes to TGF-β-mediated liver fibrogenesis.

D. Brenner, R. Bataller, M. Vivarelli, 2013, The American journal of pathology.

Transforming growth factor B and hepatic fibrosis: Cause or effect?

D. Brenner, 1991, Hepatology.

Zinc finger protein 267 is up-regulated during the activation process of human hepatic stellate cells and functions as a negative transcriptional regulator of MMP-10.

D. Brenner, B. Stefanovic, C. Hellerbrand, 2005, Biochemical and biophysical research communications.

From quiescence to activation: Gene regulation in hepatic stellate cells.

D. Brenner, R. Rippe, 2004, Gastroenterology.

Increased expression of collagenase in the liver induces hepatocyte proliferation with cytoplasmic accumulation of beta-catenin in the rat.

D. Brenner, Y. Yamaoka, Y. Iimuro, 2003, Journal of hepatology.

Hepatic stellate cell nomenclature.

Desmet, S. French, D. Brenner, 1996, Hepatology.

The CAAX peptidomimetic compound B581 specifically blocks farnesylated, but not geranylgeranylated or myristylated, oncogenic ras signaling and transformation.

D. Brenner, C. Der, J. Westwick, 1994, The Journal of biological chemistry.

L-glutamine and L-asparagine stimulate ODC activity and proliferation in a porcine jejunal enterocyte line.

H. M. Kandil, D. Brenner, J. Westwick, 1995, The American journal of physiology.

Roles for C 16-ceramide and Sphingosine 1-Phosphate in Regulating Hepatocyte Apoptosis in Response to Tumor Necrosis Factor-* □

R. Schwabe, D. Brenner, Y. Hannun, 2005 .

Mitochondrial Dysfunction in the Pathogenesis of Necrotic and Apoptotic Cell Death

John J. Lemasters, Brian Herman, Lawrence C. Trost, 1999, Journal of bioenergetics and biomembranes.

Transforming growth factor‐β1: There is regulation beyond transcription

D. Brenner, D. Brenner, 1993 .

Bradykinin attenuates hepatocellular damage and fibrosis in rats with chronic liver injury.

D. Brenner, R. Bataller, W. Jiménez, 2007, Gastroenterology.

Therapeutic strategies for hepatic fibrosis

D. Brenner, M. Chojkier, 1988, Hepatology.

Western Diet Promotes Renal Injury, Inflammation, and Fibrosis in a Murine Model of Alström Syndrome

D. Brenner, V. Vallon, D. Dhar, 2020, Nephron.

Signal transduction during liver regeneration.

D. Brenner, 1998, Journal of gastroenterology and hepatology.

Ezetimibe for the Treatment of Nonalcoholic Steatohepatitis: Assessment by Novel Magnetic Resonance Imaging and Magnetic Resonance Elastography in a Randomized Trial (MOZART Trial)

D. Brenner, R. Ehman, C. Sirlin, 2015, Hepatology.

TNF receptor-associated factor-2 is involved in both IL-1 beta and TNF-alpha signaling cascades leading to NF-kappa B activation and IL-8 expression in human intestinal epithelial cells.

D. Brenner, R. Sartor, C. Jobin, 1999, Journal of immunology.

Pathogenesis of alcoholic hepatitis

D. Brenner, D. Brenner, Sveren Sigmund, 2004 .

Thomas E. Starzl: Transplantation pioneer

D. Brenner, 2017, Proceedings of the National Academy of Sciences.

Evidence for a common progenitor of epithelial and mesenchymal components of the liver

D. Brenner, B. Sacchetti, P. Bianco, 2013, Cell Death and Differentiation.

TLR4 enhances TGF-beta signaling and hepatic fibrosis.

R. Schwabe, D. Brenner, Y. Osawa, 2007, Nature medicine.

The role of gut‐derived bacterial toxins and free radicals in alcohol‐induced liver injury

D. Brenner, G. Arteel, M. Kadiiska, 1998, Journal of gastroenterology and hepatology.

Norepinephrine induces calcium spikes and proinflammatory actions in human hepatic stellate cells.

Vicente Arroyo, D. Brenner, R. Bataller, 2006, American journal of physiology. Gastrointestinal and liver physiology.

The Fibrosis Across Organs Symposium: A Roadmap for Future Research Priorities

D. Brenner, K. Brown, L. Richeldi, 2019, The American journal of the medical sciences.

Estriol sensitizes rat Kupffer cells via gut-derived endotoxin.

D. Brenner, N. Enomoto, P. Schemmer, 1999, The American journal of physiology.

Nicotinamide adenine dinucleotide phosphate oxidase in experimental liver fibrosis: GKT137831 as a novel potential therapeutic agent

D. Brenner, Y. Paik, Sumio Watanabe, 2012, Hepatology.

Hepatic Stellate Cells Revert to an Inactive Phenotype During Regression of Fibrosis

K. Iwaisako, D. Brenner, Y. Paik, 2011 .

Alteration of Interferon-α/β Receptors in Chronic Hepatitis B Patients

D. Brenner, Y. Paik, B. Wang, 2011, Journal of Clinical Immunology.

A single promoter directs both housekeeping and erythroid preferential expression of the human ferrochelatase gene.

D. Brenner, S. Magness, Antonio Tugores, 1994, The Journal of biological chemistry.

Fibrosis research : methods and protocols

D. Brenner, J. Varga, S. Phan, 2005 .

endotoxinsensitizes rat Kupffer cells via gut-derived

D. Brenner, N. Enomoto, P. Schemmer, 2016 .

DNA Methylation Represses the Murine od(I) Collagen Promoter by an Indirect Mechanism

D. Brenner, Akihiro, Katherine, 2022 .

Comparison of human and bovine protoporphyria.

D. Brenner, J. Bloomer, 1979, The Yale journal of biology and medicine.

Far upstream regulatory elements enhance position-independent and uterus-specific expression of the murine alpha1(I) collagen promoter in transgenic mice.

D. Brenner, R. Rippe, K. Hall, 1999, Gene expression.

Mechanisms of alcoholic liver disease: cytokines.

D. Brenner, R. Cameron, B. Rehermann, 2001, Alcoholism, clinical and experimental research.

Activation of nuclear factor-kappaB during orthotopic liver transplantation in rats is protective and does not require Kupffer cells.

D. Brenner, P. Schemmer, C. Bradham, 1999, Liver transplantation and surgery : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society.

Direct Hepatotoxic Effect of KC Chemokine in the Liver Without Infiltration of Neutrophils

D. Brenner, B. Stefanovic, L. Stefanovic, 2005, Experimental biology and medicine.

Gene expression profiles during hepatic stellate cell activation in culture and in vivo.

R. Schwabe, D. Brenner, H. Uchinami, 2007, Gastroenterology.

Stimulation of collagen gene expression by ascorbic acid in cultured human fibroblasts. A role for lipid peroxidation?

D. Brenner, M. Chojkier, K. Houglum, 1989, The Journal of biological chemistry.

Ceramide Activates the Stress-activated Protein Kinases (*)

D. Brenner, A. Bielawska, Y. Hannun, 1995, The Journal of Biological Chemistry.

Serum metabolites detect the presence of advanced fibrosis in derivation and validation cohorts of patients with non-alcoholic fatty liver disease

D. Brenner, C. Sirlin, M. Valasek, 2018, Gut.

Human hepatic stellate cells express CCR5 and RANTES to induce proliferation and migration.

Ramon Bataller, R. Schwabe, D. Brenner, 2003, American journal of physiology. Gastrointestinal and liver physiology.

Toll‐like receptors and adaptor molecules in liver disease: Update

D. Brenner, E. Seki, 2008, Hepatology.

Hepatic Stellate Cells as a Target for the Treatment of Liver Fibrosis

D. Brenner, R. Bataller, D. Brenner, 2001, Seminars in liver disease.

Bacterial translocation and changes in the intestinal microbiome in mouse models of liver disease.

Derrick E Fouts, Karen E Nelson, Manolito Torralba, 2012, Journal of hepatology.

Gliotoxin-mediated apoptosis of activated human hepatic stellate cells.

D. Brenner, Y. Paik, J. Lemasters, 2003, Journal of hepatology.

The phenotypic fate and functional role for bone marrow-derived stem cells in liver fibrosis.

D. Brenner, T. Kisseleva, 2012, Journal of hepatology.

New aspects of hepatic fibrosis.

D. Brenner, B. Stefanovic, M. Yamauchi, 2000, Journal of hepatology.

Bone Morphogenetic Protein 7 is Elevated in Patients with Chronic Liver Disease and Exerts Fibrogenic Effects on Human Hepatic Stellate Cells

T. Luedde, R. Schwabe, M. Manns, 2007, Digestive Diseases and Sciences.

Liver inflammation and fibrosis.

Y. Koyama, D. Brenner, 2017, The Journal of clinical investigation.

Reduced nicotinamide adenine dinucleotide phosphate oxidase mediates fibrotic and inflammatory effects of leptin on hepatic stellate cells

R. Schwabe, D. Brenner, E. Seki, 2008, Hepatology.

The Enzymatic Defect in Variegate Porphyria

D. Brenner, J. Bloomer, 1980 .

Protective effect of human serum amyloid P on CCl4-induced acute liver injury in mice

D. Brenner, Weihua Zhao, H. Zhuang, 2017, International journal of molecular medicine.

CCR2 promotes hepatic fibrosis in mice

R. Schwabe, D. Brenner, N. Van Rooijen, 2009, Hepatology.

Liver fibrosis: signals leading to the amplification of the fibrogenic hepatic stellate cell.

D. Brenner, R. Rippe, E. Gäbele, 2003, Frontiers in bioscience : a journal and virtual library.

A fluorometric assay for measurement of protoporphyrinogen oxidase activity in mammalian tissue.

D. Brenner, J. Bloomer, 1980, Clinica chimica acta; international journal of clinical chemistry.

Study of factors causing excess protoporphyrin accumulation in cultured skin fibroblasts from patients with protoporphyria.

D. Brenner, J. Bloomer, M. J. Mahoney, 1977, The Journal of clinical investigation.

Analysis of ferrochelatase expression during hematopoietic development of embryonic stem cells.

D. Brenner, S. Magness, Antonio Tugores, 2000, Blood.

Analysis of the human ferrochelatase promoter in transgenic mice.

D. Brenner, S. Magness, Antonio Tugores, 1998, Blood.

Ferrochelatase cDNA delivered by adenoviral vector corrects biochemical defect in protoporphyric cells.

D. Brenner, S. Magness, 1995, Human gene therapy.

Prolonged activation of jun and collagenase genes by tumour necrosis factor-α

D. Brenner, M. Karin, P. Angel, 1989, Nature.

Transient induction of C‐jun during hepatic regeneration

D. Brenner, S. Feitelberg, Joseph A. Alcorn, 1990, Hepatology.

Human hepatic stellate cell isolation and characterization

D. Brenner, M. Hosseini, T. Kisseleva, 2017, Journal of Gastroenterology.

Myofibroblasts revert to an inactive phenotype during regression of liver fibrosis

Christopher K. Glass, Min Cong, David A. Brenner, 2012, Proceedings of the National Academy of Sciences.

Fibroblast-specific protein 1 identifies an inflammatory subpopulation of macrophages in the liver

C. Datz, D. Brenner, M. Karin, 2010, Proceedings of the National Academy of Sciences.

Identification of Lineage-specific Transcription Factors That Prevent Activation of Hepatic Stellate Cells and Promote Fibrosis Resolution.

Y. Koyama, D. Brenner, C. Glass, 2020, Gastroenterology.

Loss of MMP 13 attenuates murine hepatic injury and fibrosis during cholestasis

D. Brenner, J. D’Armiento, H. Uchinami, 2006, Hepatology.

Roles for C16-ceramide and Sphingosine 1-Phosphate in Regulating Hepatocyte Apoptosis in Response to Tumor Necrosis Factor-α*

R. Schwabe, D. Brenner, Y. Hannun, 2005, Journal of Biological Chemistry.

Molecular and cellular mechanisms of liver fibrosis and its regression

D. Brenner, T. Kisseleva, 2020, Nature Reviews Gastroenterology & Hepatology.

Mechanisms of Liver Injury. I. TNF-α-induced liver injury: role of IKK, JNK, and ROS pathways

David A. Brenner, R. Schwabe, D. Brenner, 2006 .

NADPH oxidase signal transduces angiotensin II in hepatic stellate cells and is critical in hepatic fibrosis.

R. Schwabe, D. Brenner, R. Bataller, 2003, The Journal of clinical investigation.

TRAM2 Protein Interacts with Endoplasmic Reticulum Ca2+ Pump Serca2b and Is Necessary for Collagen Type I Synthesis

D. Brenner, B. Stefanovic, R. Bataller, 2004, Molecular and Cellular Biology.

, Ramon Necessary for Collagen Type I Synthesis Pump Serca 2 b and Is 2 + Reticulum Ca TRAM 2 Protein Interacts with Endoplasmic

D. Brenner, B. Stefanovic, R. Bataller, 2004 .

A Universal Gut-Microbiome-Derived Signature Predicts Cirrhosis.

R. Knight, P. Dorrestein, D. Brenner, 2020, Cell metabolism.

Matrix Metalloproteinase Gene Delivery for Liver Fibrosis

D. Brenner, Y. Iimuro, 2007, Pharmaceutical Research.

Synergistic effects of family history of hepatocellular carcinoma and hepatitis B virus infection on risk for incident hepatocellular carcinoma.

Chien-Jen Chen, D. Brenner, Hwai I. Yang, 2013, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

The role of Smad3 in mediating mouse hepatic stellate cell activation

D. Brenner, Xiao-Fan Wang, J. Frederick, 2001, Hepatology.

Regulatory Role of the Conserved Stem-Loop Structure at the 5′ End of Collagen α1(I) mRNA

D. Brenner, B. Stefanovic, C. Hellerbrand, 1999, Molecular and Cellular Biology.

The gut–liver axis and the intersection with the microbiome

Justine W. Debelius, R. Knight, D. Brenner, 2018, Nature Reviews Gastroenterology & Hepatology.

Development of an animal model of chronic alcohol-induced pancreatitis in the rat.

I. Rusyn, D. Brenner, B. Stefanovic, 2001, American journal of physiology. Gastrointestinal and liver physiology.

The Mitochondrial Permeability Transition Augments Fas-induced Apoptosis in Mouse Hepatocytes*

D. Brenner, E. Hatano, C. Bradham, 2000, The Journal of Biological Chemistry.

Intestinal REG3 Lectins Protect against Alcoholic Steatohepatitis by Reducing Mucosa-Associated Microbiota and Preventing Bacterial Translocation.

D. Brenner, D. Fouts, L. Hooper, 2016, Cell host & microbe.

Alcohol, intestinal bacterial growth, intestinal permeability to endotoxin, and medical consequences: summary of a symposium.

Ali Keshavarzian, R Balfour Sartor, Radhakrishna Rao, 2008, Alcohol.

Disruption of TAK1 in hepatocytes causes hepatic injury, inflammation, fibrosis, and carcinogenesis

S. Akira, D. Brenner, Kouichi Miura, 2009, Proceedings of the National Academy of Sciences.

M2-like macrophages are responsible for collagen degradation through a mannose receptor–mediated pathway

Sven Burgdorf, David A. Brenner, Roberto Weigert, 2013, The Journal of cell biology.

Publisher Correction: The gut–liver axis and the intersection with the microbiome

Justine W. Debelius, R. Knight, D. Brenner, 2018, Nature Reviews Gastroenterology & Hepatology.

Heritability of Hepatic Fibrosis and Steatosis Based on a Prospective Twin Study.

N. Schork, D. Brenner, K. Nelson, 2015, Gastroenterology.

The Role of Focal Adhesion Kinase-Phosphatidylinositol 3-Kinase-Akt Signaling in Hepatic Stellate Cell Proliferation and Type I Collagen Expression*

David A. Brenner, D. Brenner, Y. Yata, 2003, The Journal of Biological Chemistry.

TAK1-mediated autophagy and fatty acid oxidation prevent hepatosteatosis and tumorigenesis.

Mason R. Mackey, Dorothy D. Sears, Mark Ellisman, 2014, The Journal of clinical investigation.

Bone marrow-derived fibrocytes participate in pathogenesis of liver fibrosis.

R. Schwabe, D. Brenner, J. Segovia, 2006, Journal of hepatology.

Mesothelin/mucin 16 signaling in activated portal fibroblasts regulates cholestatic liver fibrosis

Y. Koyama, K. Iwaisako, D. Brenner, 2017, The Journal of clinical investigation.

Origin of myofibroblasts in the fibrotic liver in mice

K. Iwaisako, D. Brenner, C. Glass, 2014, Proceedings of the National Academy of Sciences.

Resident fibroblast lineages mediate pressure overload-induced cardiac fibrosis.

D. Brenner, Yusu Gu, N. Dalton, 2014, The Journal of clinical investigation.

Role of Mitochondria in Apoptosis Induced by Tumor Necrosis Factor-α

C. Trautwein, D. Brenner, K. Streetz, 2002 .

Release c Cytochrome Alpha-Mediated Apoptosis and Is Required for Tumor Necrosis Factor The Mitochondrial Permeability Transition

C. Trautwein, D. Brenner, K. Streetz, 1998 .

Role of NADPH oxidases in liver fibrosis.

D. Brenner, R. Bataller, Y. Paik, 2014, Antioxidants & redox signaling.

Transcriptional Repression of the Transforming Growth Factor β (TGF-β) Pseudoreceptor BMP and Activin Membrane-bound Inhibitor (BAMBI) by Nuclear Factor κB (NF-κB) p50 Enhances TGF-β Signaling in Hepatic Stellate Cells*

D. Brenner, C. Liu, E. Seki, 2014, The Journal of Biological Chemistry.

TLR4 enhances TGF-β signaling and hepatic fibrosis

Yosuke Osawa, R. Schwabe, D. Brenner, 2007, Nature Medicine.

Differential requirement for c‐Jun NH2‐terminal kinase in TNF‐α‐and Fas‐mediated apoptosis in hepatocytes

R. Schwabe, D. Brenner, H. Uchinami, 2004, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Apoptosis in Liver Injury and Liver Diseases

D. Brenner, Y. Osawa, E. Seki, 2009 .

Modulation of the intestinal bile acid/farnesoid X receptor/fibroblast growth factor 15 axis improves alcoholic liver disease in mice

D. Brenner, D. Fouts, M. Downes, 2018, Hepatology.

Role of mitochondrial inner membrane permeabilization in necrotic cell death, apoptosis, and autophagy.

John J Lemasters, Lihua He, D. Brenner, 2002, Antioxidants & redox signaling.

Detection of alpha-hydroxyethyl free radical adducts in the pancreas after chronic exposure to alcohol in the rat.

D. Brenner, B. Stefanovic, M. Kadiiska, 1996, Molecular pharmacology.

Recent advancement of molecular mechanisms of liver fibrosis

D. Brenner, E. Seki, 2015, Journal of hepato-biliary-pancreatic sciences.

New Approaches for Studying Alcoholic Liver Disease

D. Brenner, M. Karin, H. Tsukamoto, 2014, Current Pathobiology Reports.

Inhibition of transforming growth factor‐β/Smad signaling improves regeneration of small‐for‐size rat liver grafts

Christopher J. Parsons, D. Brenner, T. Theruvath, 2010, Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society.

Hepatic stellate cells and the reversal of fibrosis

D. Brenner, David A Brenner, Tatiana Kisseleva, 2006, Journal of gastroenterology and hepatology.

Dominant-negative TAK1 induces c-Myc and G(0) exit in liver.

D. Brenner, E. Hatano, C. Bradham, 2001, American journal of physiology. Gastrointestinal and liver physiology.

Casein kinase II is a negative regulator of c-Jun DNA binding and AP-1 activity

D. Brenner, J. Frost, T. Hunter, 1992, Cell.

Inactivation of myofibroblasts during regression of liver fibrosis

D. Brenner, T. Kisseleva, 2013, Cell cycle.

A gut microbiome signature for cirrhosis due to nonalcoholic fatty liver disease

D. Brenner, C. Sirlin, M. Downes, 2019, Nature Communications.

Blockade of IL-17 signaling reverses alcohol-induced liver injury and excessive alcohol drinking in mice.

Y. Koyama, G. Koob, D. Brenner, 2020, JCI insight.

The Role of IL-17 Signaling in Regulation of the Liver–Brain Axis and Intestinal Permeability in Alcoholic Liver Disease

D. Jeste, D. Brenner, A. Roberts, 2016, Current Pathobiology Reports.

Stimulation of the collagen α1(I) endogenous gene and transgene in carbon tetrachloride–induced hepatic fibrosis

R. Jaenisch, D. Brenner, J. Alcorn, 1993, Hepatology.

Acetaldehyde increases collagen gene transcription in cultured human fibroblasts.

D. Brenner, M. Chojkier, David A. BrennerS, 1987, The Journal of biological chemistry.

Magnetic Resonance Elastography vs Transient Elastography in Detection of Fibrosis and Noninvasive Measurement of Steatosis in Patients With Biopsy-Proven Nonalcoholic Fatty Liver Disease.

D. Brenner, C. Sirlin, M. Valasek, 2017, Gastroenterology.

The recombination and integration of DNAs introduced into mouse L cells.

D. Brenner, R. Camerini-Otero, R. Anderson, 1984, Cold Spring Harbor symposia on quantitative biology.

Replicative senescence of activated human hepatic stellate cells is accompanied by a pronounced inflammatory but less fibrogenic phenotype

D. Brenner, C. Hagedorn, Carrie Purbeck, 2003, Hepatology.

Differential role of IκB kinase 1 and 2 in primary rat hepatocytes

R. Schwabe, D. Brenner, A. Manning, 2001 .

Neutralization of Oxidized Phospholipids Ameliorates Non-alcoholic Steatohepatitis.

D. Brenner, C. Glass, R. Evans, 2019, Cell metabolism.

Mechanisms of Fibrogenesis

D. Brenner, T. Kisseleva, 2008, Experimental biology and medicine.

Mitogens and hepatocyte growth control in vivo and in vitro

D. Brenner, H. Leffert, G. Fey, 1990, In Vitro Cellular & Developmental Biology.

Oncogenic Ras activates c-Jun via a separate pathway from the activation of extracellular signal-regulated kinases.

D. Brenner, M. Karin, C. Der, 1994, Proceedings of the National Academy of Sciences of the United States of America.

Liver carcinogenesis: rodent models of hepatocarcinoma and cholangiocarcinoma.

D. Brenner, A. Benedetti, D. Alvaro, 2013, Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver.

Effect of insertions, deletions, and double-strand breaks on homologous recombination in mouse L cells

D. Brenner, R. Camerini-Otero, A. Smigocki, 1985 .

Effect of insertions, deletions, and double-strand breaks on homologous recombination in mouse L cells.

D. Brenner, R. Camerini-Otero, A. Smigocki, 1985, Molecular and cellular biology.

Link between gut‐microbiome derived metabolite and shared gene‐effects with hepatic steatosis and fibrosis in NAFLD

Rohit Loomba, Chi-Hua Chen, Jonathan Hooker, 2018, Hepatology.

Role of glycogen synthase kinase-3 in TNF-α-induced NF-κB activation and apoptosis in hepatocytes

David A. Brenner, R. Schwabe, D. Brenner, 2002 .

Genetic labeling does not detect epithelial-to-mesenchymal transition of cholangiocytes in liver fibrosis in mice.

K. Iwaisako, D. Brenner, Guoqiang Gu, 2010, Gastroenterology.

Hepatocytes do not undergo epithelial‐mesenchymal transition in liver fibrosis in mice

K. Iwaisako, D. Brenner, Kouichi Miura, 2010, Hepatology.

Expression of the NF-κB Target Gene X-Ray-Inducible Immediate Early Response Factor-1 Short Enhances TNF-α-Induced Hepatocyte Apoptosis by Inhibiting Akt Activation1

D. Brenner, S. Nakashima, Y. Banno, 2003, The Journal of Immunology.

Activation Hepatocyte Apoptosis by Inhibiting Akt-Induced α Factor-1 Short Enhances TNF-X-Ray-Inducible Immediate Early Response B Target Gene κ Expression of the NF -

D. Brenner, Y. Banno, Y. Osawa, 2003 .

Hepatitis C virus core and nonstructural proteins induce fibrogenic effects in hepatic stellate cells.

D. Brenner, R. Bataller, J. Lindquist, 2004, Gastroenterology.

Double-strand gap repair results in homologous recombination in mouse L cells.

D. Brenner, R. Camerini-Otero, A. Smigocki, 1986, Proceedings of the National Academy of Sciences of the United States of America.

5 – The Liver's Response to Injury: Inflammation and Fibrosis

D. Brenner, J. Jia, T. Kisseleva, 2018 .

Innate immunity in alcoholic liver disease.

D. Brenner, S. Friedman, G. Szabo, 2011, American journal of physiology. Gastrointestinal and liver physiology.

Tumor Necrosis Factor Alpha-Induced Interleukin-8 Production via NF-κB and Phosphatidylinositol 3-Kinase/Akt Pathways Inhibits Cell Apoptosis in Human Hepatocytes

D. Brenner, T. Asano, S. Nakashima, 2002, Infection and Immunity.

The role of TGFbeta1 in initiating hepatic stellate cell activation in vivo.

D. Brenner, B. Stefanovic, C. Hellerbrand, 1999, Journal of hepatology.

The Role of Mesothelin in Activation of Portal Fibroblasts in Cholestatic Liver Injury

Y. Koyama, K. Iwaisako, D. Brenner, 2022, Biology.

Immunotherapy-based targeting of MSLN+ activated portal fibroblasts is a strategy for treatment of cholestatic liver fibrosis

I. Pastan, Y. Koyama, K. Iwaisako, 2021, Proceedings of the National Academy of Sciences.

CCR1 and CCR5 promote hepatic fibrosis in mice.

R. Schwabe, D. Brenner, J. Llovet, 2009, The Journal of clinical investigation.

Pharmacological inhibition of P2RX7 ameliorates liver injury by reducing inflammation and fibrosis

D. Brenner, K. Dabbagh, B. Baeza-Raja, 2020, PloS one.

Interactions between the intestinal microbiome and liver diseases.

D. Brenner, B. Schnabl, 2014, Gastroenterology.

Aging and liver disease.

D. Brenner, I. Kim, David A Brenner, 2015, Current opinion in gastroenterology.

The nicotinamide adenine dinucleotide phosphate oxidase (NOX) homologues NOX1 and NOX2/gp91phox mediate hepatic fibrosis in mice

K. Iwaisako, D. Brenner, Y. Paik, 2011, Hepatology.

NOX in liver fibrosis.

D. Brenner, S. de Minicis, 2007, Archives of biochemistry and biophysics.

Interleukin-6 Increases Rat Metalloproteinase-13 Gene Expression through Stimulation of Activator Protein 1 Transcription Factor in Cultured Fibroblasts*

D. Brenner, R. Rippe, L. Schrum, 1999, The Journal of Biological Chemistry.

The Role of Fibrosis and Liver-Associated Fibroblasts in the Pathogenesis of Hepatocellular Carcinoma

D. Brenner, T. Kisseleva, J. Baglieri, 2019, International journal of molecular sciences.

CX3CL1‐CX3CR1 interaction prevents carbon tetrachloride‐induced liver inflammation and fibrosis in mice

D. Brenner, E. Seki, Tomonori Aoyama, 2010, Hepatology.

Inherited human cPLA(2alpha) deficiency is associated with impaired eicosanoid biosynthesis, small intestinal ulceration, and platelet dysfunction.

D. Brenner, J. Morrow, N. Schnetz-Boutaud, 2008, The Journal of clinical investigation.

Stellate Cells, Portal Myofibroblasts, and Epithelial-to-Mesenchymal Transition

Y. Koyama, D. Brenner, Ping Wang, 2015 .

981 EPITHELIAL-TO-MESENCHYMAL TRANSITION (EMT) IN CHOLANGIOCYTES DOES NOT CONTRIBUTE TO THE POPULATION OF α-SMA+ MYOFIBROBLASTS IN EXPERIMENTAL MODELS OF LIVER FIBROSIS

D. Brenner, T. Kisseleva, D. Scholten, 2010 .

Intestinal Virome in Patients With Alcoholic Hepatitis

D. Brenner, R. Bataller, D. Fouts, 2020, Hepatology.

Functional Microbial Responses to Alcohol Abstinence in Patients With Alcohol Use Disorder

D. Brenner, R. Loomba, B. Schnabl, 2020, Frontiers in Physiology.

Molecular pathogenesis of alcohol-induced hepatic fibrosis.

D. Brenner, S. Siegmund, 2005, Alcoholism, clinical and experimental research.

Toll-like receptor 9 promotes steatohepatitis by induction of interleukin-1beta in mice.

D. Brenner, J. Olefsky, Kouichi Miura, 2010, Gastroenterology.

Impact of burn injury on hepatic TGF-β1 expression and plasma TGF-β1 levels

D. Brenner, A. Meyer, T. Nakagawa, 2000 .

Impact of burn injury on hepatic TGF-beta1 expression and plasma TGF-beta1 levels.

D. Brenner, A. Meyer, T. Nakagawa, 2000, The Journal of trauma.

Reversibility of Liver Fibrosis and Inactivation of Fibrogenic Myofibroblasts

D. Brenner, T. Kisseleva, Jun Xu, 2013, Current Pathobiology Reports.

D. Brenner, B. Stefanovic, C. Hellerbrand, 1997 .

Role of endotoxin and Kupffer cells as triggers of hypoxia-reoxygenation in alcoholic liver injury

D. Brenner, G. Arteel, M. Kadiiska, 2002 .

Cryptochrome Mediates Circadian Regulation of cAMP Signaling and Hepatic Gluconeogenesis

Dmitri A. Nusinow, T. Hirota, Pagkapol Y. Pongsawakul, 2010, Nature Medicine.

Tumor necrosis factor α in the pathogenesis of human and murine fulminant hepatic failure

M. Manns, C. Trautwein, D. Brenner, 2000 .

Mutation of the 5′-Untranslated Region Stem-Loop Structure Inhibits α1(I) Collagen Expression in Vivo*

Christopher J. Parsons, D. Brenner, B. Stefanovic, 2010, The Journal of Biological Chemistry.

Inhibition of proinflammatory molecule production by adenovirus-mediated expression of a nuclear factor kappaB super-repressor in human intestinal epithelial cells.

D. Brenner, C. Hellerbrand, R. Sartor, 1998, Journal of immunology.

Anti-fibrogenic strategies and the regression of fibrosis.

D. Brenner, T. Kisseleva, 2011, Best practice & research. Clinical gastroenterology.

Prolonged infusion of angiotensin II into normal rats induces stellate cell activation and proinflammatory events in liver.

D. Brenner, R. Bataller, R. Rippe, 2003, American journal of physiology. Gastrointestinal and liver physiology.

Attenuated hepatic inflammation and fibrosis in angiotensin type 1a receptor deficient mice.

D. Brenner, R. Bataller, R. Rippe, 2005, Journal of hepatology.

Genetic polymorphisms and the progression of liver fibrosis: A critical appraisal

D. Brenner, R. Bataller, K. North, 2003, Hepatology.

Regulation of alpha1(I) collagen messenger RNA decay by interactions with alphaCP at the 3'-untranslated region.

Christopher J. Parsons, D. Brenner, B. Stefanovic, 2004, The Journal of biological chemistry.

CD40 Activates NF-κB and c-Jun N-Terminal Kinase and Enhances Chemokine Secretion on Activated Human Hepatic Stellate Cells1

R. Schwabe, D. Brenner, Y. Kweon, 2001, The Journal of Immunology.

Antifibrotic effects of a tissue inhibitor of metalloproteinase‐1 antibody on established liver fibrosis in rats

Christopher J. Parsons, Barbara Krebs, D. Brenner, 2004, Hepatology.

Synectin promotes fibrogenesis by regulating PDGFR isoforms through distinct mechanisms.

D. Mukhopadhyay, D. Brenner, V. Shah, 2017, JCI insight.

Liver: DNA methylation controls liver fibrogenesis

D. Brenner, Xiao Liu, 2016, Nature Reviews Gastroenterology &Hepatology.

Molecular defects in ferrochelatase in patients with protoporphyria requiring liver transplantation.

D. Brenner, S. Magness, J. Bloomer, 1998, The Journal of clinical investigation.

An exon 10 deletion in the mouse ferrochelatase gene has a dominant-negative effect and causes mild protoporphyria.

D. Brenner, N. Maeda, S. Magness, 2002, Blood.

Deletion of the ferrochelatase gene in a patient with protoporphyria.

D. Brenner, G. Evans, S. Magness, 1994, Human molecular genetics.

Role of Toll-Like Receptors and Their Downstream Molecules in the Development of Nonalcoholic Fatty Liver Disease

D. Brenner, Kouichi Miura, E. Seki, 2011, Gastroenterology research and practice.

Toll‐Like receptor 4 mediates inflammatory signaling by bacterial lipopolysaccharide in human hepatic stellate cells

Christian Jobin, R. Schwabe, D. Brenner, 2003, Hepatology.

Free cholesterol-loaded macrophages are an abundant source of tumor necrosis factor-alpha and interleukin-6: model of NF-kappaB- and map kinase-dependent inflammation in advanced atherosclerosis.

R. Schwabe, D. Brenner, A. Tall, 2005, The Journal of biological chemistry.

Analysis ofRNA transcripts forHLA class II genesin humansmall intestinal biopsies

D. Brenner, M. Kagnoff, B. Volk, 2017 .

Combatting Fibrosis: Exosome‐Based Therapies in the Regression of Liver Fibrosis

D. Brenner, T. Kisseleva, Li Chen, 2018, Hepatology communications.

Targeted disruption of the mouse ferrochelatase gene producing an exon 10 deletion.

D. Brenner, S. Magness, 1999, Biochimica et biophysica acta.

Tumor necrosis factor alpha stimulates AP-1 activity through prolonged activation of the c-Jun kinase.

D. Brenner, M. Karin, J. Westwick, 1994, The Journal of biological chemistry.

Identifying nonalcoholic fatty liver disease patients with active fibrosis by measuring extracellular matrix remodeling rates in tissue and blood

D. Brenner, T. Angel, Shanshan Liu, 2016, Hepatology.

A dual reporter gene transgenic mouse demonstrates heterogeneity in hepatic fibrogenic cell populations

D. Brenner, R. Bataller, S. Magness, 2004, Hepatology.

Hepatic stellate cells primed with cytokines upregulate inflammation in response to peptidoglycan or lipoteichoic acid

Sang In Lee, D. Brenner, Y. Paik, 2006, Laboratory Investigation.

Novel perspectives on the origins of the hepatic myofibroblasts

D. Brenner, T. Kisseleva, Jun Xu, 2015 .

Mechanisms of Liver Injury. I. TNF-alpha-induced liver injury: role of IKK, JNK, and ROS pathways.

R. Schwabe, D. Brenner, Robert F Schwabe, 2006, American journal of physiology. Gastrointestinal and liver physiology.

IL-17 signaling in inflammatory cells , Kupffer cells and Hepatic Stellate cells exacerbates liver fibrosis

K. Iwaisako, D. Brenner, K. Ley, 2013 .

Sitagliptin vs. placebo for non-alcoholic fatty liver disease: A randomized controlled trial.

D. Brenner, C. Sirlin, R. Loomba, 2016, Journal of hepatology.

Synergism between obesity and alcohol in increasing the risk of hepatocellular carcinoma: a prospective cohort study.

Chien-Jen Chen, D. Brenner, E. Barrett-Connor, 2013, American journal of epidemiology.

15th International Symposium on Cells of the Hepatic Sinusoid, 2010

D. Brenner, H. Jaeschke, H. Tsukamoto, 2011, Liver international : official journal of the International Association for the Study of the Liver.

Primary Alcohol‐Activated Human and Mouse Hepatic Stellate Cells Share Similarities in Gene‐Expression Profiles

D. Brenner, S. Rosenthal, K. Dorko, 2020, Hepatology communications.

NADPH oxidase mediated oxidative stress in hepatic fibrogenesis

D. Brenner, Y. Paik, 2011, The Korean journal of hepatology.

Role and cellular source of nicotinamide adenine dinucleotide phosphate oxidase in hepatic fibrosis

R. Schwabe, D. Brenner, Y. Paik, 2010, Hepatology.

Expression of insulin-like growth factor I by activated hepatic stellate cells reduces fibrogenesis and enhances regeneration after liver injury

D. Brenner, J. Prieto, J. Fagin, 2004, Gut.

Akt protects mouse hepatocytes from TNF-α- and Fas-mediated apoptosis through NK-κB activation

D. Brenner, E. Hatano, 2001 .

NFkappaB prevents apoptosis and liver dysfunction during liver regeneration.

D. Brenner, C. Hellerbrand, J. Grisham, 1998, The Journal of clinical investigation.

Nuclear Factor-κB in the Liver: Friend or Foe?

R. Schwabe, D. Brenner, 2007 .

TNF alpha-induced hepatocyte apoptosis is associated with alterations of the cell cycle and decreased stem loop binding protein.

D. Brenner, E. Hatano, R. Rippe, 2004, Surgery.

Hepatic porphyrias.

D. Brenner, J. Bloomer, Y. Scarlett, 1998, Clinics in liver disease.

Primary cirrhotic hepatocytes resist TGFbeta-induced apoptosis through a ROS-dependent mechanism.

D. Brenner, R. Rippe, L. Schrum, 2004, Journal of hepatology.

Binding of Upstream Stimulatory Factor to an E-box in the 3′-Flanking Region Stimulates α1(I) Collagen Gene Transcription*

D. Brenner, R. Rippe, A. Umezawa, 1997, The Journal of Biological Chemistry.

TNF-α-Induced Sphingosine 1-Phosphate Inhibits Apoptosis Through a Phosphatidylinositol 3-Kinase/Akt Pathway in Human Hepatocytes1

D. Brenner, S. Nakashima, Y. Banno, 2001, The Journal of Immunology.

Confocal microscopy of the mitochondrial permeability transition in necrotic and apoptotic cell death.

D. Brenner, W. Cascio, B. Herman, 1999, Biochemical Society symposium.

Expression of the NF-kappa B target gene X-ray-inducible immediate early response factor-1 short enhances TNF-alpha-induced hepatocyte apoptosis by inhibiting Akt activation.

D. Brenner, S. Nakashima, Y. Banno, 2003, Journal of immunology.

Expression of collagen genes in the liver.

D. Brenner, M. Chojkier, H. Leffert, 1990, Molecular biology & medicine.

Differential expression of the transfected liver-specific alpha 1-inhibitor III gene in normal hepatocytes and hepatoma cells in culture.

D. Brenner, H. Leffert, K. Koch, 1992, Biochemical and Biophysical Research Communications - BBRC.

A simplified method for the preparation of transcriptionally active liver nuclear extracts.

D. Brenner, M. Karin, Antonio Tugores, 1990, DNA and cell biology.

What goes up must come down: The emerging role of microRNA in fibrosis

D. Brenner, B. Chau, 2011, Hepatology.

Gastric acid suppression promotes alcoholic liver disease by inducing overgrowth of intestinal Enterococcus

D. Brenner, H. Sørensen, K. Nelson, 2017, Nature Communications.

The role of Mesothelin signaling in Portal Fibroblasts in the pathogenesis of cholestatic liver fibrosis

Y. Koyama, D. Brenner, R. Loomba, 2021, Frontiers in Molecular Biosciences.

Protection from liver fibrosis by a peroxisome proliferator-activated receptor δ agonist

K. Iwaisako, D. Brenner, C. Sirlin, 2012, Proceedings of the National Academy of Sciences.

Monocytes-macrophages that express α-smooth muscle actin preserve primitive hematopoietic cells in the bone marrow

A. Mildner, Steffen Jung, D. Brenner, 2012, Nature Immunology.

Techniques to measure nucleic acid-protein binding and specificity. Nuclear extract preparations, DNase I footprinting, and mobility shift assays.

D. Brenner, R. Rippe, Antonio Tugores, 2001, Methods in molecular biology.

A Molecular DefectinHuman Protoporphyria

D. Brenner, G. Evans, J. Didier, 1992 .

Transforming growth factor-beta1 induces hepatocyte apoptosis by a c-Jun independent mechanism.

D. Brenner, R. Rippe, L. Schrum, 2002, Surgery.

Report of the American Gastroenterological Association (AGA) Institute Obesity Task Force.

D. Brenner, B. Popkin, R. Seeley, 2007, Gastroenterology.

The enteropathy of prostaglandin deficiency

D. Brenner, J. Morrow, N. Schnetz-Boutaud, 2008, Journal of Gastroenterology.

Association Between Obesity and Discordance in Fibrosis Stage Determination by Magnetic Resonance vs Transient Elastography in Patients With Nonalcoholic Liver Disease

D. Brenner, R. Ehman, C. Sirlin, 2017, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Aging increases the susceptibility of hepatic inflammation, liver fibrosis and aging in response to high-fat diet in mice

D. Jeste, Y. Koyama, D. Brenner, 2016, AGE.

NF-kappaB activation in Kupffer cells after partial hepatectomy.

D. Brenner, R. Bataller, R. Rippe, 2005, American journal of physiology. Gastrointestinal and liver physiology.

Alpha‐1 antitrypsin Z protein (PiZ) increases hepatic fibrosis in a murine model of cholestasis

D. Brenner, Y. Osawa, E. Seki, 2007, Hepatology.

Cognitive Health of Nonagenarians in Southern Italy: A Descriptive Analysis from a Cross-Sectional, Home-Based Pilot Study of Exceptional Longevity (Cilento Initiative on Aging Outcomes or CIAO)

D. Jeste, D. Brenner, S. Di Somma, 2020, Medicina.

Mixed-methods quantitative–qualitative study of 29 nonagenarians and centenarians in rural Southern Italy: focus on positive psychological traits

N. Schork, D. Jeste, D. Brenner, 2017, International Psychogeriatrics.

Heterogeneity of HSCs in a Mouse Model of NASH

D. Brenner, C. Glass, S. Rosenthal, 2021, Hepatology.

Activated Hepatic Stellate Cells and Portal Fibroblasts contribute to cholestatic liver fibrosis in MDR2 knockout mice.

Y. Koyama, K. Iwaisako, D. Brenner, 2019, Journal of hepatology.

Contribution of bone marrow-derived fibrocytes to liver fibrosis.

D. Brenner, T. Park, T. Kisseleva, 2015, Hepatobiliary surgery and nutrition.

The characteristics of activated portal fibroblasts/myofibroblasts in liver fibrosis.

Y. Koyama, D. Brenner, T. Kisseleva, 2016, Differentiation; research in biological diversity.

Microbiome 101: Studying, Analyzing, and Interpreting Gut Microbiome Data for Clinicians

Rohit Loomba, Rob Knight, Daniel McDonald, 2019, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Magnetic Resonance Elastography Predicts Advanced Fibrosis in Patients With Nonalcoholic Fatty Liver Disease: A Prospective Study

Anthony Gamst, Rohit Loomba, Tanya Wolfson, 2014, Hepatology.

Genetic covariance between gamma-glutamyl transpeptidase and fatty liver risk factors: role of beta2-adrenergic receptor genetic variation in twins.

D. O'Connor, D. Brenner, R. Loomba, 2010, Gastroenterology.

Information Assimilation and Distribution Challenges and Goals for Real and Virtual Journals

Irvin M Modlin, R. Spiller, D. Brenner, 2005, Journal of clinical gastroenterology.

High molecular weight adiponectin inhibits proliferation of hepatic stellate cells via activation of adenosine monophosphate–activated protein kinase

D. Brenner, M. Adachi, 2008, Hepatology.

Clinical Syndromes of Alcoholic Liver Disease

D. Brenner, M. Adachi, 2006, Digestive Diseases.

Differential Expression of Human Lysyl Hydroxylase Genes, Lysine Hydroxylation, and Cross‐Linking of Type I Collagen During Osteoblastic Differentiation In Vitro

D. Brenner, M. Yamauchi, K. Uzawa, 1999, Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research.

Lecture Fibrogenesis of Parenchymal Organs

D. Brenner, T. Kisseleva, 2008 .

Nonalcoholic Steatohepatitis and HCC in a Hyperphagic Mouse Accelerated by Western Diet

D. Brenner, S. Rosenthal, M. Hosseini, 2021, Cellular and molecular gastroenterology and hepatology.

Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistance

D. Brenner, J. M. Suh, R. Evans, 2015, Nature Medicine.

A gut microbiome signature for cirrhosis due to nonalcoholic fatty liver disease

R. Knight, D. Brenner, C. Sirlin, 2019, Nature Communications.

BASIC-LIVER, PANCREAS, AND BILIARY TRACT The Forkhead Transcription Factor FoxO1 Regulates Proliferation and Transdifferentiation of Hepatic Stellate Cells

D. Brenner, D. Accili, T. Kitamura, 2007 .

Deletion of IKK 2 in hepatocytes does not sensitize these cells to TNF-induced apoptosis but protects from ischemia / reperfusion injury

T. Luedde, M. Manns, C. Trautwein, 2005 .

949 Sitagliptin Versus Placebo in the Treatment of Nonalcoholic Fatty Liver Disease: A Randomized Controlled Trial

D. Brenner, C. Sirlin, R. Loomba, 2016 .

CRIg on liver macrophages clears pathobionts and protects against alcoholic liver disease

D. Brenner, R. Bataller, M. Karin, 2021, Nature Communications.

TNFalpha is required for cholestasis-induced liver fibrosis in the mouse.

D. Brenner, C. Hellerbrand, J. Schölmerich, 2009, Biochemical and biophysical research communications.

Study of loneliness and wisdom in 482 middle-aged and oldest-old adults: a comparison between people in Cilento, Italy and San Diego, USA

D. Jeste, D. Brenner, D. Ziedonis, 2020, Aging & mental health.

Overexpression of Endoglin Modulates TGF-β1-Signalling Pathways in a Novel Immortalized Mouse Hepatic Stellate Cell Line

C. Trautwein, D. Brenner, R. Weiskirchen, 2013, PloS one.

Intestinal α1-2-Fucosylation Contributes to Obesity and Steatohepatitis in Mice

O. Fiehn, D. Brenner, K. Goglin, 2021, Cellular and molecular gastroenterology and hepatology.

Celecoxib induces hepatic stellate cell apoptosis through inhibition of Akt activation and suppresses hepatic fibrosis in rats

S. I. Lee, D. Brenner, Y. Paik, 2009, Gut.

Shared genetic effects between hepatic steatosis and fibrosis: A prospective twin study

N. Schork, D. Brenner, K. Nelson, 2016, Hepatology.

Novel 3D Magnetic Resonance Elastography for the Noninvasive Diagnosis of Advanced Fibrosis in NAFLD: A Prospective Study

D. Brenner, R. Ehman, A. Gamst, 2016, The American Journal of Gastroenterology.

Utility of magnetic resonance imaging versus histology for quantifying changes in liver fat in nonalcoholic fatty liver disease trials

Rohit Loomba, Claude Sirlin, Jessica Lam, 2013, Hepatology.

Stem Cells and Cloning: Advances and Applications

D. Brenner, A. Conigliaro, T. Kisseleva, 2010 .

Toll-like receptor 4 mediates alcohol-induced steatohepatitis through bone marrow-derived and endogenous liver cells in mice.

D. Brenner, E. Park, E. Seki, 2011, Alcoholism, clinical and experimental research.

Therapy for Hepatic Fibrosis

D. Brenner, J. Alcorn, J. Alcorn, 1990, Seminars in liver disease.

Tumor necrosis factor alpha prevents tumor necrosis factor receptor-mediated mouse hepatocyte apoptosis, but not fas-mediated apoptosis: role of nuclear factor-kappaB.

D. Brenner, S. Nakashima, Y. Banno, 2000, Hepatology.

Role of glycogen synthase kinase-3 in TNF-alpha-induced NF-kappaB activation and apoptosis in hepatocytes.

R. Schwabe, D. Brenner, Robert F Schwabe, 2002, American journal of physiology. Gastrointestinal and liver physiology.

NF-kappaB inhibits expression of the alpha1(I) collagen gene.

D. Brenner, B. Stefanovic, R. Rippe, 1999, DNA and cell biology.

The Crosstalk between Hepatocytes, Hepatic Macrophages, and Hepatic Stellate Cells Facilitates Alcoholic Liver Disease.

D. Brenner, T. Kisseleva, 2019, Cell metabolism.

Contribution of Fibrocytes to Liver Fibrosis: Current Concept and Future Prospect

D. Brenner, T. Kisseleva, 2011 .

Akt protects mouse hepatocytes from TNF-alpha- and Fas-mediated apoptosis through NK-kappa B activation.

D. Brenner, E. Hatano, 2001, American journal of physiology. Gastrointestinal and liver physiology.

Publisher Correction: Gastric acid suppression promotes alcoholic liver disease by inducing overgrowth of intestinal Enterococcus

D. Brenner, K. Nelson, D. Fouts, 2017, Nature Communications.

NF-κB inactivation converts a hepatocyte cell line TNF-α response from proliferation to apoptosis.

D. Brenner, M. Czaja, R. Kitsis, 1998, American journal of physiology. Cell physiology.

Molecular Mechanisms of Alcohol-Induced Hepatic Fibrosis

S. Dooley, D. Brenner, S. Siegmund, 2006, Digestive Diseases.

Reversibility of liver fibrosis.

D. Brenner, 2013, Gastroenterology & hepatology.

Differential role of I kappa B kinase 1 and 2 in primary rat hepatocytes.

R. Schwabe, D. Brenner, A. Manning, 2001, Hepatology.

EFFECTS OF THREE SUPEROXIDE DISMUTASE GENES DELIVERED WITH AN ADENOVIRUS ON GRAFT FUNCTION AFTER TRANSPLANTATION OF FATTY LIVERS IN THE RAT1

R. Schwabe, D. Brenner, J. Samulski, 2003, Transplantation.

Recommendations for Probiotic Use--2015 Update: Proceedings and Consensus Opinion.

D. Brenner, M. Nieuwdorp, L. Brandt, 2015, Journal of clinical gastroenterology.

IKB kinase B(IKKB), but not NF-KB-inducing kinase (NIK) or IKKA, represents a therapeutic target for modulation of fas, IL-1B and TNFA-mediated NF-KB activation in intestinal epithelial cells (IEC)

D. Brenner, A. Manning, M. Russo, 2000 .

The role of gut-derived bacterial toxins and free radicals in alcohol-induced liver injury.

D. Brenner, G. Arteel, M. Kadiiska, 1998, Journal of gastroenterology and hepatology.

The genetics of nonalcoholic fatty liver disease.

D. Brenner, C. Osterreicher, 2007, Annals of hepatology.

Publisher Correction: Gastric acid suppression promotes alcoholic liver disease by inducing overgrowth of intestinal Enterococcus

D. Brenner, H. Sørensen, K. Nelson, 2017, Nature Communications.

Gastroenterology's editors-in-chief: historical and personal perspectives of their editorships.

D. Brenner, N. LaRusso, A. Rustgi, 2013, Gastroenterology.

Obesity and alcohol synergize to increase the risk of incident hepatocellular carcinoma in men.

Chien-Jen Chen, D. Brenner, Hwai I. Yang, 2010, Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association.

Sitagliptin Versus Placebo in the Treatment of Non-Alcoholic Fatty Liver Disease: A Randomized Controlled Trial

D. Brenner, C. Sirlin, R. Loomba, 2016 .

Molecular and cellular biology of the small intestine

D. Brenner, E. Zimmerman, 1991, Current opinion in gastroenterology.

Fra, Fra Away: The complex role of activator protein 1 in liver injury

D. Brenner, 2014, Hepatology.

Genomics of liver fibrosis and cirrhosis.

D. Brenner, F. Stickel, C. Osterreicher, 2007, Seminars in liver disease.

Cellular and molecular biology of hepatocyte growth, regeneration and gene expression.

D. Brenner, M. Karin, M. Chojkier, 1990, Advances in second messenger and phosphoprotein research.

Nuclear factor-kappaB in the liver: friend or foe?

R. Schwabe, D. Brenner, 2007, Gastroenterology.

Non-degradable collagen increases liver fibrosis but not hepatocellular carcinoma in mice.

D. Brenner, M. Karin, S. Rosenthal, 2021, The American journal of pathology.

Epimorphin, a morphogenic protein, induces proteases in rodent hepatocytes through NF-kappaB.

D. Brenner, Y. Osawa, Sumio Watanabe, 2007, Journal of hepatology.

The role of NF-κB in hepatocarcinogenesis: Promoter or suppressor?

David A. Brenner, D. Brenner, E. Seki, 2007 .

Asian Pacific Association for Study of the Liver (APASL)

M. Alter, M. Hashizume, M. Manns, 2003 .

Investigating the role of the extracellular environment in modulating hepatic stellate cell biology with arrayed combinatorial microenvironments.

Shu Chien, David A Brafman, David A. Brafman, 2009, Integrative biology : quantitative biosciences from nano to macro.

What is the potential role of antifibrotic agents for the treatment of liver disease?

D. Brenner, B. Schnabl, D. Scholten, 2008, Nature Clinical Practice Gastroenterology &Hepatology.

Regulation of α1(I) Collagen Messenger RNA Decay by Interactions with αCP at the 3′-Untranslated Region*

Christopher J. Parsons, D. Brenner, B. Stefanovic, 2004, Journal of Biological Chemistry.

Gene regulation in hepatic stellate cell.

D. Brenner, A. Lang, 1999, Italian journal of gastroenterology and hepatology.

Staging of fibrosis in experimental non-alcoholic steatohepatitis by quantitative molecular imaging in rat models.

D. Brenner, C. Sirlin, C. Hoh, 2015, Nuclear medicine and biology.

Application of the polymerase chain reaction in gastroenterological endoscopy.

D. Brenner, J. Nelson, J. Rooney, 1992, Endoscopy.

Novel association between serum pentraxin‐2 levels and advanced fibrosis in well‐characterised patients with non‐alcoholic fatty liver disease

D. Brenner, E. Verna, M. Valasek, 2015, Alimentary pharmacology & therapeutics.

The Role of p70 S6K in Hepatic Stellate Cell Collagen Gene Expression and Cell Proliferation*

D. Brenner, R. Bataller, Y. Yata, 2005 .

Cardiovascular health of nonagenarians in southern Italy: a cross-sectional, home-based pilot study of longevity.

D. Jeste, D. Brenner, A. Maisel, 2019, Journal of cardiovascular medicine.

The enzymatic defect in variegate prophyria. Studies with human cultured skin fibroblasts.

D. Brenner, J. Bloomer, 1980, The New England journal of medicine.

NF-I/Sp1 Switch Elements Regulate Collagen α1(I) Gene Expression

D. Brenner, M. Nehls, M. L. Grapilon, 1992 .

Epithelial and Mesenchymal Cell Biology Pericytes and Perivascular Fibroblasts Are the Primary Source of Collagen-Producing Cells in Obstructive Fibrosis of the Kidney

D. Brenner, J. Duffield, Shuei-Liong Lin, 2010 .

Longitudinal comparison between MRI , MRS and histology-determined steatosis in NAFLD patients at two-time points in a randomized trial

D. Brenner, C. Sirlin, M. Peterson, 2013 .

Analysis of the collagen α(I) promoter

D. Brenner, R. Rippe, L. Veloz, 1989 .

Analysis of the collagen alpha 1(I) promoter.

D. Brenner, R. Rippe, L. Veloz, 1989, Nucleic acids research.

Fibrogenesis and type I collagen gene regulation.

D. Brenner, J. Trotter, R. Rippe, 1994, The Journal of laboratory and clinical medicine.

The role of NF-kappaB in hepatocarcinogenesis: promoter or suppressor?

D. Brenner, E. Seki, 2007, Journal of Hepatology.

Transforming growth factor-alpha stimulates proto-oncogene c-jun expression and a mitogenic program in primary cultures of adult rat hepatocytes.

D. Brenner, H. Leffert, K. Koch, 1989, DNA.

Gene expression and cytokine and enzyme activation in the liver after a burn injury.

D. Brenner, A. Meyer, C. Bradham, 2000, The Journal of burn care & rehabilitation.

TAK1-mediated autophagy and fatty acid oxidation prevent hepatosteatosis and tumorigenesis.

Mason R. Mackey, Dorothy D. Sears, Mark Ellisman, 2014, The Journal of clinical investigation.

Toll‐like receptors and adaptor molecules in liver disease: Update

D. Brenner, E. Seki, 2008, Hepatology.

Mechanisms of Fibrogenesis

D. Brenner, T. Kisseleva, 2008, Experimental biology and medicine.

TNFalpha is required for cholestasis-induced liver fibrosis in the mouse.

D. Brenner, C. Hellerbrand, J. Schölmerich, 2009, Biochemical and biophysical research communications.

Collagen Formation Assessed by N‐Terminal Propeptide of Type 3 Procollagen Is a Heritable Trait and Is Associated With Liver Fibrosis Assessed by Magnetic Resonance Elastography

M. Karsdal, D. Brenner, C. Sirlin, 2019, Hepatology.

The phenotypic fate and functional role for bone marrow-derived stem cells in liver fibrosis.

D. Brenner, T. Kisseleva, 2012, Journal of hepatology.

Three distinct cell populations express extracellular matrix proteins and increase in number during skeletal muscle fibrosis.

D. Brenner, R. Lieber, S. Subramaniam, 2017, American journal of physiology. Cell physiology.

The gut–liver axis and the intersection with the microbiome

Justine W. Debelius, D. Brenner, M. Karin, 2018, Nature Reviews Gastroenterology & Hepatology.

Angiotensin‐converting‐enzyme 2 inhibits liver fibrosis in mice

D. Brenner, J. Penninger, E. Seki, 2009, Hepatology.

Protection from liver fibrosis by a peroxisome proliferator-activated receptor δ agonist

K. Iwaisako, D. Brenner, C. Sirlin, 2012, Proceedings of the National Academy of Sciences.

Gut Microbiome-Based Me tagenomic Signature for Non-invasive Detection of Advanced Fibrosis in Human Nonalcoholic Fatty Liver Disease Graphical Abstract Highlights d Gut microbiota is associated with advanced fibrosis in human NAFLD d Metagenome-based gut microbiome panel can accurately diagnose

J. Venter, N. Schork, Niels Klitgord, 2017 .

Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression

D. Brenner, J. Olefsky, Hiroyasu Ito, 2011, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

The characteristics of activated portal fibroblasts/myofibroblasts in liver fibrosis.

Y. Koyama, D. Brenner, T. Kisseleva, 2016, Differentiation; research in biological diversity.

Hepatic progenitors for liver disease: current position

D. Brenner, A. Conigliaro, T. Kisseleva, 2010, Stem cells and cloning : advances and applications.

Mixed-methods quantitative–qualitative study of 29 nonagenarians and centenarians in rural Southern Italy: focus on positive psychological traits

N. Schork, D. Jeste, D. Brenner, 2017, International Psychogeriatrics.

Hepatocytes do not undergo epithelial‐mesenchymal transition in liver fibrosis in mice

K. Iwaisako, D. Brenner, Kouichi Miura, 2010, Hepatology.

Regulation of collagen alpha1(I) expression in hepatic stellate cells.

D. Brenner, B. Stefanovic, J. Lindquist, 2000, Journal of gastroenterology.

Activated Hepatic Stellate Cells and Portal Fibroblasts contribute to cholestatic liver fibrosis in MDR2 knockout mice.

Y. Koyama, K. Iwaisako, D. Brenner, 2019, Journal of hepatology.

The Fibrosis Across Organs Symposium: A Roadmap for Future Research Priorities

D. Brenner, K. Brown, L. Richeldi, 2019, The American journal of the medical sciences.

Hepatic stellate cells secrete angiopoietin 1 that induces angiogenesis in liver fibrosis.

K. Iwaisako, D. Brenner, E. Hatano, 2008, Gastroenterology.

ESTROGEN INCREASES SENSITIVITY OF KUPFFER CELLS TO ENDOTOXIN

D. Brenner, N. Enomoto, K. Ikejima, 1998 .

Transforming growth factor-beta1 induces hepatocyte apoptosis by a c-Jun independent mechanism.

D. Brenner, R. Rippe, L. Schrum, 2002, Surgery.

Ascorbic acid stimulation of collagen biosynthesis independent of hydroxylation.

D. Brenner, M. Chojkier, K. Houglum, 1991, The American journal of clinical nutrition.

CTCTGCAGCTCAGCC ATGGCTGCTTCTGCTGCT TCCTCAGAGACATCC ATCTGGTCCTACACGAAGCC TTCCCAGATCACAGA TCCAGAAGGCCCTCAGACTA GCAGCCTGAGTGTCT AATTCCAGAACCGCTCCAGT AGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA AAAGGTTTGGAAGCAG TGTGAAATGCCACCTTTTGA CAGGTCCTTCCTAAA GGAGAGCCCTGGATACCAAC TCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTAC

K. Iwaisako, D. Brenner, K. Ley, 2012 .

The Mitochondrial Permeability Transition Is Required for Tumor Necrosis Factor Alpha-Mediated Apoptosis and Cytochrome c Release

C. Trautwein, D. Brenner, K. Streetz, 1998, Molecular and Cellular Biology.

Toll-like receptor 2-mediated intestinal injury and enteric tumor necrosis factor receptor I contribute to liver fibrosis in mice.

D. Brenner, M. Haimerl, B. Schnabl, 2012, Gastroenterology.