V. Pattanayak

发表

Physics first in science education reform

V. Pattanayak, 2003 .

High-fidelity CRISPR-Cas9 variants with undetectable genome-wide off-targets

J. Joung, V. Pattanayak, S. Tsai, 2015, Nature.

Broad Specificity Profiling of TALENs Results in Engineered Nucleases With Improved DNA Cleavage Specificity

J. Keith Joung, David R. Liu, John P. Guilinger, 2014, Nature Methods.

High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity

David R. Liu, Steven Lin, V. Pattanayak, 2013, Nature Biotechnology.

Revealing Off-Target Cleavage Specificities of Zinc Finger Nucleases by In Vitro Selection

David R. Liu, C. L. Ramirez, J. Joung, 2011, Nature Methods.

Response to “Unexpected mutations after CRISPR–Cas9 editing in vivo”

Jonathan Y. Hsu, J. Joung, C. Lareau, 2018, Nature Methods.

Observed versus predicted structure of fluorescent self-quenching reporter molecules (SQRM): caveats with respect to the use of "stem-loop" oligonucleotides as probes for mRNA folding.

V. Pattanayak, P. Lu, A. Gewirtz, 2008, RNA.

Stemless self-quenching reporter molecules identify target sequences in mRNA.

Lida K. Gifford, V. Pattanayak, Kathy Vernovsky, 2005, Analytical biochemistry.

CRISPR-Cas9 treatment partially restores amyloid-β 42/40 in human fibroblasts with the Alzheimer’s disease PSEN1 M146L mutation

Martin J. Aryee, J. Joung, V. Pattanayak, 2022, Molecular therapy. Nucleic acids.

Association between human leukocyte antigen type and keratinocyte carcinoma risk in renal transplant recipients.

Yuhree Kim, V. Pattanayak, Hang Lee, 2020, The Journal of investigative dermatology.

A Code of Ethics for Gene Drive Research

Chase L. Beisel, Ahmad S. Khalil, J. Joung, 2021, The CRISPR journal.

Diminished antibody response against SARS-CoV-2 Omicron variant after third dose of mRNA vaccine in kidney transplant recipients

V. Pattanayak, Z. Solhjou, L. Riella, 2022, medRxiv.

Suboptimal antibody response against SARS-CoV-2 Omicron variant after third dose of mRNA vaccine in kidney transplant recipients

V. Pattanayak, J. Azzi, Z. Solhjou, 2022, Kidney International.

731. High-Fidelity CRISPR-Cas9 Nucleases with No Detectable Genome-Wide Off-Target Effects

J. Keith Joung, Benjamin P. Kleinstiver, Vikram Pattanayak, 2016 .

Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules

Lida K. Gifford, V. Pattanayak, Kathy Vernovsky, 2005, Nucleic acids research.

Small Molecule-Triggered Cas9 Protein with Improved Genome-Editing Specificity

David R. Liu, Vikram Pattanayak, David B. Thompson, 2015, Nature chemical biology.

COVID-19 infection and vaccination rarely impact HLA antibody profile in waitlisted renal transplant candidates- a multicenter cohort

V. Pattanayak, J. Houp, P. Stock, 2023, Human Immunology.

Determining the specificities of TALENs, Cas9, and other genome-editing enzymes.

David R. Liu, V. Pattanayak, J. Guilinger, 2014, Methods in enzymology.

Analysis of off-target effects in CRISPR-based gene drives in the human malaria mosquito

J. Joung, V. Pattanayak, A. Crisanti, 2021, Proceedings of the National Academy of Sciences.

Non-Invasive Monitoring for Rejection in Kidney Transplant Recipients After SARS-CoV-2 mRNA Vaccination

V. Pattanayak, J. Azzi, P. Cravedi, 2022, Frontiers in Immunology.

Global-scale CRISPR gene editor specificity profiling by ONE-seq identifies population-specific, variant off-target effects

Martin J. Aryee, Matthew C. Canver, David R. Liu, 2021, bioRxiv.

“Unexpected mutations after CRISPR-Cas9 editing in vivo” are most likely pre-existing sequence variants and not nuclease-induced mutations

Jonathan Y. Hsu, J. Joung, C. Lareau, 2017, bioRxiv.

GGTGTTGGGGAACACAGACCGTCATTCGATTAAAAAGAATCTTATCGGTGCCCTCCTATTCGATAGTGGCGAAACGGCAGAGGCGACTCGCCTGA AACGAACCGCTCGGAGAAGGTATACACGTCGCAAGAACCGAATATGTTACTTACAAGAAATTTTTAGCAATGAGATGGCCAAAGTTGACGATTCTTT CTTTCACCGTTTGGAAGAGTCCTTCCTTGTCGAAGAGGACAAGAAACATGAACGGCACCCCATCTTTGGAAACATAGTAGATGAGGTGGCATATCA TGAAAAGTA

J. Joung, V. Pattanayak, S. Tsai, 2015 .

Tebentafusp in the Treatment of Metastatic Uveal Melanoma: Patient Selection and Special Considerations

V. Pattanayak, R. Sullivan, K. Montazeri, 2023, Drug design, development and therapy.

Directed evolution and substrate specificity profile of homing endonuclease I-SceI.

David R. Liu, V. Pattanayak, J. Doyon, 2006, Journal of the American Chemical Society.

Finding platelets: Don't let the perfect be the enemy of the good

V. Pattanayak, G. Mahowald, P. Brunker, 2021, Transfusion.

In silico abstraction of zinc finger nuclease cleavage profiles reveals an expanded landscape of off-target sites

Bradley E. Bernstein, J. Keith Joung, David R. Liu, 2013, Nucleic acids research.

Gene editing without ex vivo culture evades genotoxicity in human hematopoietic stem cells

Shondra M. Pruett-Miller, J. Joung, V. Pattanayak, 2023, bioRxiv.

Use of routine complete blood count results to rule out anaplasmosis without the need for specific diagnostic testing.

Melis N. Anahtar, E. Rosenberg, V. Pattanayak, 2019, Clinical Infectious Diseases.

SHERLOCK and DETECTR Open a New Frontier in Molecular Diagnostics.

Karl Petri, Vikram Pattanayak, V. Pattanayak, 2018, The CRISPR journal.

Targeted genome editing in human cells using CRISPR/Cas nucleases and truncated guide RNAs.

Ken W. Y. Cho, J Keith Joung, Margaret B. Fish, 2014, Methods in enzymology.

Determining the specificities of TALENs, Cas9, and other genome-editing enzymes.

David R. Liu, V. Pattanayak, J. Guilinger, 2014, Methods in enzymology.

Revealing Off-Target Cleavage Specificities of Zinc Finger Nucleases by In Vitro Selection

C. L. Ramirez, J. Joung, V. Pattanayak, 2011, Nature Methods.

High-fidelity CRISPR-Cas9 variants with undetectable genome-wide off-targets you. Your story matters

V. Pattanayak, B. Kleinstiver, Zongli Zheng, 2016 .