F. Haluska

发表

G. Landes, A. Lash, K. Kinzler, 1999, Nature Genetics.

Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib.

Patricia L. Harris, D. Louis, D. Christiani, 2004, The New England journal of medicine.

Effects of Ketoconazole on the Pharmacokinetics of Ponatinib in Healthy Subjects

F. Haluska, D. Dorer, D. Sonnichsen, 2013, Journal of clinical pharmacology.

Ponatinib in refractory Philadelphia chromosome-positive leukemias.

I. Flinn, T. Clackson, H. Kantarjian, 2012, The New England journal of medicine.

Sequence analysis of the MYC oncogene involved in the t(8;14)(q24;q11) chromosome translocation in a human leukemia T-cell line indicates that putative regulatory regions are not altered.

P. Nowell, C. Croce, F. Haluska, 1988, Proceedings of the National Academy of Sciences of the United States of America.

The molecular genetics of chromosomal translocations in lymphoid malignancy

G. Russo, F. Haluska, 1995 .

Molecular genetics of lymphoid tumorigenesis.

M. Isobe, G. Russo, C. Croce, 1989, Progress in nucleic acid research and molecular biology.

Southwest Oncology Group S0008: a phase III trial of high-dose interferon Alfa-2b versus cisplatin, vinblastine, and dacarbazine, plus interleukin-2 and interferon in patients with high-risk melanoma--an intergroup study of cancer and leukemia Group B, Children's Oncology Group, Eastern Cooperative

V. Sondak, M. Atkins, B. Redman, 2014, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Randomized trial of an allogeneic melanoma lysate vaccine with low-dose interferon Alfa-2b compared with high-dose interferon Alfa-2b for Resected stage III cutaneous melanoma.

M. Atkins, F. Haluska, M. Ernstoff, 2007, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Identification of PTEN/MMAC1 alterations in uncultured melanomas and melanoma cell lines

F. Haluska, H. Tsao, E. Benoit, 1998, Oncogene.

Loss of expression of the p16/cyclin-dependent kinase inhibitor 2 tumor suppressor gene in melanocytic lesions correlates with invasive stage of tumor progression.

F. Haluska, C. Shea, F. Loganzo, 1995, Cancer research.

Graft-versus-Host Disease Associated with Transfusion of Blood from Unrelated HLA-Homozygous Donors

J. Dover, R. Shivdasani, F. Haluska, 1993 .

Ponatinib efficacy and safety in Philadelphia chromosome-positive leukemia: final 5-year results of the phase 2 PACE trial.

Martin C. Müller, M. Baccarani, H. Kantarjian, 2018, Blood.

UV-Induced Melanoma via Suppression of XPC Mice toV 600 ELoss of ARF Sensitizes Transgenic BRAF

G. Hu, F. Haluska, P. Hinds, 2013 .

Loss of ARF sensitizes transgenic BRAFV600E mice to UV-induced melanoma via suppression of XPC.

G. Hu, F. Haluska, P. Hinds, 2013, Cancer research.

Genetic Interaction Between NRAS and BRAF Mutations and PTEN / MMAC 1 Inactivation in Melanoma

F. Haluska, Guang Yang, H. Tsao, 2010 .

Novel mutations in the p16/CDKN2A binding region of the cyclin-dependent kinase-4 gene.

A. Sober, F. Haluska, C. Thiele, 1998, Cancer research.

Initial Findings From the PACE Trial: A Pivotal Phase 2 Study of Ponatinib in Patients with CML and Ph+ ALL Resistant or Intolerant to Dasatinib or Nilotinib, or with the T315I Mutation

T. Clackson, M. Baccarani, J. Dipersio, 2011 .

The cellular biology of the Reed-Sternberg cell.

F. Haluska, A. Brufsky, G. Canellos, 1994, Blood.

Screening strategies for cancer. Implications and results.

F. Haluska, B. Chabner, J. Talcott, 1997, JAMA.

Randomized Phase II Trial of Ridaforolimus in Advanced Endometrial Carcinoma.

A. Oza, F. Haluska, S. Pignata, 2015, Journal of Clinical Oncology.

Mutations of the CDKN2/p16INK4 gene in Australian melanoma kindreds.

N. Hayward, F. Haluska, N. Dracopoli, 1995, Human molecular genetics.

Relative reciprocity of NRAS and PTEN/MMAC1 alterations in cutaneous melanoma cell lines.

F. Haluska, X. Zhang, H. Tsao, 2000, Cancer research.

First-in-human dose-finding study of the ALK/EGFR inhibitor AP26113 in patients with advanced malignancies: Updated results.

T. Clackson, A. Shaw, S. Gettinger, 2013 .

Melanocytic nevus-like hyperplasia and melanoma in transgenic BRAFV600E mice

N. Ibrahim, S. Westmoreland, F. Haluska, 2009, Oncogene.

Oncogene activation by chromosome translocation in human malignancy.

F. Haluska, Y. Tsujimoto, C. Croce, 1987, Annual review of genetics.

Antimelanoma Activity of CTL Generated from Peripheral Blood Mononuclear Cells After Stimulation with Autologous Dendritic Cells Pulsed with Melanoma gp100 Peptide G209-2M Is Correlated to TCR Avidity

G. Linette, F. Haluska, S. Longerich, 2002, The Journal of Immunology.

Low prevalence of germline CDKN2A and CDK4 mutations in patients with early-onset melanoma.

D. Finkelstein, A. Sober, F. Haluska, 2000, Archives of Dermatology.

Loss of the p16INK4a and p15INK4b genes, as well as neighboring 9p21 markers, in sporadic melanoma.

M. Bulyk, D. Housman, N. Hayward, 1996, Cancer research.

Impact of dose intensity of ponatinib on selected adverse events: Multivariate analyses from a pooled population of clinical trial patients.

M. Baccarani, F. Haluska, J. Cortes, 2016, Leukemia research.

Immunization Using Autologous Dendritic Cells Pulsed with the Melanoma-Associated Antigen gp100-Derived G280-9V Peptide Elicits CD8+ Immunity

G. Linette, F. Hodi, A. Sober, 2005, Clinical Cancer Research.

HLA-A2.1/K(b) transgenic murine dendritic cells transduced with an adenovirus encoding human gp100 process the same A2.1-restricted peptide epitopes as human antigen-presenting cells and elicit A2.1-restricted peptide-specific CTL.

G. Linette, F. Haluska, B. Roberts, 2000, Cellular Immunology.

G 2092 M Is Correlated to TCR Avidity Cells Pulsed with Melanoma gp 100 Peptide After Stimulation with Autologous Dendritic from Peripheral Blood Mononuclear Cells Antimelanoma Activity of CTL Generated

G. Linette, F. Haluska, S. Longerich, 2002 .

Molecular analysis of an AIDS-associated Burkitt's lymphoma: near-identity with endemic cases.

G. Russo, C. Croce, M. Andreeff, 1988, Current topics in microbiology and immunology.

Adjuvant therapy of melanoma with interferon‐alpha‐2b is associated with mania and bipolar syndromes

E. Jonasch, M. Gadd, A. Sober, 2000, Cancer.

Localization of the human JUN protooncogene to chromosome region 1p31-32.

M. Isobe, C. Croce, K. Huebner, 1988, Proceedings of the National Academy of Sciences of the United States of America.

12 – Involvement of the Immunoglobulin Loci in B-Cell Neoplasia

F. Haluska, L. Finger, C. Croce, 1989 .

A highly conserved processed PTEN pseudogene is located on chromosome band 9p21

M. FitzGerald, D. Haber, A. Deimling, 1998, Oncogene.

Mapping chromosomal breakpoints of Burkitt's t(8;14) translocations far upstream of c-myc.

C. Croce, F. Haluska, H. Hameister, 1992, Cancer research.

Hypopigmentation associated with an adenovirus-mediated gp100/MART-1-transduced dendritic cell vaccine for metastatic melanoma.

G. Linette, M. Goldberg, F. Hodi, 2002, Archives of dermatology.

Impact of Dose Intensity of Ponatinib on Selected Adverse Events: Multivariate Analyses from a Pooled Population of Clinical Trial Patients

M. Baccarani, F. Haluska, J. Cortes, 2014 .

Ponatinib Efficacy and Safety in Patients with the T315I Mutation: Long-Term Follow-up of Phase 1 and Phase 2 (PACE) Trials

I. Flinn, T. Clackson, M. Baccarani, 2014 .

Ponatinib (PON) in patients (pts) with Philadelphia chromosome-positive (Ph+) leukemias resistant or intolerant to dasatinib or nilotinib, or with the T315I mutation: Longer-term follow up of the PACE trial.

M. Baccarani, J. Dipersio, H. Kantarjian, 2014 .

P3.02a-013 Brigatinib in Crizotinib-Refractory ALK+ NSCLC: Central Assessment and Updates from ALTA, a Pivotal Randomized Phase 2 Trial: Topic: ALK Clinical

Edward S. Kim, H. Groen, T. Clackson, 2017 .

Ponatinib versus imatinib for newly diagnosed chronic myeloid leukaemia: an international, randomised, open-label, phase 3 trial.

T. Clackson, M. Baccarani, R. Clark, 2016, The Lancet. Oncology.

Long-Term Follow-up of Ponatinib Efficacy and Safety in the Phase 2 PACE Trial

Martin C. Müller, T. Clackson, M. Baccarani, 2014 .

Phase II Study of Paclitaxel and Carboplatin for Malignant Melanoma

Jeffrey W. Clark, F. Hodi, D. Finkelstein, 2002, American journal of clinical oncology.

Molecular resemblance of an AIDS-associated lymphoma and endemic Burkitt lymphomas: implications for their pathogenesis.

G. Russo, C. Croce, F. Haluska, 1989, Proceedings of the National Academy of Sciences of the United States of America.

A Phase 1 Trial of Oral Ponatinib (AP24534) In Patients with Refractory Chronic Myelogenous Leukemia (CML) and Other Hematologic Malignancies: Emerging Safety and Clinical Response Findings

I. Flinn, T. Clackson, H. Kantarjian, 2010 .

Ponatinib in Japanese patients with Philadelphia chromosome-positive leukemia, a phase 1/2 study

H. Iwasaki, T. Naoe, T. Kyo, 2017, International Journal of Hematology.

Analysis of the potential effect of ponatinib on the QTc interval in patients with refractory hematological malignancies

I. Flinn, H. Kantarjian, F. Haluska, 2011, Cancer Chemotherapy and Pharmacology.

Cloning of the gene encoding the delta subunit of the human T-cell receptor reveals its physical organization within the alpha-subunit locus and its involvement in chromosome translocations in T-cell malignancy.

M. Isobe, G. Russo, C. Croce, 1988, Proceedings of the National Academy of Sciences of the United States of America.

4-year results of the ponatinib phase II PACE trial in patients (pts) with heavily pretreated leukemia.

M. Baccarani, H. Kantarjian, F. Haluska, 2016 .

Efficacy and Safety of Ponatinib in Patients with Accelerated Phase or Blast Phase Chronic Myeloid Leukemia (AP-CML or BP-CML) or Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia (Ph+ ALL): 12-Month Follow-up of the PACE Trial

Martin C. Müller, T. Clackson, M. Baccarani, 2012 .

Phase II Study of Ponatinib in Advanced Gastrointestinal Stromal Tumors: Efficacy, Safety, and Impact of Liquid Biopsy and Other Biomarkers

J. Hodgson, J. Fletcher, J. Pritchard, 2022, Clinical cancer research : an official journal of the American Association for Cancer Research.

Compound mutations in BCR-ABL1 are not major drivers of primary or secondary resistance to ponatinib in CP-CML patients.

Martin C. Müller, J. Hodgson, T. Clackson, 2016, Blood.

Ponatinib in patients with refractory acute myeloid leukaemia: findings from a phase 1 study

I. Flinn, T. Clackson, H. Kantarjian, 2013, British journal of haematology.

Ponatinib in patients with acute myeloid leukemia (AML): Preliminary findings from a phase I study in hematologic malignancies.

I. Flinn, T. Clackson, H. Kantarjian, 2011, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

A Phase 1 Trial of Oral AP24534 in Patients with Refractory Chronic Myeloid Leukemia and Other Hematologic Malignancies: First Results of Safety and Clinical Activity against T315I and Resistant Mutations.

I. Flinn, T. Clackson, H. Kantarjian, 2009 .

A Pivotal Phase 2 Trial of Ponatinib in Patients with Chronic Myeloid Leukemia (CML) and Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia (Ph+ALL) Resistant or Intolerant to Dasatinib or Nilotinib, or with the T315I BCR-ABL Mutation: 12-Month Follow-up of the PACE Trial

Martin C. Müller, T. Clackson, M. Baccarani, 2012 .

Induction of ocular neoplasms in Wistar rat by N-methyl-N-nitrosourea.

C. Puliafito, F. Haluska, D. Albert, 1986, Experimental eye research.

Results of the phase III, placebo-controlled trial (SUCCEED) evaluating the mTOR inhibitor ridaforolimus (R) as maintenance therapy in advanced sarcoma patients (pts) following clinical benefit from prior standard cytotoxic chemotherapy (CT).

J. Blay, G. Demetri, A. Cesne, 2011, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Preliminary characterization of oral lesions associated with inhibitors of mammalian target of rapamycin in cancer patients

G. Demetri, F. Haluska, S. Sonis, 2009, Cancer.

A First-In-Human Dose-Finding Study of the Alk/Egfr Inhibitor AP26113 in Patients with Advanced Malignancies

T. Clackson, A. Shaw, S. Gettinger, 2012 .

Molecular Mechanisms of Chromosome Translocation in Human B‐ and T‐cell Neoplasia a

C. Croce, F. Haluska, C. Croce, 1987, Annals of the New York Academy of Sciences.

Efficacy and Safety Of Ponatinib Following Failure Of Dasatinib In Patients (pts) With Chronic Phase Chronic Myeloid Leukemia (CP-CML) In The PACE Trial

Martin C. Müller, T. Clackson, M. Baccarani, 2013 .

Phase III trial of high-dose interferon alpha-2b versus cisplatin, vinblastine, DTIC plus IL-2 and interferon in patients with high-risk melanoma (SWOG S0008): An intergroup study of CALGB, COG, ECOG, and SWOG.

V. Sondak, M. Atkins, B. Redman, 2012 .

Lack of phospholipase A2 mutations in neuroblastoma, melanoma and colon‐cancer cell lines

D. Housman, A. Goldstein, F. Haluska, 1997, International journal of cancer.

Loss of the pJ 6 INK 4 aand @ 15 INK 4 bGenes , as well as Neighboring 9 p 2 i Markers , in Sporadic Melanoma 1

M. Bulyk, D. Housman, N. Hayward, 2022 .

Suppressor Gene in Melanocytic Lesions Correlates with Invasive Stage of Tumor Progression1

F. Haluska, C. Shea, F. Loganzo, 1995 .

Outcome of patients with melanoma and histologically negative sentinel lymph nodes.

M. Mihm, M. Gadd, T. Flotte, 1999, Archives of surgery.

Mechanisms of chromosome translocation in B- and T-cell neoplasia

F. Haluska, Y. Tsujimoto, C. Croce, 1987 .

More clues to gene rearrangements

F. Haluska, C. Croce, FRANK G. HALUSKA, 1987, Nature.

Wilms' tumor protein WT1 as an ovarian transcription factor: decreases in expression during follicle development and repression of inhibin-alpha gene promoter.

D. Housman, M. Kubo, F. Haluska, 1995, Molecular endocrinology.

Brigatinib in Patients With Crizotinib-Refractory Anaplastic Lymphoma Kinase-Positive Non-Small-Cell Lung Cancer: A Randomized, Multicenter Phase II Trial.

Edward S. Kim, H. Groen, E. Smit, 2017, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Surgical management of primary cutaneous melanomas of the hands and feet.

M. Mihm, M. Gadd, A. Sober, 1997, Annals of surgery.

The gene for schnyder's crystalline corneal dystrophy maps to human chromosome 1p34.1-p36.

X. Wu, T. Hudson, D. Housman, 1997, Human molecular genetics.

The Gene for Schnyder's Crystalline Corneal Dystrophy Maps to Human Chromosome 1p34.1–p36

T. Hudson, D. Housman, F. Haluska, 1996 .

Interferon in oncological practice: review of interferon biology, clinical applications, and toxicities.

E. Jonasch, F. Haluska, E. Jonasch, 2001, The oncologist.

Patient preferences for adjuvant interferon alfa-2b treatment.

M. Atkins, J. Kirkwood, A. Sober, 2001, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Bcl-2 antisense (oblimersen sodium) plus dacarbazine in patients with advanced melanoma: the Oblimersen Melanoma Study Group.

H. Pehamberger, M. Gore, J. Kirkwood, 2006, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Molecular genetics of familial cutaneous melanoma.

F. Hodi, F. Haluska, F. Hodi, 1998, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Genetic Alterations in Signaling Pathways in Melanoma

F. Haluska, H. Tsao, V. Goel, 2006, Clinical Cancer Research.

Results of an international randomized phase III trial of the mammalian target of rapamycin inhibitor ridaforolimus versus placebo to control metastatic sarcomas in patients after benefit from prior chemotherapy.

J. Blay, Ruey-min Lee, G. Demetri, 2013, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Molecular pathogenesis of cutaneous melanocytic neoplasms.

N. Ibrahim, F. Haluska, 2009, Annual review of pathology.

Novel Mutations in the p 16 / CDKN 2 A Binding Region of the Cyclin-dependent Kinase-4 Gene 1

A. Sober, F. Haluska, C. Thiele, 2022 .

PTEN signaling pathways in melanoma

F. Haluska, V. Goel, Heng Wu, 2003, Oncogene.

Evolution of B-cell malignancy: pre-B-cell leukemia resulting from MYC activation in a B-cell neoplasm with a rearranged BCL2 gene.

P. Nowell, F. Haluska, Y. Tsujimoto, 1988, Proceedings of the National Academy of Sciences of the United States of America.

The t(8;14) breakpoint of the EW 36 undifferentiated lymphoma cell line lies 5' of MYC in a region prone to involvement in endemic Burkitt's lymphomas.

F. Haluska, Y. Tsujimoto, C. Croce, 1988, Nucleic acids research.

The t(8;14) chromosome translocation of the Burkitt lymphoma cell line Daudi occurred during immunoglobulin gene rearrangement and involved the heavy chain diversity region.

F. Haluska, Y. Tsujimoto, C. Croce, 1987, Proceedings of the National Academy of Sciences of the United States of America.

The t(8; 14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V–D–J joining

F. Haluska, Y. Tsujimoto, S. Finver, 1986, Nature.

Biologic activity of cytotoxic T lymphocyte-associated antigen 4 antibody blockade in previously vaccinated metastatic melanoma and ovarian carcinoma patients

Thomas Davis, F. Stephen Hodi, M. Mihm, 2003, Proceedings of the National Academy of Sciences of the United States of America.

Ridaforolimus as a single agent in advanced endometrial cancer: results of a single-arm, phase 2 trial

D. Matei, M. Einstein, F. Haluska, 2013, British Journal of Cancer.

Genetic interaction between NRAS and BRAF mutations and PTEN/MMAC1 inactivation in melanoma.

F. Haluska, Guang Yang, H. Tsao, 2004, The Journal of investigative dermatology.

Examination of mutations in BRAF, NRAS, and PTEN in primary cutaneous melanoma.

C. Warneke, F. Haluska, M. Redston, 2006, The Journal of investigative dermatology.

Phase II study of the farnesyltransferase inhibitor R115777 in advanced melanoma (CALGB 500104)

G. Linette, F. Haluska, D. Niedzwiecki, 2012, Journal of Translational Medicine.

Phase II study of the farnesyltransferase inhibitor R115777 in advanced melanoma (CALGB 500104)

G. Linette, F. Haluska, D. Niedzwiecki, 2006, Journal of Translational Medicine.

Vaccination with irradiated, autologous melanoma cells engineered to secrete granulocyte-macrophage colony-stimulating factor by adenoviral-mediated gene transfer augments antitumor immunity in patients with metastatic melanoma.

D. Neuberg, M. Mihm, F. Hodi, 2003, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

A randomized phase II (RP2) trial of ridaforolimus (R) compared with progestin (P) or chemotheraphy (C) in female adult patients with advanced endometrial carcinoma.

A. Oza, F. Haluska, S. Pignata, 2011, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Phase I/IIa trial of the mammalian target of rapamycin inhibitor ridaforolimus (AP23573; MK-8669) administered orally in patients with refractory or advanced malignancies and sarcoma.

A. Tolcher, W. Tap, F. Haluska, 2013, Annals of Oncology.

Phase II study of the mammalian target of rapamycin inhibitor ridaforolimus in patients with advanced bone and soft tissue sarcomas.

J. Blay, G. Demetri, T. Clackson, 2012, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Phase IB study of the mTOR inhibitor ridaforolimus with capecitabine.

F. Rojo, J. Albanell, F. Haluska, 2010, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Phase Ib study of weekly mammalian target of rapamycin inhibitor ridaforolimus (AP23573; MK-8669) with weekly paclitaxel.

F. Rojo, J. Albanell, F. Haluska, 2010, Annals of oncology : official journal of the European Society for Medical Oncology.

A Multicenter, First-in-Pediatrics, Phase 1, Pharmacokinetic and Pharmacodynamic Study of Ridaforolimus in Patients with Refractory Solid Tumors

F. Haluska, Amy A. Smith, H. Katzenstein, 2013, Clinical Cancer Research.

Cancer Therapy : Clinical A Multicenter , First-in-Pediatrics , Phase 1 , Pharmacokinetic and Pharmacodynamic Study of Ridaforolimus in Patients with Refractory Solid Tumors

F. Haluska, Amy A. Smith, H. Katzenstein, 2013 .

The cellular biology of the Reed-Sternberg cell.

F. Haluska, A. Brufsky, G. Canellos, 1994, Blood.

Therapeutic targets in melanoma: MAPKinase pathway

N. Ibrahim, F. Haluska, Frank G Haluska, 2006, Current oncology reports.

Adjuvant interferon for stage II melanoma.

F. Haluska, 1998, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Updated efficacy and safety of the ALK inhibitor AP26113 in patients (pts) with advanced malignancies, including ALK+ non-small cell lung cancer (NSCLC).

T. Clackson, A. Shaw, S. Gettinger, 2014 .

The RTK/RAS/BRAF/PI3K pathways in melanoma: biology, small molecule inhibitors, and potential applications.

T. Pemberton, N. Ibrahim, F. Haluska, 2007, Seminars in oncology.

Melanoma in the young: Differences and similarities with adult melanoma

M. Mihm, A. Sober, F. Haluska, 2007, Cancer.

Effects of food on the pharmacokinetics of ponatinib in healthy subjects

F. Haluska, D. Sonnichsen, K. Niland, 2013, Journal of clinical pharmacy and therapeutics.

Safety and preliminary efficacy analysis of the mTOR inhibitor ridaforolimus in patients with taxane-treated, castration-resistant prostate cancer.

M. Gross, G. Bubley, G. Wilding, 2012, Clinical genitourinary cancer.

A phase 2 trial of ponatinib in Philadelphia chromosome-positive leukemias.

T. Clackson, M. Baccarani, J. Dipersio, 2013, The New England journal of medicine.

Activity and safety of brigatinib in ALK-rearranged non-small-cell lung cancer and other malignancies: a single-arm, open-label, phase 1/2 trial.

T. Clackson, A. Shaw, S. Gettinger, 2016, The Lancet. Oncology.

Phase I trial of AP24534 in patients with refractory chronic myeloid leukemia (CML) and hematologic malignancies.

I. Flinn, H. Kantarjian, F. Haluska, 2010 .

Molecular genetics of human B- and T-cell neoplasia.

J Erikson, C. Croce, F. Haluska, 1986, Cold Spring Harbor symposia on quantitative biology.

Phase 2 Study of the g209-2M Melanoma Peptide Vaccine and Low-Dose Interleukin-2 in Advanced Melanoma: Cancer and Leukemia Group B 509901

John D Roberts, Donna Niedzwiecki, Alan Houghton, 2006, Journal of immunotherapy.

Quality-of-Life–Adjusted Survival Analysis of High-Dose Adjuvant Interferon Alfa-2b for High-Risk Melanoma Patients Using Intergroup Clinical Trial Data

J. Kirkwood, F. Haluska, J. Weeks, 2002 .

Mutational and expression analysis of the p73 gene in melanoma cell lines.

F. Haluska, X. Zhang, H. Tsao, 1999, Cancer research.

Novel inhibitors in the treatment of metastatic melanoma

F. Haluska, K. Kalinsky, 2007, Expert review of anticancer therapy.

Treatment of Melanoma with 5-Fluorouracil or Dacarbazine In Vitro Sensitizes Cells to Antigen-Specific CTL Lysis through Perforin/Granzyme- and Fas-Mediated Pathways1

F. Haluska, Sixun Yang, 2004, The Journal of Immunology.

A phase 1 study of oral ridaforolimus in pediatric patients with advanced solid tumors

Sara M. Federico, B. Geoerger, F. Haluska, 2016, Oncotarget.

Immunologic and clinical effects of antibody blockade of cytotoxic T lymphocyte-associated antigen 4 in previously vaccinated cancer patients

D. Neuberg, M. Mihm, G. Dranoff, 2008, Proceedings of the National Academy of Sciences.

Melanoma of unknown primary: experience at Massachusetts General Hospital and Dana-Farber Cancer Institute

F. Hodi, A. Sober, F. Haluska, 2005, Melanoma research.

In Vitro Priming with Adenovirus/gp100 Antigen-Transduced Dendritic Cells Reveals the Epitope Specificity of HLA-A*0201-Restricted CD8+ T Cells in Patients with Melanoma1

G. Linette, F. Haluska, F. Preffer, 2000, Journal of Immunology.

Recent advances in the molecular genetics of malignant melanoma.

D. Housman, F. Haluska, 1995, Cancer Surveys.

Innovations and Challenges in Melanoma: Summary Statement from the First Cambridge Conference

M. Weinstock, V. Sondak, D. Elder, 2006, Clinical Cancer Research.

Patients with Melanoma T Cells in + HLA-A * 0201-Restricted CD 8 the Epitope Specificity of Antigen-Transduced Dendritic Cells Reveals In Vitro Priming with Adenovirus / gp 100

G. Linette, F. Haluska, F. Preffer, 2000 .

Cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) antibody blockade in patients previously vaccinated with irradiated, autologous tumor cells engineered to secrete granulocyte-macrophage colony stimulating factor (GM-CSF).

M. Mihm, F. Hodi, G. Dranoff, 2004, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Variable breakpoints in Burkitt lymphoma cells with chromosomal t(8;14) translocation separate c-myc and the IgH locus up to several hundred kb.

P. Lichter, F. Haluska, G. Lenoir, 1992, Human molecular genetics.

Skin cancer prevention and detection practices among siblings of patients with melanoma.

Donald R. Miller, K. Emmons, B. Gilchrest, 2003, Journal of the American Academy of Dermatology.

Safety and efficacy of brigatinib (AP26113) in advanced malignancies, including ALK+ non–small cell lung cancer (NSCLC).

T. Clackson, A. Shaw, S. Gettinger, 2015 .

Identification and mutation analysis of DOC-1R, a DOC-1 growth suppressor-related gene.

D. Housman, R. Todd, D. Wong, 1999, Biochemical and biophysical research communications.

Epic: A Phase 3 Trial of Ponatinib Compared with Imatinib in Patients with Newly Diagnosed Chronic Myeloid Leukemia in Chronic Phase (CP-CML)

T. Clackson, M. Baccarani, R. Clark, 2014 .

Brigatinib (BRG) in patients (pts) with crizotinib (CRZ)-refractory ALK+ non-small cell lung cancer (NSCLC): First report of efficacy and safety from a pivotal randomized phase (ph) 2 trial (ALTA).

Edward S. Kim, H. Groen, E. Smit, 2016 .

Long-Term Follow-up of a Phase 1 Study of Ponatinib in Patients with Chronic-Phase Chronic Myeloid Leukemia (CP-CML)

I. Flinn, T. Clackson, H. Kantarjian, 2014 .

Clinical impact of dose modification and dose intensity on response to ponatinib (PON) in patients (pts) with Philadelphia chromosome-positive (Ph+) leukemias.

M. Baccarani, H. Kantarjian, F. Haluska, 2014 .

Ponatinib In Heavily Pretreated Patients With Chronic Phase Chronic Myeloid Leukemia (CP-CML): Management Of Adverse Events (AEs)

Martin C. Müller, M. Baccarani, J. Dipersio, 2013 .

EPIC: A phase III trial of ponatinib (PON) versus imatinib (IM) in patients (pts) with newly diagnosed CP-CML.

T. Clackson, M. Baccarani, H. Kantarjian, 2014 .

Subset Analysis of Response to Treatment of Chronic Phase CML in a Phase 1 Study of Ponatinib in Refractory Hematologic Malignancies

I. Flinn, T. Clackson, H. Kantarjian, 2011 .

1292PALK INHIBITOR AP26113 IN PATIENTS WITH ADVANCED MALIGNANCIES, INCLUDING ALK+ NON-SMALL CELL LUNG CANCER (NSCLC): UPDATED EFFICACY AND SAFETY DATA.

T. Clackson, A. Shaw, S. Gettinger, 2014, Annals of oncology : official journal of the European Society for Medical Oncology.

Clinical Impact Of Dose Modification On Response To Ponatinib In Patients With Chronic Phase Chronic Myeloid Leukemia (CP-CML)

Martin C. Müller, T. Clackson, M. Baccarani, 2013 .

Four-year minimum follow-up of ongoing patients (pts) with chronic-phase chronic myeloid leukemia (CP-CML) in a phase 1 trial of ponatinib (PON).

I. Flinn, T. Clackson, H. Kantarjian, 2015 .

Adjuvant high-dose interferon alfa-2b in patients with high-risk melanoma.

G. Linette, M. Mihm, M. Gadd, 2000, Cancer journal.

Activity and safety of brigatinib (BRG) in patients (pts) with ALK+ non–small cell lung cancer (NSCLC): Phase (ph) 1/2 trial results.

A. Shaw, S. Gettinger, R. Salgia, 2016 .

Impact Of Baseline (BL) Mutations, Including Low-Level and Compound Mutations, On Ponatinib Response and End Of Treatment (EOT) Mutation Analysis In Patients (Pts) With Chronic Phase Chronic Myeloid Leukemia (CP-CML)

Martin C. Müller, T. Clackson, M. Baccarani, 2013 .

PACE: A pivotal phase II trial of ponatinib in patients with CML and Ph+ALL resistant or intolerant to dasatinib or nilotinib, or with the T315I mutation.

Martin C. Müller, M. Baccarani, J. Dipersio, 2012 .

Phase II study of temozolomide and thalidomide in patients with metastatic melanoma in the brain

A. Houghton, F. Haluska, D. Niedzwiecki, 2006, Cancer.

TGAAATGCAGTGGTCGTTACGC TCCACC AAGAAAGCAGGAACC TGTGGTATGAA CAAATCAA CTTATGTGT TGACC TTTAGAGAGTTGC TTACGTGGCC TGTTCAACACAGACCCACCC AGAGCCC TCC TGCCC TCC TTCCGCGGGGGC T TTC TC AGGC TGTCC TTC AGGGTC TTCCTGAAATGC AGTGG TCGTT CGC ACCAAGAAAGCAGGAAC TGGTATGAA CGAATCAACTTATGTGTTGAC TTAGAGAG TGCTTAC TGGCCTGTT

F. Haluska, Y. Tsujimoto, C. Croce, 2022 .

PACE: A Pivotal Phase 2 Trial of Ponatinib in Patients With CML and Ph+ ALL Resistant or Intolerant to Dasatinib or Nilotinib, or With the T315I Mutation

M. Baccarani, J. Dipersio, H. Kantarjian, 2013 .

Multivariate Analyses of the Clinical and Molecular Parameters Associated with Efficacy and Safety in Patients with Chronic Myeloid Leukemia (CML) and Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia (Ph+ ALL) Treated with Ponatinib in the PACE Trial

Martin C. Müller, T. Clackson, M. Baccarani, 2012 .

Phase Ib study of weekly mammalian target of rapamycin inhibitor ridaforolimus (AP23573; MK-8669) with weekly paclitaxel.

F. Haluska, L. Gianni, S. Cresta, 2010, Annals of oncology : official journal of the European Society for Medical Oncology.

Phase III, placebo-controlled trial (SUCCEED) evaluating ridaforolimus as maintenance therapy in advanced sarcoma patients following clinical benefit from prior standard cytotoxic chemotherapy: Long-term (≥ 24 months) overall survival results.

J. Blay, G. Demetri, A. Cesne, 2012 .

Experimental gypsy moth (Lymantria dispar) ophthalmia nodosa.

C. Puliafito, F. Haluska, D. Albert, 1983, Archives of ophthalmology.

p380-8A 1.8 SaSs, a single copy clone 5' of c-myc at 8q24 which recognizes an SstI polymorphism.

C. Croce, K. Huebner, F. Haluska, 1987, Nucleic acids research.

Phase I/IIa trial of the mammalian target of rapamycin inhibitor ridaforolimus (AP23573; MK-8669) administered orally in patients with refractory or advanced malignancies and sarcoma.

A. Tolcher, W. Tap, F. Haluska, 2013, Annals of Oncology.

Phase IB study of the mTOR inhibitor ridaforolimus with capecitabine.

F. Rojo, J. Albanell, F. Haluska, 2010, Journal of Clinical Oncology.