D. Fearon

发表

The Instructive Role of Innate Immunity in the Acquired Immune Response

R. Locksley, D. Fearon, 1996, Science.

The complement system and adaptive immunity.

D. Fearon, 1998, Seminars in immunology.

Human alternative complement pathway: membrane-associated sialic acid regulates the competition between B and beta1 H for cell-bound C3b.

M. Kazatchkine, D. Fearon, K. Austen, 1979, Journal of immunology.

Regulation by membrane sialic acid of beta1H-dependent decay-dissociation of amplification C3 convertase of the alternative complement pathway.

D. Fearon, 1978, Proceedings of the National Academy of Sciences of the United States of America.

Control of the amplification convertase of complement by the plasma protein beta1H.

J. Weiler, D. Fearon, K. Austen, 1976, Proceedings of the National Academy of Sciences of the United States of America.

T cell exclusion, immune privilege, and the tumor microenvironment

D. Fearon, J. Joyce, 2015, Science.

A soluble divalent class I major histocompatibility complex molecule inhibits alloreactive T cells at nanomolar concentrations.

D. Tuveson, D. Fearon, J. D. Dal Porto, 1993, Proceedings of the National Academy of Sciences of the United States of America.

Classification of current anticancer immunotherapies

Axel Hoos, Patrizia Agostinis, Fernando Aranda, 2014, Oncotarget.

Suppression of Signal Transducer and Activator of Transcription 3–Dependent B Lymphocyte Terminal Differentiation by Bcl-6

D. Fearon, R. Reljic, S. Wagner, 2000, The Journal of experimental medicine.

Inflammation and cardiovascular disease: role of the interleukin-1 receptor antagonist.

D. Fearon, W. Fearon, 2008, Circulation.

A subpopulation of B220+ cells in murine bone marrow does not express CD19 and contains natural killer cell progenitors

D. Fearon, A. Rolink, F. Melchers, 1996, The Journal of experimental medicine.

The rationale for the IL‐2‐independent generation of the self‐renewing central memory CD8+ T cells

D. Fearon, J. Thaventhiran, James M. Carr, 2006, Immunological reviews.

IgM and stromal cell‐associated heparan sulfate / heparin as complement‐independent ligands for CD19

E. Johnsson, D. Fearon, A. D. de Fougerolles, 2001, European journal of immunology.

Identification of a restriction fragment length polymorphism by a CR1 cDNA that correlates with the number of CR1 on erythrocytes

D. Fearon, L. Klickstein, J. Weis, 1986, The Journal of experimental medicine.

Distinct fibroblast subsets drive inflammation and damage in arthritis

S. Raychaudhuri, H. Perlman, D. Fearon, 2019, Nature.

Bcl-6 uncouples B lymphocyte proliferation from differentiation.

D. Fearon, S. Wagner, P. Manders, 2002, Advances in experimental medicine and biology.

Complement: instructing the acquired immune system through the CD21/CD19 complex.

D. Fearon, P. Dempsey, 1996, Research in immunology.

Unresolved endoplasmic reticulum stress engenders immune-resistant, latent pancreatic cancer metastases

C. Iacobuzio-Donahue, S. Lyons, D. Fearon, 2017, Science.

Endoplasmic reticulum stress engenders immune-resistant, latent pancreatic cancer metastases

C. Iacobuzio-Donahue, S. Lyons, D. Fearon, 2017, bioRxiv.

Cancer Immunotherapy Trials Underutilize Immune Response Monitoring

D. Fearon, D. Jodrell, T. Janowitz, 2017, The Oncologist.

Inhibition of the B Cell by CD22: A Requirement for Lyn

Kenneth G. C. Smith, D. Fearon, M. Hibbs, 1998, The Journal of experimental medicine.

Purification of C3b inactivator and demonstration of its two polypeptide chain structure.

D. Fearon, 1977, Journal of immunology.

Fibroblastic reticular cells of the lymph node are required for retention of resting but not activated CD8+ T cells

D. Fearon, M. Linterman, Edward W. Roberts, 2014, Proceedings of the National Academy of Sciences.

Depletion of stromal cells expressing fibroblast activation protein-α from skeletal muscle and bone marrow results in cachexia and anemia

James O. Jones, S. Teichmann, S. O’Rahilly, 2013, The Journal of experimental medicine.

Immune-Suppressing Cellular Elements of the Tumor Microenvironment

D. Fearon, 2017 .

Carcinomas assemble a filamentous CXCL12–keratin-19 coating that suppresses T cell–mediated immune attack

J. Hechtman, D. Fearon, M. Yao, 2022, Proceedings of the National Academy of Sciences.

Pancreatic cancer cells assemble a CXCL12-keratin 19 coating to resist immunotherapy

J. Hechtman, D. Fearon, T. Janowitz, 2019, bioRxiv.

Pancreatic cancer cells assemble a CXCL12-keratin 19 coating to resist immunotherapy

J. Hechtman, D. Fearon, M. Yao, 2019, bioRxiv.

Roles of Stromal Cells in the Immune System

D. Fearon, Edward W. Roberts, A. Denton, 2016 .

Transcriptional regulation of effector and memory CD8+ T cell fates.

D. Fearon, L. Gattinoni, James E. D. Thaventhiran, 2013, Current opinion in immunology.

Receptor modulators of B-cell receptor signalling--CD19/CD22.

D. Fearon, K. G. Smith, 2000, Current topics in microbiology and immunology.

The incorporation of C3 nephritic factor (C3NeF) into a stabilized C3 convertase, C3bBb(C3NeF), and its release after decay of convertase function.

D. Fearon, K. Austen, M. Daha, 1977, Journal of immunology.

Formation in the presence of C3 nephritic factor (C3NeF) of an alternative pathway C3 convertase containing uncleaved B.

D. Fearon, K. Austen, M. Daha, 1976, Immunology.

BCL6b mediates the enhanced magnitude of the secondary response of memory CD8+ T lymphocytes.

R. Ahmed, S. Kaech, V. Cerundolo, 2005, Proceedings of the National Academy of Sciences of the United States of America.

Happy coupling: Recruiting both antigen and effector function

D. Fearon, 1997, Nature Biotechnology.

Recruitment of Effectors Cells Appears More Important Than Lymphoma: Signaling Activity on Tumor Monoclonal Antibody Therapy of B Cell

D. Fearon, T. Illidge, R. Parkhouse, 1998 .

Monoclonal antibody therapy of B cell lymphoma: signaling activity on tumor cells appears more important than recruitment of effectors.

D. Fearon, T. Illidge, G. Klaus, 1998, Journal of immunology.

Secondary Replicative Function of CD8+ T Cells That Had Developed an Effector Phenotype

D. Fearon, Oliver Bannard, Matthew Kraman, 2009, Science.

Self‐renewal of B‐1 lymphocytes is dependent on CD19

R. Hardy, D. Fearon, M. Schlissel, 1996, European journal of immunology.

CR1 and the cell membrane proteins that bind C3 and C4

D. Fearon, James G. Wilson, Nicolaos A. Andriopoulos, 1987, Immunologic research.

T cell-mediated development of stromal fibroblasts with an immune-enhancing chemokine profile

D. Fearon, Ran Yan, 2022, bioRxiv.

Human anti-endotoxin antibody HA-1A mediates complement-dependent binding of Escherichia coli J5 lipopolysaccharide to complement receptor type 1 of human erythrocytes and neutrophils.

D. S. Neblock, J. Krieger, D. Fearon, 1993, The Journal of infectious diseases.

Pathways of memory CD8+ T‐cell development

D. Fearon, Oliver Bannard, Matthew Kraman, 2009, European journal of immunology.

Tyrosine phosphorylation of phospholipase C induced by membrane immunoglobulin in B lymphocytes.

D. Fearon, R. Carter, S. Rhee, 1991, Proceedings of the National Academy of Sciences of the United States of America.

The CD19 complex of B lymphocytes. Activation of phospholipase C by a protein tyrosine kinase-dependent pathway that can be enhanced by the membrane IgM complex.

D. Tuveson, D. Fearon, R. Carter, 1991, Journal of immunology.

Recombinant soluble CR1 suppressed complement activation, inflammation, and necrosis associated with reperfusion of ischemic myocardium.

G. R. Carson, M. Weisfeldt, H. Weisman, 1990, Transactions of the Association of American Physicians.

CHAPTER 12 – Regulation of Antigen Receptor Signaling by the Co-Receptors, CD19 and CD22

D. Fearon, L. Nitschke, 2003 .

Co-receptors of B lymphocytes.

D. Fearon, R. Tooze, L. O'Rourke, 1997, Current opinion in immunology.

Mediating B Lymphocyte Activation by the CR2/CD19 Complex

D. Fearon, R. Carter, 1993 .

Selective synthesis of mRNA and proteins by human peripheral blood neutrophils.

D. Fearon, R. Jack, 1988, Journal of immunology.

Generation of C3a anaphylatoxin from human C3 by human mast cell tryptase.

D. Fearon, K. Austen, L. Schwartz, 1983, Journal of immunology.

Autoantibody to the C3b/C4b receptor and absence of this receptor from erythrocytes of a patient with systemic lupus erythematosus.

P. Schur, D. Fearon, W. Wong, 1985, The Journal of clinical investigation.

CD19 as a membrane-anchored adaptor protein of B lymphocytes: costimulation of lipid and protein kinases by recruitment of Vav.

D. Fearon, R. Carter, V. Tybulewicz, 1998, Immunity.

Identifying genes important for spermatogonial stem cell self-renewal and survival.

D. Fearon, R. Brinster, J. Oatley, 2006, Proceedings of the National Academy of Sciences of the United States of America.

Embryonic FAP+ lymphoid tissue organizer cells generate the reticular network of adult lymph nodes

D. Fearon, E. J. Carr, A. Denton, 2019, The Journal of experimental medicine.

The human C3b receptor

D. Fearon, 2004, Springer Seminars in Immunopathology.

Tissue-specific phosphorylation of complement receptors CR1 and CR2

D. Fearon, P. Changelian, Ann Douglas, 1986, The Journal of experimental medicine.

Activation of the alternative complement pathway.

D. Fearon, 1979, CRC Critical reviews in immunology.

Decreased expression of the C3b/C4b receptor (CR1) and the C3d receptor (CR2) on B lymphocytes and of CR1 on neutrophils of patients with systemic lupus erythematosus.

P. Schur, D. Fearon, J. Wilson, 1986, Arthritis and rheumatism.

Altered expression of complement receptors as a pathogenetic factor in systemic lupus erythematosus.

D. Fearon, J. Wilson, J. G. Wilson, 1984, Arthritis and rheumatism.

Decreased expression of C3b receptor (CR1) on erythrocytes of patients with systemic lupus erythematosus contrasts with its normal expression in other systemic diseases and does not correlate with the occurrence or severity of SLE nephritis.

M. Kazatchkine, D. Fearon, P. Bourgeois, 1986, Complement.

PMA induces the ligand-independent internalization of CR1 on human neutrophils.

D. Fearon, P. Changelian, R. Jack, 1985, Journal of immunology.

Increased expression of the C3b receptor by neutrophils and complement activation during haemodialysis.

D. Fearon, R. Hakim, J. Lee, 1984, Clinical and experimental immunology.

Opsonin-independent phagocytosis of activators of the alternative complement pathway by human monocytes.

D. Fearon, K. Austen, J. Czop, 1978, Journal of immunology.

Structure of the human CR1 gene. Molecular basis of the structural and quantitative polymorphisms and identification of a new CR1-like allele

D. Fearon, E. Bonaccio, L. Klickstein, 1989, The Journal of experimental medicine.

STRUCTURE OF THE HUMAN CRl GENE

James G. Wilson, D. Fearon, E. Bonaccio, 1989 .

STRUCTURE OF THE HUMAN CRl GENE Molecular Basis of the Structural and Quantitative Polymorphisms and Identification of a New CRl-like Allele

James G. Wilson, D. Fearon, E. Bonaccio, 1989 .

DimerX Peptide Presentation Technology (continued from cover)

D. Fearon, B. Čatipović, U. Gether, 2001 .

Identification of a partial cDNA clone for the C3d/Epstein-Barr virus receptor of human B lymphocytes: homology with the receptor for fragments C3b and C4b of the third and fourth components of complement.

D. Fearon, J. Smith, L. Klickstein, 1986, Proceedings of the National Academy of Sciences of the United States of America.

A molecular basis of activation of the alternative pathway of human complement.

D. Fearon, K. Austen, 1979, Advances in experimental medicine and biology.

Membrane sialic acid on target particles modulates their phagocytosis by a trypsin-sensitive mechanism on human monocytes.

D. Fearon, K. Austen, J. Czop, 1978, Proceedings of the National Academy of Sciences of the United States of America.

Suppression of the immune response by a soluble complement receptor of B lymphocytes.

D. Fearon, J. Ahearn, T. Hebell, 1991, Science.

Regulation by Complement of Acquired Immunity

D. Fearon, M. Carroll, 1998 .

Structural determinants of the capacity of heparin to inhibit the formation of the human amplification C3 convertase.

M. Kazatchkine, D. Fearon, K. Austen, 1981, The Journal of clinical investigation.

Complement ligand-receptor interactions that mediate biological responses.

D. Fearon, W. Wong, 1983, Annual review of immunology.

CD28-mediated costimulation in the absence of phosphatidylinositol 3-kinase association and activation

D. Fearon, A. Weiss, D. Littman, 1995, Molecular and cellular biology.

Membrane IgM-induced tyrosine phosphorylation of CD19 requires a CD19 domain that mediates association with components of the B cell antigen receptor complex.

D. Fearon, R. Carter, J. Bolen, 1997, Journal of immunology.

GCACCCGGGGTCCTCGGGATTTCTTGTGACCCTCCTC GCACCCGGGGTCCTCGGGAT AATAAAACCATTTCTTGCTCAGATCCCATAGTACCAGG TCTAGAACTAGTGGATCCCC AGACATGGTGATTCTGTG GCTCCTCCTATATGTGAATATTTCAATAAA TGGGATAAACCTGCTCCTATATGTGAATCTGTGAATAAAACCATTTCTTGCTCA GATCCCATAGTACCAGGAGGA AATAAATATTCTTCTTGCTCAGATCCCATA TGGGATAAAGCTCCTCCTAAATG

A. Yuryev, D. Fearon, J. Ahearn, 2003 .

Determination of the structural basis for selective binding of Epstein- Barr virus to human complement receptor type 2

A. Yuryev, D. Fearon, J. Ahearn, 1991, The Journal of experimental medicine.

CR1 and CR2: Receptors Mediating Cellular Recognition in the Complement System

D. Fearon, R. Carter, J. Ahearn, 1990 .

Combination immunotherapy for cancer

D. Fearon, 2016, The Journal of experimental medicine.

Transplanted hepatocytes infected with a complement receptor type 1 (CR1)-containing recombinant adenovirus are resistant to hyperacute rejection.

D. Fearon, N. Kobayashi, F. Graham, 1998, Transplantation proceedings.

Endocytosis of the C3b receptor of complement within coated pits in human polymorphonuclear leukocytes and monocytes.

D. Fearon, D. Abrahamson, 1983, Laboratory investigation; a journal of technical methods and pathology.

The Human C 3 b Receptor *

D. Fearon, 2022 .

Innate pathways that control acquired immunity.

D. Fearon, A. Bendelac, 1997, Current opinion in immunology.

Human complement receptors for C3b (CR1) and C3d (CR2).

D. Fearon, 1985, The Journal of investigative dermatology.

Demonstration of Receptor Function of Membrane Proteins by Selection and Immobilization with Monoclonal Antibodies

D. Fearon, J. Weis, 1985 .

Rapid purification of the human C3b/C4b receptor (CR1) by monoclonal antibody affinity chromatography.

D. Fearon, J. Smith, W. Wong, 1985, Journal of immunological methods.

Cellular receptors for fragments of the third component of complement.

D. Fearon, 1984, Immunology today.

Immunohistochemical study of the human glomerular C3b receptor in normal kidney and in renal diseases: Loss of C3b receptor antigen in proliferate nephritis of sle

M. Kazatchkine, D. Fearon, M. Appay, 1982 .

T-bet-mediated differentiation of the activated CD8+ T cell

D. Fearon, C. J. Yeo, 2010, European journal of immunology.

Cellular distribution of complement receptor type 4 (CR4): expression on human platelets.

D. Fearon, D. Vik, 1987, Journal of immunology.

The identification of N-linked oligosaccharides on the human CR2/Epstein-Barr virus receptor and their function in receptor metabolism, plasma membrane expression, and ligand binding.

D. Fearon, J. Weis, 1985, The Journal of biological chemistry.

Measurement by Flow Cytometry of Intracellular Free Ca2+ Concentration and Complement Receptor Expression in Activated Neutrophils and Monocytes

D. Fearon, P. Späth, M. Spycher, 1989 .

The C3d Receptor Identified by the HB-5 Monoclonal Antibody: Expression and Role as a Receptor for Epstein-Barr Virus

D. Fearon, M. Cooper, T. Tedder, 1986 .

Immunofibroblasts are pivotal drivers of tertiary lymphoid structure formation and local pathology

K. Tarte, D. Fearon, A. Filer, 2019, Proceedings of the National Academy of Sciences.

Mapping of the C3b-binding site of CR1 and construction of a (CR1)2- F(ab')2 chimeric complement inhibitor

D. Fearon, J. Ahearn, K. Kalli, 1991, The Journal of experimental medicine.

Identification of a 145,000 Mr membrane protein as the C3d receptor (CR2) of human B lymphocytes.

D. Fearon, T. Tedder, J. Weis, 1984, Proceedings of the National Academy of Sciences of the United States of America.

Distinct populations of inflammatory fibroblasts and myofibroblasts in pancreatic cancer

Hans Clevers, Mikala Egeblad, Christine Feig, 2017, The Journal of experimental medicine.

The role of receptors for complement in the induction of polyclonal B-cell proliferation and differentiation

D. Fearon, M. Cooper, T. Tedder, 2004, Journal of Clinical Immunology.

AMD3100/Plerixafor overcomes immune inhibition by the CXCL12–KRT19 coating on pancreatic and colorectal cancer cells

D. Fearon, T. Janowitz, 2021, British Journal of Cancer.

Function during a Persistent Viral Infection Clones and the Maintenance of Replicative T Cell + Cutting Edge: Virus-Specific CD8

D. Fearon, Oliver Bannard, Matthew Kraman, 2017 .

Cutting Edge: Virus-Specific CD8+ T Cell Clones and the Maintenance of Replicative Function during a Persistent Viral Infection

D. Fearon, Oliver Bannard, Matthew Kraman, 2010, The Journal of Immunology.

Action of the C3b-inactivator on the cell-bound C3b.

D. Fearon, R. Levine, S. Law, 1979, Journal of immunology.

The signaling activity of murine CD19 is regulated during cell development.

A. Shaffer, D. Fearon, M. Schlissel, 1996, Journal of immunology.

p65: A C3b-binding protein on murine cells that shares antigenic determinants with the human C3b receptor (CR1) and is distinct from murine C3b receptor.

D. Fearon, W. Wong, 1985, Journal of immunology.

Molecular interactions of complement receptors on B lymphocytes: a CR1/CR2 complex distinct from the CR2/CD19 complex

D. Tuveson, D. Fearon, J. Ahearn, 1991, The Journal of experimental medicine.

Seeking wisdom in innate immunity

D. Fearon, 1997, Nature.

The modulation of the alternative pathway of complement in C2-deficient human serum by changes in concentration of the component and control proteins.

D. Fearon, K. Austen, U. Nydegger, 1978, Journal of immunology.

Pathways of complement activation in membranoproliferative glomerulonephritis and allograft rejection.

J. Weiler, D. Fearon, T. Strom, 1977, Transplantation proceedings.

Differential interaction of the C3b/C4b receptor and MHC class I with the cytoskeleton of human neutrophils.

R. Ezzell, J. Hartwig, D. Fearon, 1986, Journal of immunology.

A framework for advancing our understanding of cancer-associated fibroblasts

Thea D. Tlsty, Erik Sahai, Rakesh K. Jain, 2020, Nature Reviews Cancer.

Non-structural determinants of immunogenicity and the B cell co-receptors, CD19, CD21, and CD22.

D. Fearon, 1998, Advances in experimental medicine and biology.

Connecting the Metabolic and Immune Responses to Cancer.

D. Fearon, T. Janowitz, T. R. Flint, 2017, Trends in molecular medicine.

Increased expression of C3b receptors on polymorphonuclear leukocytes induced by chemotactic factors and by purification procedures.

D. Fearon, L. A. Collins, 1983, Journal of immunology.

Hereditary angioedema: a decade of management with stanozolol.

A. Sheffer, D. Fearon, K. Austen, 1987, The Journal of allergy and clinical immunology.

Tranexamic acid: preoperative prophylactic therapy for patients with hereditary angioneurotic edema.

A. Sheffer, D. Fearon, F. Rosen, 1977, The Journal of allergy and clinical immunology.

Surface-associated heparin inhibits zymosan-induced activation of the human alternative complement pathway by augmenting the regulatory action of the control proteins on particle-bound C3b

M. Kazatchkine, D. Fearon, K. Austen, 1979, The Journal of experimental medicine.

Methyltestosterone therapy in hereditary angioedema.

A. Sheffer, D. Fearon, K. Austen, 1977, Annals of internal medicine.

Activation of the properdin pathway of complement in patients with gram-negative of bacteremia.

P. Schur, D. Fearon, S. Ruddy, 1975, The New England journal of medicine.

INHIBITION OF COMPLEMENT‐DERIVED ENZYMES *

D. Fearon, K. Austen, 1975, Annals of the New York Academy of Sciences.

ANTI‐INFLAMMATORY AND IMMUNOSUPPRESSIVE EFFECTS OF RECOMBINANT SOLUBLE COMPLEMENT RECEPTORS

D. Fearon, 1991, Clinical and experimental immunology.

Soluble human complement receptor type 1: in vivo inhibitor of complement suppressing post-ischemic myocardial inflammation and necrosis.

G. R. Carson, M. Weisfeldt, H. Weisman, 1990, Science.

Modulation of the formation of the amplification convertase of complement, C3b, Bb, by native and commercial heparin

J. Weiler, D. Fearon, K. Austen, 1978, The Journal of experimental medicine.

Regulation of expression and cell surface motility of the C3b receptor on neutrophils and monocytes

D. Fearon, R. Jack, 1985 .

Clinical and biochemical effects of impeded androgen (oxymetholone) therapy of hereditary angioedema.

A. Sheffer, D. Fearon, K. Austen, 1979, The Journal of allergy and clinical immunology.

CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes.

D. Fearon, R. Carter, 1992, Science.

Autophagy promotes immune evasion of pancreatic cancer by degrading MHC-I

J. Debnath, J. Paulo, J. Mancias, 2020, Nature.

Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2.

P. A. Biro, J. Strominger, D. Fearon, 1984, Proceedings of the National Academy of Sciences of the United States of America.

Tumor-Induced IL-6 Reprograms Host Metabolism to Suppress Anti-tumor Immunity

D. Fearon, D. Jodrell, A. Coll, 2016, Cell metabolism.

Isolation of a human erythrocyte membrane glycoprotein with decay-accelerating activity for C3 convertases of the complement system.

D. Fearon, K. Austen, P. Weller, 1982, Journal of immunology.

A framework for advancing our understanding of cancer-associated fibroblasts

R. Jain, A. Weeraratna, D. Tuveson, 2020, Nature Reviews Cancer.

Complement receptor type 1 (C3b/C4b receptor; CD35) and complement receptor type 2 (C3d/Epstein-Barr virus receptor; CD21).

D. Fearon, J. Ahearn, 1990, Current topics in microbiology and immunology.

Tumoral Immune Suppression by Macrophages Expressing Fibroblast Activation Protein-α and Heme Oxygenase-1

D. Fearon, J. N. Arnold, Matthew Kraman, 2013, Cancer Immunology Research.

Targeting CXCL12 from FAP-expressing carcinoma-associated fibroblasts synergizes with anti–PD-L1 immunotherapy in pancreatic cancer

Derek S. Chan, James O. Jones, S. Teichmann, 2013, Proceedings of the National Academy of Sciences.

Suppression of Antitumor Immunity by Stromal Cells Expressing

James O. Jones, D. Tuveson, D. Fearon, 2022 .

Expression of C3b receptors on human be cells and myelomonocytic cells but not natural killer cells.

D. Fearon, M. Cooper, T. Tedder, 1983, Journal of immunology.

Stromal Cells in the Tumor Microenvironment.

D. Fearon, Edward W. Roberts, A. Denton, 2018, Advances in experimental medicine and biology.

CXCR4 inhibition in human pancreatic and colorectal cancers induces an integrated immune response

N. Rosenfeld, F. Gallagher, E. Godfrey, 2020, Proceedings of the National Academy of Sciences.

The Carcinoma-Associated Fibroblast Expressing Fibroblast Activation Protein and Escape from Immune Surveillance

D. Fearon, 2014, Cancer Immunology Research.

Identification of unique neoantigen qualities in long-term survivors of pancreatic cancer

Mithat Gönen, Katherine M. Tucker, Jedd D. Wolchok, 2017, Nature.

Activation of the alternative complement pathway due to resistance of zymosan-bound amplification convertase to endogenous regulatory mechanisms.

D. Fearon, K. Austen, 1977, Proceedings of the National Academy of Sciences of the United States of America.

Epstein-Barr virus (EBV) infection of murine L cells expressing recombinant human EBV/C3d receptor.

D. Fearon, J. Ahearn, S. Hayward, 1988, Proceedings of the National Academy of Sciences of the United States of America.

Neutrophil extracellular traps produced during inflammation awaken dormant cancer cells in mice

Michael S. Goldberg, P. Gimotty, S. Lyons, 2018, Science.

Akt inhibition enhances expansion of potent tumor-specific lymphocytes with memory cell characteristics.

Mark S. Sundrud, F. Marincola, S. Rosenberg, 2015, Cancer research.

Fenofibrate prevents skeletal muscle loss in mice with lung cancer

L. Cantley, D. Fearon, B. Hopkins, 2018, Proceedings of the National Academy of Sciences.

Interaction of iC3b with recombinant isotypic and chimeric forms of CR2.

D. Fearon, J. Ahearn, K. Kalli, 1991, Journal of immunology.

Identification of distinct C3b and C4b recognition sites in the human C3b/C4b receptor (CR1, CD35) by deletion mutagenesis

D. Fearon, J. Smith, L. Klickstein, 1988, The Journal of experimental medicine.

Identification of a partial cDNA clone for the human receptor for complement fragments C3b/C4b.

D. Fearon, J. Smith, L. Klickstein, 1985, Proceedings of the National Academy of Sciences of the United States of America.

Regulation of the amplification C3 convertase of human complement by an inhibitory protein isolated from human erythrocyte membrane.

D. Fearon, D T Fearon, 1979, Proceedings of the National Academy of Sciences of the United States of America.

Arrested Differentiation, the Self-Renewing Memory Lymphocyte, and Vaccination

D. Fearon, S. Wagner, P. Manders, 2001, Science.

A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP.

D. Fearon, M. Thomas, J. Lin, 1995, Science.

Distinct fibroblast subsets drive inflammation and damage in arthritis

S. Raychaudhuri, H. Perlman, D. Fearon, 2019, Nature.

The CD19-CR2-TAPA-1 complex, CD45 and signaling by the antigen receptor of B lymphocytes.

D. Fearon, 1993, Current opinion in immunology.

CD19 of B cells as a surrogate kinase insert region to bind phosphatidylinositol 3-kinase.

D. Tuveson, D. Fearon, R. Carter, 1993, Science.

Human C3b/C4b Receptor (Cr1): Isolation, Protein Sequence Analysis, and Cloning of a Partial cDNA from Human Tonsil

D. Fearon, L. Klickstein, J. Weis, 1987 .

IgG on mouse erythrocytes augments activation of the human alternative complement pathway by enhancing deposition of C3b.

D. Fearon, K. Austen, F. Moore, 1981, Journal of immunology.

De-Risking Immunotherapy: Report of a Consensus Workshop of the Cancer Immunotherapy Consortium of the Cancer Research Institute

Vanessa M. Hubbard-Lucey, S. H. van der Burg, E. Wherry, 2016, Cancer Immunology Research.

32nd Annual Meeting and Pre-Conference Programs of the Society for Immunotherapy of Cancer (SITC 2017): Part One

Daniel K. Wells, C. Iacobuzio-Donahue, A. Levine, 2017, Journal of Immunotherapy for Cancer.

Explaining the Paucity of Intratumoral T Cells: A Construction Out of Known Entities.

D. Fearon, 2016, Cold Spring Harbor symposia on quantitative biology.

Epstein-barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis

E. Kieff, D. Fearon, J. Weis, 1987, Cell.

Counterregulation by the coreceptors CD19 and CD22 of MAP kinase activation by membrane immunoglobulin.

D. Fearon, R. Tooze, G. Doody, 1997, Immunity.

Functional dissection of the CD21/CD19/TAPA-1/Leu-13 complex of B lymphocytes

D. Fearon, R. Carter, J. Ahearn, 1993, The Journal of experimental medicine.

Loss of T cell receptor-induced Bmi-1 in the KLRG1+ senescent CD8+ T lymphocyte

D. Fearon, M. Heffner, 2007, Proceedings of the National Academy of Sciences.

Disruption of Anti-tumor T Cell Responses by Cancer-Associated Fibroblasts

D. Fearon, Arnaud Pommier, 2016 .

Biocompatibility of dialysis membranes: effects of chronic complement activation.

D. Fearon, R. Hakim, J. Lazarus, 1984, Kidney international.

The CD19/CR2/TAPA-1 complex of B lymphocytes: linking natural to acquired immunity.

D. Fearon, R. Carter, D T Fearon, 1995, Annual review of immunology.

Therapeutic uses of recombinant complement protein inhibitors

D. Fearon, K. Kalli, P. Hsu, 2005, Springer Seminars in Immunopathology.

Neutrophil activation in thermal injury as assessed by increased expression of complement receptors.

D. Fearon, J. Mannick, M. Rodrick, 1986, The New England journal of medicine.

C3 requirements for formation of alternative pathway C5 convertase.

D. Fearon, K. Austen, M. Daha, 1976, Journal of immunology.

C3 nephritic factor (C3NeF): stabilization of fluid phase and cell-bound alternative pathway convertase.

D. Fearon, K. Austen, M. Daha, 1976, Journal of immunology.

Intersection of the complement and immune systems: a signal transduction complex of the B lymphocyte-containing complement receptor type 2 and CD19

D. Tuveson, D. Fearon, R. Carter, 1991, The Journal of experimental medicine.

Tyrosine phosphorylation ofphospholipase C induced bymembrane immunoglobulin inB lymphocytes

D. Fearon, R. Carter, 1991 .

The expansion and maintenance of antigen-selected CD8(+) T cell clones.

D. Fearon, 2007, Advances in immunology.

Antibody restores human alternative complement pathway activation by mouse erythrocytes rendered functionally deficient by pretreatment with pronase.

D. Fearon, K. Austen, F. Moore, 1982, Journal of immunology.

Properdin: binding to C3b and stabilization of the C3b-dependent C3 convertase

D. Fearon, K. Austen, Douglas T Fearonf, 1975, The Journal of experimental medicine.

FORMATION OF A HEMOLYTICALLY ACTIVE CELLULAR INTERMEDIATE BY THE INTERACTION BETWEEN PROPERDIN FACTORS B AND D AND THE ACTIVATED THIRD COMPONENT OF COMPLEMENT

D. Fearon, S. Ruddy, K. Austen, 1973, The Journal of experimental medicine.

Polymeric C3dg primes human B lymphocytes for proliferation induced by anti-IgM.

D. Fearon, R. Carter, 1989, Journal of immunology.

Synergistic interaction between complement receptor type 2 and membrane IgM on B lymphocytes.

D. Fearon, R. Carter, M. Spycher, 1988, Journal of immunology.

C3d of Complement as a Molecular Adjuvant: Bridging Innate and Acquired Immunity

Christopher C. Goodnow, D. Fearon, C. Goodnow, 1996, Science.

Clinical and biochemical effects of stanozolol therapy for hereditary angioedema.

A. Sheffer, D. Fearon, K. Austen, 1981, The Journal of allergy and clinical immunology.

Acquired deficiency of the inhibitor of the first component of complement: report of five additional cases with commentary on the syndrome.

A. Sheffer, D. Fearon, F. Rosen, 1985, The Journal of allergy and clinical immunology.

PROPERDIN FACTOR D: CHARACTERIZATION OF ITS ACTIVE SITE AND ISOLATION OF THE PRECURSOR FORM

D. Fearon, S. Ruddy, K. Austen, 1974, The Journal of experimental medicine.

The Natural Modulation of the Amplification Phase of Complement Activation

J. Weiler, D. Fearon, K. Austen, 1976, Transplantation reviews.

73 Clinical/biochemical assessment of acquired CTINH deficiency

A. Sheffer, D. Fearon, K. Austen, 1983 .

Mapping of the Epstein-Barr virus and C3dg binding sites to a common domain on complement receptor type 2

D. Fearon, R. Carter, J. Ahearn, 1989, The Journal of experimental medicine.

Structure and function of the complement receptors, CR1 (CD35) and CR2 (CD21).

D. Fearon, J. Ahearn, Joseph M. Ahearn, 1989, Advances in immunology.

Human C3b/C4b receptor (CR1). Demonstration of long homologous repeating domains that are composed of the short consensus repeats characteristics of C3/C4 binding proteins

D. Fearon, J. Smith, L. Klickstein, 1987, The Journal of experimental medicine.

Characterization of human T lymphocytes that express the C3b receptor.

D. Fearon, T. Tedder, J. Wilson, 1983, Journal of immunology.

Properdin: initiation of alternative complement pathway.

D. Fearon, K. Austen, 1975, Proceedings of the National Academy of Sciences of the United States of America.

Organization of the genes encoding complement receptors type 1 and 2, decay-accelerating factor, and C4-binding protein in the RCA locus on human chromosome 1

D. Fearon, J. Smith, M. Carroll, 1988, The Journal of experimental medicine.

Normal function of CR1 on affected erythrocytes of patients with paroxysmal nocturnal hemoglobinuria.

D. Fearon, K. Austen, A. Nicholson-Weller, 1985, Journal of immunology.

Genetic regulation of a structural polymorphism of human C3b receptor.

D. Fearon, W. Wong, J. Wilson, 1983, The Journal of clinical investigation.

Inhibition of the alternative pathway of complement by gold sodium thiomalate in vitro.

D. Fearon, K. Austen, J. Burge, 1978, Journal of immunology.

Current concepts in immunology: the alternative pathway of complement--a system for host resistance to microbial infection.

D. Fearon, K. Austen, 1980, The New England journal of medicine.

Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex.

D. Fearon, M. Carroll, M. Carroll, 2000, Annual review of immunology.

Structure of the human B lymphocyte receptor for C3d and the Epstein- Barr virus and relatedness to other members of the family of C3/C4 binding proteins [published erratum appears in J Exp Med 1988 Nov 1;168(5):1953-4]

D. Fearon, J. Smith, J. Weis, 1988, The Journal of experimental medicine.

Identification of a 145 , 000 Mr membrane protein as the C 3 d receptor ( CR 2 ) of human

D. Fearon, J. Weis, B. Iymphocytes, 2022 .

Analysis of multiple restriction fragment length polymorphisms of the gene for the human complement receptor type I. Duplication of genomic sequences occurs in association with a high molecular mass receptor allotype

D. Fearon, E. Bonaccio, L. Klickstein, 1986, The Journal of experimental medicine.

Mode of inheritance of decreased C3b receptors on erythrocytes of patients with systemic lupus erythematosus.

P. Schur, D. Fearon, W. Wong, 1982, The New England journal of medicine.

Cancer cell CCR2 orchestrates suppression of the adaptive immune response

D. Fearon, L. Van Aelst, J. Wilkinson, 2018, bioRxiv.

Neutrophils express a receptor for iC3b, C3dg, and C3d that is distinct from CR1, CR2, and CR3.

D. Fearon, D. Vik, 1985, Journal of immunology.

Complement, C receptors, and immune complex disease.

D. Fearon, 1988, Hospital practice.

Deficiency of the C3b/C4b receptor (CR1) of erythrocytes in systemic lupus erythematosus: analysis of the stability of the defect and of a restriction fragment length polymorphism of the CR1 gene.

P. Schur, D. Fearon, W. Wong, 1987, Journal of immunology.

CD27 mediates interleukin-2-independent clonal expansion of the CD8+ T cell without effector differentiation

D. Fearon, A. Edwards, A. Al-Shamkhani, 2006, Proceedings of the National Academy of Sciences.

Blockade of CTLA-4 promotes the development of effector CD8+ T lymphocytes and the therapeutic effect of vaccination with an attenuated protozoan expressing NY-ESO-1

D. Fearon, R. Gazzinelli, S. Teixeira, 2015, Cancer Immunology and Immunotherapy.

The precursors of memory: models and controversies

Michael J. Bevan, R. Ahmed, M. Bevan, 2009, Nature Reviews Immunology.

Membrane distribution and adsorptive endocytosis by C3b receptors on human polymorphonuclear leukocytes

D. Fearon, I. Kaneko, G. G. Thomson, 1981, The Journal of experimental medicine.

Characterization of a soluble form of the C3b/C4b receptor (CR1) in human plasma.

D. Fearon, S. Yoon, 1985, Journal of immunology.

Cell and Molecular Biology of Human Complement Receptors

D. Fearon, 1986 .

Lateral distribution and diffusion of the C3b receptor of complement, HLA antigens, and lipid probes in peripheral blood leukocytes.

H. Petty, D. Fearon, L. M. Smith, 1980, Proceedings of the National Academy of Sciences of the United States of America.

Heterogeneity, polypeptide chain composition and antigenic reactivity of C3 nephritic factor.

D. Fearon, K. Austen, M. Daha, 1978, Journal of immunology.

Initiation of C3 cleavage in the alternative complement pathway.

D. Fearon, K. Austen, 1975, Journal of immunology.

Expression of complement receptor type one (for C3b) on human natural killer cells, B cells and lymphoblastoid cell lines

D. Fearon, M. Cooper, T. Tedder, 1982 .

Lipid monolayer-coated solid surfaces do not perturb the lateral motion and distribution of C3b receptors on neutrophils

Lloyd M. Smith, D. Fearon, D. Hafeman, 1982, The Journal of cell biology.

Lipid monolayer-coated solid surfaces do not perturb the lateral motion and distribution of C3b receptors on neutrophils

D. Fearon, L. M. Smith, H. Mcconnell, 1982, The Journal of cell biology.

Activation of the Hippo pathway by CTLA-4 regulates the expression of Blimp-1 in the CD8+ T cell

D. Fearon, M. de la Roche, M. Brunner‐Weinzierl, 2012, Proceedings of the National Academy of Sciences.

Priority Brief Tumoral Immune Suppression by Macrophages Expressing Fibroblast Activation Protein-a and Heme Oxygenase-1

D. Fearon, J. N. Arnold, Matthew Kraman, 2014 .

Cancer immunotherapy trial registrations increase exponentially but chronic immunosuppressive glucocorticoid therapy may compromise outcomes

D. Fearon, D. Jodrell, T. Janowitz, 2017, Annals of oncology : official journal of the European Society for Medical Oncology.

Tumor Immunology

G. Dranoff, D. Fearon, A. Bondanza, 2016, Methods in Molecular Biology.

A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr virus receptor map to 1q32.

C. Morton, G. Bruns, D. Fearon, 1987, Journal of immunology.

The proto-oncogene BCL-6 is expressed in olfactory sensory neurons

D. Fearon, Haruhiko Yamamoto, J. M. Otaki, 2005, Neuroscience Research.

Enhanced immunogenicity of aldehyde‐bearing antigens: a possible link between innate and adaptive immunity

M. Allison, D. Fearon, 2000, European journal of immunology.

Expansion of the complement receptor gene family. Identification in the mouse of two new genes related to the CR1 and CR2 gene family.

D. Fearon, L. Klickstein, J. Weis, 1987, Journal of immunology.

Activation of B lymphocytes: integrating signals from CD19, CD22 and FcγRIIb1

D. Fearon, P. Dempsey, G. Doody, 1996 .

Activation of B lymphocytes: integrating signals from CD19, CD22 and Fc gamma RIIb1.

D. Fearon, P. Dempsey, G. Doody, 1996, Current opinion in immunology.

Isolation of alternative pathway C3 convertase containing uncleaved B and formed in the presence of C3 nephritic factor (C3neF).

D. Fearon, K. Austen, M. Daha, 1976, Journal of immunology.

The role of antibody in the activation of the alternative complement pathway

D. Fearon, K. Austen, W. D. Ratnoff, 2005, Springer Seminars in Immunopathology.

Properdin factor D. II. Activation to D by properdin.

D. Fearon, S. Ruddy, K. Austen, 1974 .

Downregulated Expression of SHP-1 in Burkitt Lymphomas and Germinal Center B Lymphocytes

D. Fearon, M. Rowe, Martin Rowe, 1997, The Journal of experimental medicine.

Innate immunity—beginning to fulfill its promise?

D. Fearon, 2000, Nature Immunology.

Serum proteins involved in decay and regeneration of cobra venom factor-dependent complement activation.

D. Fearon, S. Ruddy, K. Austen, 1973, Journal of immunology.

Inhibition of the alternative pathway of human complement in vitro by a natural microbial product, complestatin.

D. Fearon, K. Austen, I. Kaneko, 1980, Journal of immunology.

Prolongation of guinea pig cardiac xenograft survival in rats by soluble human complement receptor type 1.

D. Fearon, R. Kirkman, F. J. Schoen, 1992, Transplantation proceedings.

Innate immunity Innate pathways that control acquired immunity

D. Fearon, A. Bendelac, 1997 .

Regulation of the amplification C 3 convertase of human complement by an inhibitory protein isolated from human erythrocyte membrane ( alternative complement pathway / jBlH / CAb inactivator / properdin )

D. Fearon, 2022 .

Depressed synovial fluid levels of properdin and properdin factor B in patients with rheumatoid arthritis.

D. Fearon, S. Ruddy, K. Austen, 1975, Arthritis and rheumatism.

Effect of repetitive doses of soluble human complement receptor type 1 on survival of discordant cardiac xenografts.

D. Fearon, R. Kirkman, W. Xia, 1993, Transplantation Proceedings.

Complement as a Mediator of Inflammation

D. Fearon, DOUGLAS T. FEARON, 1981, Clinics in Immunology and Allergy.

Binding of C3b and C4b by the CR1-like site in murine CR1.

D. Fearon, K. Kalli, 1994, Journal of immunology.

Maintenance of T Cell Function in the Face of Chronic Antigen Stimulation and Repeated Reactivation for a Latent Virus Infection

Scott N. Mueller, D. Fearon, L. Wakim, 2012, The Journal of Immunology.

The gene encoding hematopoietic cell phosphatase (SHP-1) is structurally and transcriptionally intact in polycythemia vera

B. Göttgens, A. Green, D. Fearon, 1997, Oncogene.

Altered surface distribution of both C3b receptors and Fc receptors on neutrophils induced by anti-C3b receptor or aggregated IgG.

D. Fearon, R. Jack, 1984, Journal of immunology.

CONSTITUENTS OF CELL SURFACES THAT REGULATE ACTIVATION OF THE HUMAN ALTERNATIVE COMPLEMENT PATHWAY

D. Fearon, 1982 .

Innate immunity: 50 ways to kill a microbe.

D. Fearon, J. Atkinson, E. Brown, 1994, Current opinion in immunology.

Pathologically distinct fibroblast subsets drive inflammation and tissue damage in arthritis

S. Raychaudhuri, H. Perlman, D. Fearon, 2018, bioRxiv.

Reactivation for a Latent Virus InfectionRepeated of Chronic Antigen Stimulation and Maintenance of T Cell Function in the Face

Scott N. Mueller, D. Fearon, L. Wakim, 2012 .

Pillars Article: CD19: Lowering the threshold for antigen receptor stimulation of B lymphocytes. Science, 1992. 256: 105-107.

D. Fearon, R. Carter, 2010, Journal of immunology.

Purification of the B lymphocyte receptor for the C3d fragment of complement and the Epstein-Barr virus by monoclonal antibody affinity chromatography, and assessment of its functional capacities.

D. Fearon, J. Smith, J. Weis, 1986, Journal of immunological methods.

Immunohistochemical study of the human glomerular C3b receptor in normal kidney and in seventy-five cases of renal diseases: loss of C3b receptor antigen in focal hyalinosis and in proliferative nephritis of systemic lupus erythematosus.

M. Kazatchkine, D. Fearon, M. Appay, 1982, The Journal of clinical investigation.

Deficiencies of human C3 complement receptors type 1 (CR1, CD35) and type 2 (CR2, CD21).

M. Kazatchkine, D. Fearon, 1990, Immunodeficiency reviews.

Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk

D. Fearon, S. Rodríguez de Córdoba, M. Heurich, 2011, Proceedings of the National Academy of Sciences.

Neutrophil activation after burn injury: contributions of the classic complement pathway and of endotoxin.

D. Fearon, J. Mannick, M. Rodrick, 1987, Surgery.

siRNA high‐throughput kinase library screen identifies protein kinase, DNA‐activated catalytic polypeptide to play a role in MyD88‐induced IFNA2 activation and IL‐8 secretion

D. Fearon, A. Schoenemeyer, P. Morley, 2012, Biotechnology and applied biochemistry.

Innate immunity: Receptors and effectors of innate immunity: Editorial Overview

D. Fearon, A. Bendelac, 2000 .

Suppression of Antitumor Immunity by Stromal Cells Expressing Fibroblast Activation Protein–α

James O. Jones, D. Tuveson, D. Fearon, 2010, Science.

Current concepts in immunology: the alternative pathway of complement--a system for host resistance to microbial infection.

D. Fearon, K. Austen, 1980, New England Journal of Medicine.

The Carcinoma-Associated Fibroblast Expressing Fibroblast Activation Protein and Escape from Immune Surveillance

D. Fearon, 2014, Cancer Immunology Research.

Transcriptional regulation of effector and memory CD8+ T cell fates.

D. Fearon, L. Gattinoni, James E. D. Thaventhiran, 2013, Current opinion in immunology.

Fenofibrate prevents skeletal muscle loss in mice with lung cancer

L. Cantley, D. Fearon, B. Hopkins, 2018, Proceedings of the National Academy of Sciences.

Innate immunity and the biological relevance of the acquired immune response.

D. Fearon, 1999, QJM : monthly journal of the Association of Physicians.

Glomerulonephritis, Complement and C3NeF

D. Fearon, 1976 .

Inhibition of the function of activated properdin by squid chondroitin sulfate E glycosaminoglycan and murine bone marrow-derived mast cell chondroitin sulfate E proteoglycan.

D. Fearon, K. Austen, R. Stevens, 1984, Journal of immunology.

Pathways of memory CD8+ T‐cell development

D. Fearon, Oliver Bannard, Matthew Kraman, 2009, European journal of immunology.