N. Cohen

发表

Semiparametric Regression Splines in Matched Case‐Control Studies

R. Carroll, Inyoung Kim, N. Cohen, 2003, Biometrics.

Comparison of Microbiological, Histological, and Immunomodulatory Parameters in Response to Treatment with Either Combination Therapy with Prednisone and Metronidazole or Probiotic VSL#3 Strains in Dogs with Idiopathic Inflammatory Bowel Disease

G. Rossi, N. Cohen, J. Steiner, 2014, PloS one.

Risk factors for history of previous colic and for chronic, intermittent colic in a population of horses.

N. Cohen, J. Peloso, Noah D. Cohen, 1996, Journal of the American Veterinary Medical Association.

Comparison of Outcome After Use of Extra-Luminal Rings and Intra-Luminal Stents for Treatment of Tracheal Collapse in Dogs.

N. Cohen, Selena Tinga, K. T. Thieman Mankin, 2015, Veterinary surgery : VS.

Incidence of postoperative seizures with and without levetiracetam pretreatment in dogs undergoing portosystemic shunt attenuation.

N. Cohen, J. Thompson, J. Levine, 2011, Journal of veterinary internal medicine.

Risk factors associated with development of diarrhea in horses after celiotomy for colic: 190 cases (1990-1994).

N. Cohen, C. Honnas, 1996, Journal of the American Veterinary Medical Association.

Risk factors for enterolithiasis among horses in Texas.

N. Cohen, C. A. Vontur, P. Rakestraw, 2000, Journal of the American Veterinary Medical Association.

Association of perinatal exposure to airborne Rhodococcus equi with risk of pneumonia caused by R equi in foals.

N. Cohen, M. Chaffin, S. Takai, 2013, American journal of veterinary research.

Genomic and Functional Analyses of Rhodococcus equi Phages ReqiPepy6, ReqiPoco6, ReqiPine5, and ReqiDocB7

N. Cohen, R. Orchard, J. Gill, 2010, Applied and Environmental Microbiology.

The non-invasive exfoliated transcriptome (exfoliome) reflects the tissue-level transcriptome in a mouse model of NSAID enteropathy

N. Cohen, L. Davidson, I. Ivanov, 2017, Scientific Reports.

A Conserved Streptococcal Virulence Regulator Controls the Expression of a Distinct Class of M-Like Proteins

M. Waldor, N. Cohen, G. Pier, 2019, mBio.

Antibody-based vaccine for tuberculosis: validation in horse foals challenged with the TB-related pathogen Rhodococcus equi

N. Cohen, G. Pier, S. Giguère, 2018, bioRxiv.

Association of catastrophic biaxial fracture of the proximal sesamoid bones with bony changes of the metacarpophalangeal joint identified by standing magnetic resonance imaging in cadaveric forelimbs of Thoroughbred racehorses.

N. Cohen, J. Vogler, J. Peloso, 2015, Journal of the American Veterinary Medical Association.

Activation of foal neutrophils at different ages by CpG oligodeoxynucleotides and Rhodococcus equi.

N. Cohen, Tong‐Xian Liu, J. Nerren, 2009, Cytokine.

Thoracic and lumbar spinal cord diffusion tensor imaging in dogs

N. Cohen, J. Griffin, J. Levine, 2013, Journal of magnetic resonance imaging : JMRI.

Abomasal displacement and volvulus in beef cattle: 19 cases (1988-1998).

N. Cohen, A. Roussel, R. N. Hooper, 2000, Journal of the American Veterinary Medical Association.

The John Hickman Memorial Lecture: Colic by numbers

N. Cohen, N. D. Cohen, 2010 .

Are feeding practices associated with duodenitis-proximal jejunitis?

N. Cohen, A. Roussel, E. Toby, 2006, Equine veterinary journal.

Prevalence and factors associated with development of laminitis in horses with duodenitis/proximal jejunitis: 33 cases (1985-1991).

N. Cohen, Seahorn Tl, E. Parson, 1994, Journal of the American Veterinary Medical Association.

Effect of Trace Mineral Supplementation on Gastric Ulcers in Exercising Yearling Horses

N. Cohen, P. G. Gibbs, C. Larson, 2009 .

Antibody activities in hyperimmune plasma against the Rhodococcus equi virulence -associated protein A or poly-N-acetyl glucosamine are associated with protection of foals against rhodococcal pneumonia

N. Cohen, G. Pier, G. Blodgett, 2021, PloS one.

Serum Antibody Activity against Poly-N-Acetyl Glucosamine (PNAG), but Not PNAG Vaccination Status, Is Associated with Protecting Newborn Foals against Intrabronchial Infection with Rhodococcus equi

N. Cohen, G. Pier, C. Cywes-Bentley, 2021, Microbiology spectrum.

Antibody Activities in Hyperimmune Plasma Against the Rhodococcus equi Virulence-Associated Protein A or Poly-N-Acetyl Glucosamine are Associated with Protection of Foals Against Rhodococcal Pneumonia

N. Cohen, G. Pier, G. Blodgett, 2021, bioRxiv.

Prevalence of Rhodococcus equi from the nasal cavity of 1010 apparently healthy horses

N. Cohen, G. Machado, L. Corbellini, 2018, Equine veterinary journal.

Oral Administration of Electron-Beam Inactivated Rhodococcus equi Failed to Protect Foals against Intrabronchial Infection with Live, Virulent R. equi

S. Pillai, N. Cohen, R. Alaniz, 2016, PloS one.

Estimating the Sensitivity and Specificity of Real‐Time Quantitative PCR of Fecal Samples for Diagnosis of Rhodococcus equi Pneumonia in Foals

N. Cohen, M. Chaffin, M. Syndergaard, 2015, Journal of veterinary internal medicine.

Rhodococcus equi foal pneumonia.

N. Cohen, 2014, The Veterinary clinics of North America. Equine practice.

Transfer of the virulence-associated protein a-bearing plasmid between field strains of virulent and avirulent Rhodococcus equi.

N. Cohen, T. Poole, M. Liu, 2013, Journal of veterinary internal medicine.

N. Cohen, I. Ivanov, B. Chowdhary, 2013, PloS one.

Effects of location for collection of air samples on a farm and time of day of sample collection on airborne concentrations of virulent Rhodococcus equi at two horse breeding farms.

Naisyin Wang, N. Cohen, M. Chaffin, 2011, American journal of veterinary research.

Epidemiology of Rhodococcus equi foal pneumonia.

N. Cohen, W. Moyer, 2010 .

Evaluation of fecal samples from mares as a source of Rhodococcus equi for their foals by use of quantitative bacteriologic culture and colony immunoblot analyses.

N. Cohen, M. Libal, M. B. Grimm, 2007, American journal of veterinary research.

Farm characteristics and management practices associated with development of Rhodococcus equi pneumonia in foals.

N. Cohen, M. Chaffin, M. O'Conor, 2005, Journal of the American Veterinary Medical Association.

Evaluation of a real-time quantitative polymerase chain reaction assay for detection and quantitation of virulent Rhodococcus equi.

N. Cohen, M. Golding, N. Halbert, 2005, American journal of veterinary research.

Hematologic and immunophenotypic factors associated with development of Rhodococcus equi pneumonia of foals at equine breeding farms with endemic infection.

N. Cohen, M. Chaffin, R. Martens, 2004, Veterinary immunology and immunopathology.

Epidemiologic study of results of pulsed-field gel electrophoresis of isolates of Rhodococcus equi obtained from horses and horse farms.

K. E. Smith, N. Cohen, T. Ficht, 2003, American journal of veterinary research.

Rhodococcus equi Foal Pneumonia: Failure of Serologic Tests to Accurately Detect Disease

N. Cohen, M. Chaffin, S. Takai, 2002 .

Association of pneumonia in foals caused by Rhodococcus equi with farm soil geochemistry.

N. Cohen, M. Chaffin, R. Martens, 2002, American journal of veterinary research.

Detection of Rhodococcus Equi by Polymerase Chain Reaction Using Species-Specific Nonproprietary Primers

N. Cohen, J. Derr, M. Chaffin, 2002, Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

How to Prevent and Control Pneumonia Caused by Rhodococcus equi at Affected Farms

N. Cohen, M. Chaffin, R. Martens, 2002 .

Use of serial measurements of peritoneal fluid lactate concentration to identify strangulating intestinal lesions in referred horses with signs of colic.

N. Cohen, J. Peloso, 2012, Journal of the American Veterinary Medical Association.

Case-control study of factors associated with fibrinous pericarditis among horses in central Kentucky during spring 2001.

N. Cohen, V. Carey, J. Donahue, 2003, Journal of the American Veterinary Medical Association.

Macrolide- and Rifampin-Resistant Rhodococcus equi on a Horse Breeding Farm, Kentucky, USA

N. Cohen, S. Giguère, K. Kuskie, 2013, Emerging infectious diseases.

Novel transferable erm(46) determinant responsible for emerging macrolide resistance in Rhodococcus equi.

N. Cohen, J. Vázquez-Boland, M. Hondalus, 2015, The Journal of antimicrobial chemotherapy.

Fecal concentration of Rhodococcus equi determined by quantitative polymerase chain reaction of rectal swab samples to differentiate foals with pneumonia from healthy foals

N. Cohen, A. Bordin, B. P. da Silveira, 2022, Journal of veterinary internal medicine.

Identification of copy number variants in horses

M. McCue, G. Cothran, N. Cohen, 2012, Genome research.

Cerebrospinal fluid inflammatory cytokines and chemokines in naturally occurring canine spinal cord injury.

N. Cohen, J. Griffin, C. Welsh, 2014, Journal of neurotrauma.

Multicenter case-control study of signalment, diagnostic features, and outcome associated with cervical vertebral malformation-malarticulation in horses.

N. Cohen, J. Foreman, G. Levine, 2010, Journal of the American Veterinary Medical Association.

Evaluation of urine sucrose concentration for detection of gastric ulcers in horses.

N. Cohen, J. Steiner, J. Meddings, 2004, American journal of veterinary research.

Host-directed therapy in foals can enhance functional innate immunity and reduce severity of Rhodococcus equi pneumonia

N. Cohen, M. Hook, A. Bordin, 2021, Scientific Reports.

Concentrations of serum amyloid A and lipopolysaccharide-binding protein in horses with colic.

N. Cohen, James N. Moore, M. Vandenplas, 2005, American journal of veterinary research.

Comparison of whole genome sequences of Streptococcus equi subsp. equi from an outbreak in Texas with isolates from within the region, Kentucky, USA, and other countries.

N. Cohen, K. Konganti, S. Lawhon, 2020, Veterinary microbiology.

The opportunistic intracellular bacterial pathogen Rhodococcus equi elicits type I interferon by engaging cytosolic DNA sensing in macrophages

N. Cohen, K. Patrick, S. Bell, 2021, PLoS pathogens.

The opportunistic intracellular bacterial pathogen Rhodococcus equi elicits type I interferons by engaging cytosolic DNA sensing in macrophages

N. Cohen, S. Bell, K. Vail, 2021, bioRxiv.

Effects of priming with cytokines on intracellular survival and replication of Rhodococcus equi in equine macrophages

N. Cohen, S. Giguère, A. Bordin, 2018, Cytokine.

Rhodococcus equi: clinical manifestations, virulence, and immunity.

N. Cohen, J. Prescott, M. Hondalus, 2011, Journal of veterinary internal medicine.

Early Blockade of Matrix Metalloproteinases in Spinal-Cord-Injured Dogs Results in a Long-Term Increase in Bladder Compliance.

N. Cohen, J. Griffin, G. Levine, 2017, Journal of neurotrauma.

Basal and stimulus-induced cytokine expression is selectively impaired in peripheral blood mononuclear cells of newborn foals.

N. Cohen, Tong Liu, J. Nerren, 2009, Vaccine.

Effects of dietary fructooligosaccharide on selected bacterial populations in feces of dogs.

N. Cohen, M. Willard, R. Simpson, 2000, American journal of veterinary research.

Antimicrobial activity of gallium maltolate against Staphylococcus aureus and methicillin-resistant S. aureus and Staphylococcus pseudintermedius: An in vitro study.

N. Cohen, M. Libal, S. Lawhon, 2012, Veterinary microbiology.

Values of Urine Specific Gravity for Thoroughbred Horses Treated with Furosemide Prior to Racing Compared with Untreated Horses

N. Cohen, K. Peck, S. A. Smith, 2002, Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

Transmission of Retroviruses by Transfusion of Screened Blood in Patients Undergoing Cardiac Surgery

B. Polk, N. Cohen, A. Muñoz, 1989, The New England journal of medicine.

Transmission of HIV by transfusion of screened blood.

N. Cohen, A. Muñoz, K. Nelson, 1990, The New England journal of medicine.

Pharmacokinetics of an orally administered methylcellulose formulation of gallium maltolate in neonatal foals.

N. Cohen, M. Chaffin, M. O'Conor, 2010, Journal of veterinary pharmacology and therapeutics.

Gallium maltolate: safety in neonatal foals following multiple enteral administrations.

N. Cohen, M. Chaffin, V. Fajt, 2010, Journal of veterinary pharmacology and therapeutics.

Pharmacokinetics of gallium maltolate after intragastric administration in neonatal foals.

Robert J. Taylor, N. Cohen, M. Chaffin, 2007, American journal of veterinary research.

Evaluation of a multiplex polymerase chain reaction assay for simultaneous detection of Rhodococcus equi and the vapA gene.

N. Cohen, N. Halbert, R. Reitzel, 2005, American journal of veterinary research.

Prevalence of Virulent Rhodococcus Equi in Soil from Five R. Equi-Endemic Horse-Breeding Farms and Restriction Fragment Length Polymorphisms of Virulence Plasmids in Isolates from Soil and Infected Foals in Texas

N. Cohen, T. Kakuda, M. Chaffin, 2001, Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

Treatment with histamine-type 2 receptor antagonists and omeprazole increase the risk of diarrhoea in neonatal foals treated in intensive care units.

N. Cohen, M. Furr, B. Tennent-Brown, 2012, Equine veterinary journal. Supplement.

Corrigendum to: "In vitro antimicrobial activity of gallium maltolate against virulent Rhodococcus equi " [Veterinary Microbiology 146 (2010) 175-178].

N. Cohen, M. Libal, K. Kuskie, 2016, Veterinary microbiology.

In vitro antimicrobial activity of gallium maltolate against virulent Rhodococcus equi.

N. Cohen, M. Libal, S. Giguère, 2010, Veterinary microbiology.

Medical management of a large intra‐abdominal mass caused by Rhodococcus equi in a foal

N. Cohen, C. Allen, A. zur Linden, 2020, Equine Veterinary Education.

Pharmacokinetics of gallium maltolate after intragastric administration in adult horses.

Robert J. Taylor, N. Cohen, M. Chaffin, 2010, American Journal of Veterinary Research.

Gene expression of innate Th1-, Th2-, and Th17-type cytokines during early life of neonatal foals in response to Rhodococcus equi.

N. Cohen, Tong‐Xian Liu, A. Bordin, 2011, Cytokine.

CpG-induced stimulation of cytokine expression by peripheral blood mononuclear cells of foals and their dams

N. Cohen, Tong‐Xian Liu, H. E. Garch, 2008 .

Epidemiology and Molecular Basis of Multidrug Resistance in Rhodococcus equi

N. Cohen, R. Berghaus, S. Sanchez, 2021, Microbiology and Molecular Biology Reviews.

24 – Rhodococcus equi Foal Pneumonia

N. Cohen, R. Martens, 2007 .

Detection of Salmonella enteritidis in feces from poultry using booster polymerase chain reaction and oligonucleotide primers specific for all members of the genus Salmonella.

N. Cohen, B. Hargis, R. Behle, 1994, Poultry science.

Estimation of the probability for exceeding a threshold concentration of furosemide at various intervals after intravenous administration in horses.

N. Cohen, S. Stanley, K. Chu, 2001, American journal of veterinary research.

Osseous sequestration in cattle: 110 cases (1987-1997).

S. B. Adams, N. Cohen, P. Mueller, 2000, Journal of the American Veterinary Medical Association.

Use of bethanechol and metoclopramide in horses with duodenitis/proximal jejunitis: 13 cases (1987–1993)

N. Cohen, G. Brumbaugh, N. Faber, 1995 .

Borreliosis (Lyme disease) in horses

N. Cohen, 1996 .

Urinary indices of horses after intravenous administration of crystalloid solutions.

N. Cohen, G. Brumbaugh, A. Roussel, 1993, Journal of veterinary internal medicine.

Case-control study of late-term abortions associated with mare reproductive loss syndrome in central Kentucky.

N. Cohen, V. Carey, J. Donahue, 2003, Journal of the American Veterinary Medical Association.

Disseminated intravascular coagulation associated with colic in 23 horses (1984-1989).

N. Cohen, R. Welch, J. Watkins, 1992, Journal of veterinary internal medicine.

Confirmed and presumptive cervical vertebral compressive myelopathy in older horses: a retrospective study (1992-2004).

N. Cohen, R. MacKay, J. Levine, 2007, Journal of veterinary internal medicine.

Safe and effective aerosolization of in vitro transcribed mRNA to the respiratory tract epithelium of horses without a transfection agent

N. Cohen, J. Pollet, Cristina Poveda, 2021, Scientific reports.

Alterations of fluid and electrolyte balance in thoroughbred racehorses following strenuous exercise during training.

N. Cohen, A. Roussel, E. Grift, 1993, Canadian journal of veterinary research = Revue canadienne de recherche veterinaire.

Vaccination of yearling horses against poly-N-acetyl glucosamine fails to protect against infection with Streptococcus equi subspecies equi

N. Cohen, G. Pier, C. Cywes-Bentley, 2020, PloS one.

Types of Vaccines

N. Cohen, A. Bordin, 2015 .

Transmission of Retroviruses from Seronegative Donors by Transfusion during Cardiac Surgery

A. Muñoz, B. Callicott, H. Farzadegan, 1992, Annals of Internal Medicine.

Ex vivo comparison of single‐layer and double‐layer laparoscopic closure of equine bladders with 2 types of barbed sutures

N. Cohen, J. Hardy, Dustin S Major, 2017, Veterinary surgery : VS.

Duodenojejunal mesenteric rents: Survival and complications after surgical correction in 38 broodmares (2006‐2014)

N. Cohen, R. Hunt, L. A. Werner, 2017, Veterinary surgery : VS.

Gallium Maltolate as an Alternative to Macrolides for Treatment of Presumed Rhodococcus equi Pneumonia in Foals

N. Cohen, M. Chaffin, S. Giguère, 2015, Journal of veterinary internal medicine.

Ultrasonographic visualization of the liver in sites recommended for blind percutaneous liver biopsy in horses.

N. Cohen, M. Chaffin, T. Norman, 2014, Journal of the American Veterinary Medical Association.

Dietary and Other Management Factors Associated with Equine Colic

N. Cohen, P. G. Gibbs, A. Woods, 1999 .

Case-control study of early-term abortions (early fetal losses) associated with mare reproductive loss syndrome in central Kentucky.

N. Cohen, V. Carey, J. Donahue, 2003, Journal of the American Veterinary Medical Association.

Early management of race-bred weanlings and yearlings on farms

N. Cohen, P. G. Gibbs, 2001 .

Equine nutritional secondary hyperparathyroidism

N. Cohen, R. Nachreiner, J. B. David, 1997 .

Chronic idiopathic inflammatory bowel diseases of the horse.

N D Cohen, N. Cohen, J. Edwards, 2000, Journal of veterinary internal medicine.

Effect of classifying disease states in genetic association studies for paratuberculosis.

S. Sinha, N. Cohen, J. Osterstock, 2010, Preventive veterinary medicine.

Familial associations with paratuberculosis ELISA results in Texas Longhorn cattle.

N. Cohen, J. Osterstock, G. Fosgate, 2008, Veterinary microbiology.

Temporohyoid osteoarthropathy in 33 horses (1993-2000).

N. Cohen, D. Sellon, C. Ragle, 2002, Journal of veterinary internal medicine.

Empyema of the guttural pouch (auditory tube diverticulum) in horses: 91 cases (1977-1997).

N. Cohen, C. Judy, M. Chaffin, 1999, Journal of the American Veterinary Medical Association.

Massive pulmonary thromboembolism in six horses.

N. Cohen, S. Reuss, M. Chaffin, 2008, Equine veterinary journal.

N. Cohen, M. Chaffin, R. Martens, 2003, Journal of the American Veterinary Medical Association.

Pharmacokinetics, stability, and retrospective analysis of use of an oral gel formulation of the bovine injectable enrofloxacin in horses.

N. Cohen, D. Boothe, K. Epstein, 2004, Veterinary therapeutics : research in applied veterinary medicine.

Septic tenosynovitis in horses: 25 cases (1983-1989).

N. Cohen, J. Watkins, C. Honnas, 1991, Journal of the American Veterinary Medical Association.

Steroid hepatopathy in a horse with glucocorticoid-induced hyperadrenocorticism.

N. Cohen, G. K. Carter, 1992, Journal of the American Veterinary Medical Association.

Fistulous withers in horses: 24 cases (1984-1990).

N. Cohen, G. K. Carter, W. McMullan, 1992, Journal of the American Veterinary Medical Association.

Equine lymphocytic-plasmacytic enterocolitis: a retrospective study of 14 cases.

N D Cohen, N. Cohen, B. Valentine, 2010, Equine veterinary journal. Supplement.

Case-control study of risk factors for pasture-and endocrinopathy-associated laminitis in North American horses.

Rustin M. Moore, M. McCue, N. Cohen, 2018, Journal of the American Veterinary Medical Association.

Characterization of naturally developing small intestinal bacterial overgrowth in 16 German shepherd dogs.

N. Cohen, T. Fossum, G. Reinhart, 1994, Journal of the American Veterinary Medical Association.

Bactericidal activity of 3D-printed hydrogel dressing loaded with gallium maltolate

N. Cohen, E. Cosgriff-Hernandez, Ziyang Lan, 2019, APL bioengineering.

Comparison of polymerase chain reaction and microbiological culture for detection of salmonellae in equine feces and environmental samples.

N. Cohen, H. Neibergs, D. Wallis, 1996, American journal of veterinary research.

Detection of Salmonella Enteritidis in Equine Feces using the Polymerase Chain Reaction and Genus-Specific Oligonucleotide Primers

N. Cohen, B. Hargis, H. Neibergs, 1995, Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

Genus-specific detection of salmonellae in equine feces by use of the polymerase chain reaction.

N. Cohen, B. Hargis, H. Neibergs, 1994, American journal of veterinary research.

Genus-Specific Detection of Salmonellae using the Polymerase Chain Reaction (PCR)

N. Cohen, B. Hargis, R. Behle, 1993, Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

Prevalence of antibodies to Rochalimaea species (cat-scratch disease agent) in cats

J. Childs, N. Cohen, J. Olson, 1995, Veterinary Record.

Quality of tissue specimens obtained endoscopically from the duodenum of dogs and cats.

N. Cohen, S. Lovering, B. Weeks, 2001, Journal of the American Veterinary Medical Association.

Frequency of Corynebacterium pseudotuberculosis infection in horses across the United States during a 10-year period.

N. Cohen, S. Spier, C. Carter, 2014, Journal of the American Veterinary Medical Association.

Prevalence of and risk factors for fecal shedding of Cryptosporidium parvum oocysts in horses.

N. Cohen, D. Cole, R. Smith, 1998, Journal of the American Veterinary Medical Association.

Sucrose concentration in blood: a new method for assessment of gastric permeability in horses with gastric ulceration.

N. Cohen, R. Buddington, A. Roussel, 2006, Journal of veterinary internal medicine.

Whole-Genome sequencing and genetic variant analysis of a quarter Horse mare

Charles D. Johnson, N. Cohen, Ryan N. Doan, 2012, BMC Genomics.

Quantitative detection of atropine-delayed gastric emptying in the horse by the 13C-octanoic acid breath test.

N. Cohen, T. Preston, A. Roussel, 2010, Equine veterinary journal.

Temporal changes in cytokine expression of foals during the first month of life.

N. Cohen, M. Chaffin, J. Ball, 2003, Veterinary immunology and immunopathology.

Association of catastrophic condylar fracture with bony changes of the third metacarpal bone identified by use of standing magnetic resonance imaging in forelimbs from cadavers of Thoroughbred racehorses in the United States.

N. Cohen, J. Vogler, J. Peloso, 2019, American journal of veterinary research.

Aetiology The genus Cryptosporidium belongs to the phylum Apicomplexa and currently comprises 16 valid CRYPTOSPORIDIOSIS

N. Cohen, G. Pearson, T. Mair, 2009 .

Comparison of nuclear scintigraphy and acetaminophen absorption as a means of studying gastric emptying in horses.

N. Cohen, K. Lohmann, A. Roussel, 2000, American journal of veterinary research.

Feeding alfalfa hay to exercising horses reduces the severity of gastric squamous mucosal ulceration.

N. Cohen, P. G. Gibbs, D. Sigler, 2007 .

Sucrose permeability testing as an indicator of gastric ulceration in horses.

N. Cohen, J. Steiner, M. O'Conor, 2003 .

Diagnostic Assessment of Foals with Colic

N. Cohen, M. Chaffin, 1999 .

In vivo performance of a bilayer wrap to prevent abdominal adhesions.

A. Kishan, N. Cohen, E. Cosgriff-Hernandez, 2020, Acta biomaterialia.

Retrospective analysis of factors associated with outcome of proximal interphalangeal joint arthrodesis in 82 horses including Warmblood and Thoroughbred sport horses and Quarter Horses (1992-2014).

N. Cohen, C. Judy, M. Rick, 2016, Equine veterinary journal.

Injection of platelet- and leukocyte-rich plasma at the junction of the proximal sesamoid bone and the suspensory ligament branch for treatment of yearling Thoroughbreds with proximal sesamoid bone inflammation and associated suspensory ligament branch desmitis.

N. Cohen, K. Garrett, L. Bramlage, 2013, Journal of the American Veterinary Medical Association.

Comparison of the polymerase chain reaction using genus-specific oligonucleotide primers and microbiologic culture for the detection of Salmonella in drag-swabs from poultry houses.

N. Cohen, B. Hargis, A. Mcelroy, 1994, Poultry science.

Clinical and epizootiologic characteristics of dogs seropositive for Borrelia burgdorferi in Texas: 110 cases (1988).

N. Cohen, C. Carter, A. Eugster, 1990, Journal of the American Veterinary Medical Association.

Detection of vapN in Rhodococcus equi isolates cultured from humans

N. Cohen, S. Lawhon, L. Bryan, 2018, PloS one.

Prognostic indicators for horses with duodenitis-proximal jejunitis. 75 horses (1985-1989).

N D Cohen, N. Cohen, T L Seahorn, 1992, Journal of veterinary internal medicine.

Medical management of right dorsal colitis in 5 horses: a retrospective study (1987-1993).

N. Cohen, R. Mealey, G. K. Carter, 1995, Journal of veterinary internal medicine.

Meal size and starch content affect gastric emptying in horses.

N. Cohen, A. Roussel, Ildoo Kim, 2010, Equine veterinary journal.

CHAPTER 10 – Gastrointestinal Medicine

N. Cohen, K. Lohmann, 2006 .

Extrapulmonary disorders associated with Rhodococcus equi infection in foals: 150 cases (1987-2007).

N. Cohen, S. Reuss, M. Chaffin, 2009, Journal of the American Veterinary Medical Association.

Pharmacokinetics and pharmacodynamics of xylazine administered by the intravenous or intra-osseous route in adult horses.

N. Cohen, V. Fajt, A. Santonastaso, 2014, Journal of veterinary pharmacology and therapeutics.

Detection of Cryptosporidium parvum in Horses: Thresholds of Acid-Fast Stain, Immunofluorescence Assay, and Flow Cytometry

N. Cohen, D. Cole, R. Smith, 1999, Journal of Clinical Microbiology.

Intramuscular Administration of a Synthetic CpG-Oligodeoxynucleotide Modulates Functional Responses of Neutrophils of Neonatal Foals

N. Cohen, M. Kogut, K. Kuskie, 2014, PloS one.

Causes of and farm management factors associated with disease and death in foals.

N. Cohen, 1994, Journal of the American Veterinary Medical Association.

Effects of inactivated parapoxvirus ovis on the cumulative incidence of pneumonia and cytokine secretion in foals on a farm with endemic infections caused by Rhodococcus equi.

N. Cohen, S. Giguère, A. Kalyuzhny, 2011, Veterinary immunology and immunopathology.

Effect of gallium maltolate on a model of chronic, infected equine distal limb wounds

N. Cohen, S. Lawhon, B. Weeks, 2020, PloS one.

Reptiles as models for the study of immunity and its phylogenesis.

N. Cohen, 1971, Journal of the American Veterinary Medical Association.

Effects of dietary supplementation of fructo-oligosaccharides on small intestinal bacterial overgrowth in dogs.

N. Cohen, T. Fossum, G. Reinhart, 1994, American journal of veterinary research.

Chemoprophylactic Antimicrobial Activity of Gallium Maltolate against Intracellular Rhodococcus equi

Nicole A. Miller, N. Cohen, L. Bernstein, 2007 .

Effect of Dietary Corn Oil Supplementation on Equine Gastric Fluid Acid, Sodium, and Prostaglandin E2 Content before and during Pentagastrin Infusion

Inyoung Kim, N. Cohen, J. Burrow, 2004 .

Antimicrobial activity of gallium against virulent Rhodococcus equiin vitro and in vivo.

N. Cohen, L. Bernstein, R. Martens, 2006, Journal of veterinary pharmacology and therapeutics.

Differences in the Accessory Genomes and Methylomes of Strains of Streptococcus equi subsp. equi and of Streptococcus equi subsp. zooepidemicus Obtained from the Respiratory Tract of Horses from Texas

N. Cohen, S. Lawhon, Jing Wu, 2022, Microbiology spectrum.

Spread of Multidrug-Resistant Rhodococcus equi, United States

N. Cohen, J. Vázquez-Boland, S. Giguère, 2021, Emerging infectious diseases.

The novel and transferable erm(51) gene confers Macrolides, Lincosamides, and Streptogramins B (MLSB ) resistance to clonal Rhodococcus equi in the environment.

N. Cohen, S. Giguère, K. Hart, 2020, Environmental microbiology.

Associations of sex, breed, and age with cervical vertebral compressive myelopathy in horses: 811 cases (1974-2007).

N. Cohen, G. Levine, J. Levine, 2008, Journal of the American Veterinary Medical Association.

Observer agreement study of cervical-vertebral ratios in horses.

N. Cohen, T. Divers, J. Levine, 2011, Equine veterinary journal.

Rhabdomyolysis in two foals with polysaccharide storage myopathy

N. Cohen, S. Valberg, Samuel L. Jones, 2000 .

A multicenter case-control study of risk factors for equine protozoal myeloencephalitis.

J. Beech, N. Cohen, R. MacKay, 2007, Journal of the American Veterinary Medical Association.

PNAG-specific equine IgG1 mediates significantly greater opsonization and killing of Prescottella equi (formerly Rhodococcus equi) than does IgG4/7.

S. Pillai, N. Cohen, R. Alaniz, 2019, Vaccine.

NSAIDs disrupt intestinal homeostasis by suppressing macroautophagy in intestinal epithelial cells

N. Cohen, R. Barhoumi, J. Szule, 2019, Scientific Reports.

Crohn's disease and ulcerative colitis are associated with the DNA repair gene MLH1.

N. Cohen, S. Galandiuk, H. Neibergs, 1997, Annals of surgery.

Epigenetic Regulation of Gene Expression: Emerging Applications for Horses

N. Cohen, S. Dindot, Scott V. Dindot, 2013 .

A Common Practice of Widespread Antimicrobial Use in Horse Production Promotes Multi-Drug Resistance

N. Cohen, S. Giguère, E. R. A. Morris, 2020, Scientific Reports.

Novel transferable erm(46) determinant responsible for emerging macrolide resistance in Rhodococcus equi.

N. Cohen, M. Hondalus, E. Anastasi, 2016, The Journal of antimicrobial chemotherapy.

Use of Serial Quantitative PCR of the vapA Gene of Rhodococcus equi in Feces for Early Detection of R. equi Pneumonia in Foals

N. Cohen, M. Chaffin, G. Blodgett, 2016, Journal of veterinary internal medicine.

Bovine lymphocyte antigen class II alleles as risk factors for high somatic cell counts in milk of lactating dairy cows.

N. Cohen, L. Timms, M. Kehrli, 1997, Journal of dairy science.

Association of adrenocorticotrophin and cortisol concentrations with peripheral blood leukocyte cytokine gene expression in septic and nonseptic neonatal foals.

N. Cohen, T. Welsh, J. Gold, 2012, Journal of veterinary internal medicine.

Amikacin Resistance in Staphylococcus pseudintermedius Isolated from Dogs

N. Cohen, S. Lawhon, R. Gold, 2014, Journal of Clinical Microbiology.

Effects of age and R848 stimulation on expression of Toll-like receptor 8 mRNA by foal neutrophils.

N. Cohen, C. Brake, J. Harrington, 2012, Veterinary immunology and immunopathology.

Epizootiologic association between feline immunodeficiency virus infection and feline leukemia virus seropositivity.

N. Cohen, C. Carter, A. Eugster, 1990, Journal of the American Veterinary Medical Association.

The microbiota-derived metabolite indole decreases mucosal inflammation and injury in a murine model of NSAID enteropathy

A. Jayaraman, N. Cohen, R. Alaniz, 2016, Gut microbes.

Ex vivo comparison of ultrasonographic intestinal wall layering with histology in horses: A feasibilty study.

N. Cohen, K. Bevevino, J. Edwards, 2020, Veterinary radiology & ultrasound : the official journal of the American College of Veterinary Radiology and the International Veterinary Radiology Association.

Acute Phase Proteins in Cerebrospinal Fluid from Dogs with Naturally-Occurring Spinal Cord Injury.

N. Cohen, J. Griffin, C. Welsh, 2015, Journal of neurotrauma.

Factors associated with survival in septicemic foals: 65 cases (1988-1995).

N. Cohen, M. Chaffin, J. Gayle, 1998, Journal of Veterinary Internal Medicine.

Evaluation of risk factors associated with development of postoperative ileus in horses.

N. Cohen, A. Roussel, A. M. Merritt, 2004, Journal of the American Veterinary Medical Association.

Feeding practices associated with colic in horses.

N. Cohen, P. G. Gibbs, J. Thompson, 2001, Journal of the American Veterinary Medical Association.

Effects of regional limb perfusion volume on concentrations of amikacin sulfate in synovial and interstitial fluid samples from anesthetized horses.

N. Cohen, Jennifer L Godfrey, J. Hardy, 2016, American journal of veterinary research.

Association of high-speed exercise with racing injury in thoroughbreds.

I. C. Howard, Scott M. Berry, S. Berry, 2000, Journal of the American Veterinary Medical Association.

Frequency of musculoskeletal injuries and risk factors associated with injuries incurred in Quarter Horses during races.

N. Cohen, J. Peloso, G. Mundy, 1999, Journal of the American Veterinary Medical Association.

Results of physical inspection before races and race-related characteristics and their association with musculoskeletal injuries in Thoroughbreds during races.

N. Cohen, V. Carey, J. Peloso, 1999, Journal of the American Veterinary Medical Association.

N. Cohen, J. Watkins, J. Peloso, 1997, Journal of the American Veterinary Medical Association.

Prevalence of, and factors associated with, musculoskeletal racing injuries of thoroughbreds.

N. Cohen, J. Peloso, G. Mundy, 1994, Journal of the American Veterinary Medical Association.

Genetic Susceptibility to Rhodococcus equi

N. Cohen, M. Foster, S. Dindot, 2015, Journal of veterinary internal medicine.

The effects of xylazine, detomidine, acepromazine and butorphanol on equine solid phase gastric emptying rate.

R. Christley, N. Cohen, T. Preston, 2010, Equine veterinary journal.

Effect of an indwelling nasogastric tube on gastric emptying rates of liquids in horses.

N. Cohen, A. Roussel, D. Boothe, 2005, American journal of veterinary research.

Efficacy of a Metalloproteinase Inhibitor in Spinal Cord Injured Dogs

Z. Werb, M. Heller, N. Cohen, 2014, PloS one.

Case-control study of risk factors for the development of laminitis in the contralateral limb in Equidae with unilateral lameness.

N. Cohen, J. Watkins, J. Peloso, 1996, Journal of the American Veterinary Medical Association.

Dietary and other management factors associated with colic in horses.

N. Cohen, P. G. Gibbs, A. Woods, 1999, Journal of the American Veterinary Medical Association.

Detection of bacteria in equine synovial fluid by use of the polymerase chain reaction.

N. Cohen, R. Simpson, M. Crabill, 1996, Veterinary surgery : VS.

Pharmacokinetics of a high dose of gentamicin administered intravenously or intramuscularly to horses.

N. Cohen, G. Brumbaugh, K. G. Magdesian, 1998, Journal of the American Veterinary Medical Association.

N. Cohen, M. Chaffin, Roger D. Smith, 2002, American journal of veterinary research.

Risk factors associated with development of postoperative ileus in horses.

N. Cohen, A. Roussel, P. Rakestraw, 2001, Journal of the American Veterinary Medical Association.

Seroprevalence of antibodies to Borrelia burgdorferi in a population of horses in central Texas.

E. Bosler, N. Cohen, D. Cohen, 1992, Journal of the American Veterinary Medical Association.

Chemoprophylactic effects of azithromycin against Rhodococcus equi-induced pneumonia among foals at equine breeding farms with endemic infections.

N. Cohen, M. Chaffin, R. Martens, 2008, Journal of the American Veterinary Medical Association.

Pharmacokinetics and Stability of an Enrofloxacin Oral Gel Formulation in Horses

N. Cohen, D. Boothe, K. Epstein, 2004 .

Chylothorax in cats: 37 cases (1969-1989).

N. Cohen, T. Fossum, H. Boothe, 1991, Journal of the American Veterinary Medical Association.

Diagnosis, treatment, control, and prevention of infections caused by Rhodococcus equi in foals.

N. Cohen, J. Prescott, M. Hondalus, 2011, Journal of veterinary internal medicine.

N. Cohen, S. Payne, J. Nerren, 2009, Veterinary immunology and immunopathology.

Cytokine expression by neutrophils of adult horses stimulated with virulent and avirulent Rhodococcus equi in vitro.

N. Cohen, N. Halbert, S. Payne, 2009, Veterinary immunology and immunopathology.

GGGTGACGTGAGTAAACCTGAAC CCGTCCCGCGTGTTC AAGTGAACTCATCAAAGTGATGAATGA CGAAATGGATTCTGACTCCTCTTC TCGCCCAAAGCTAACCTGAGGAAGC GCTCCAGACGGTGCTTGTG GCCGATCACCCCAAAGTG TGTCGCAGGAGCCACCACGCT GAAAAAGACGGATGCTTCCAATCTG TCCGAAAGACCAGTGGTGATTTT CAGGTCTCCTGATTGAAC GCCACACTGCGAAAACTCA GCACAATAATCTGCACCCACTTTG ACGAGC

N. Cohen, N. Halbert, S. Payne, 2008 .

Assessment of microbiological correlates and immunostimulatory potential of electron beam inactivated metabolically active yet non culturable (MAyNC) Salmonella Typhimurium

S. Pillai, N. Cohen, R. Alaniz, 2021, PloS one.

Borreliosis in horses: a comparative review.

N. Cohen, D. Cohen, 1990 .

Prevalence and risk factors associated with emergence of Rhodococcus equi resistance to macrolides and rifampicin in horse-breeding farms in Kentucky, USA.

N. Cohen, S. Giguère, K. Hart, 2019, Veterinary microbiology.

Foal‐Level Risk Factors Associated With Development of Rhodococcus equi Pneumonia at a Quarter Horse Breeding Farm

N. Cohen, R. Ivanek, K. Bevevino, 2019, Journal of equine veterinary science.

Controversies in therapy of infections caused by Rhodococcus equi in foals

N. Cohen, S. Giguère, 2018 .

Update on bacterial pneumonia in the foal and weanling.

N. Cohen, S. Reuss, 2015, The Veterinary clinics of North America. Equine practice.

Relationship of mixed bacterial infection to prognosis in foals with pneumonia caused by Rhodococcus equi.

L. Jordan, N. Cohen, S. Giguère, 2012, Journal of veterinary internal medicine.

Determination of the prevalence of antimicrobial resistance to macrolide antimicrobials or rifampin in Rhodococcus equi isolates and treatment outcome in foals infected with antimicrobial-resistant isolates of R equi.

N. Cohen, Elise A Lee, N. Halbert, 2010, Journal of the American Veterinary Medical Association.

Detection of Strain Variation in Isolates of Rhodococcus Equi from an Affected Foal Using Repetitive Sequence–Based Polymerase Chain Reaction

N. Cohen, N. Halbert, S. Lawhon, 2010, Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

Postnatal changes in epigenetic modifications of neutrophils of foals are associated with increased ROS function and regulation of neutrophil function

N. Cohen, Ryan N. Doan, K. Kuskie, 2018, Developmental and comparative immunology.

A two‐component nonlinear mixed effects model for longitudinal data, with application to gastric emptying studies

Inyoung Kim, Naisyin Wang, Noah D Cohen, 2010, Statistics in medicine.

Multi-Center Retrospective Evaluation of Screw and Polymethylmethacrylate Constructs for Atlantoaxial Fixation in Dogs.

N. Cohen, C. Boudreau, J. Levine, 2016, Veterinary surgery : VS.

Quantitative magnetic resonance imaging in a naturally occurring canine model of spinal cord injury

N. Cohen, J. Griffin, J. Levine, 2015, Spinal Cord.

Characterization of agr Groups of Staphylococcus pseudintermedius Isolates from Dogs in Texas

N. Cohen, S. Lawhon, A. Hillhouse, 2019, mSphere.

Validation of quantitative polymerase chain reaction assays for measuring cytokine expression in equine macrophages.

N. Cohen, S. Payne, Charlotte A. Allen, 2007, Journal of immunological methods.

Alterations in acid-base balance and serum electrolyte concentrations in cattle: 632 cases (1984-1994).

N. Cohen, R. Green, A. Roussel, 1998, Journal of the American Veterinary Medical Association.

Risk factors for wound infection following celiotomy in horses.

N. Cohen, C. Honnas, 1997, Journal of the American Veterinary Medical Association.

Evaluation of the effects of penicillin G potassium and potassium chloride on the motility of the large intestine in horses.

N. Cohen, A. Roussel, R. N. Hooper, 2003, American journal of veterinary research.

Prokinetic effects of erythromycin on the ileum, cecum, and pelvic flexure of horses during the postoperative period.

N. Cohen, A. Roussel, R. N. Hooper, 2000, American journal of veterinary research.

Characteristics and risk factors for failure of horses with acute diarrhea to survive: 122 cases (1990-1996).

N. Cohen, A. Woods, Woods Am, 1999, Journal of the American Veterinary Medical Association.

Effects of phenylbutazone alone or in combination with a nutritional therapeutic on gastric ulcers, intestinal permeability, and fecal microbiota in horses

N. Cohen, C. Whitfield-Cargile, A. Chamoun-Emanuelli, 2021, Journal of veterinary internal medicine.

Comparison of primary closure of incisional hernias in horses with and without the use of prosthetic mesh support.

N. Cohen, P. Rakestraw, C. Whitfield-Cargile, 2011, Equine veterinary journal. Supplement.

Identification of Genomic Loci Associated with Rhodococcus equi Susceptibility in Foals

N. Cohen, Ryan N. Doan, I. Ivanov, 2014, PloS one.

Right dorsal colitis

N. Cohen, 2010 .

Principles of Vaccination

N. Cohen, A. Bordin, 2015 .

Case-control study of the association between various management factors and development of colic in horses. Texas Equine Colic Study Group.

N. Cohen, P. Matějka, C. Honnas, 1995, Journal of the American Veterinary Medical Association.

Evaluation of administration of West Nile virus vaccine to pregnant broodmares.

N. Cohen, G. Blodgett, T. Blanchard, 2004, Journal of the American Veterinary Medical Association.

Randomized, controlled trial comparing Rhodococcus equi and poly‐N ‐acetyl glucosamine hyperimmune plasma to prevent R equi pneumonia in foals

N. Cohen, G. Pier, G. Blodgett, 2021, Journal of veterinary internal medicine.

Transfusion with 2 litres of hyperimmune plasma is superior to transfusion of 1 litre for protecting foals against pneumonia attributed to Rhodococcus equi

N. Cohen, A. Bordin, S. Kahn, 2021 .

Opsonization but not pretreatment of equine macrophages with hyperimmune plasma nonspecifically enhances phagocytosis and intracellular killing of Rhodococcus equi.

N. Cohen, A. Bordin, Jocelyne M. Bray, 2020, Journal of veterinary internal medicine.

Transfusion With 2 L of Hyperimmune Plasma is Superior to Transfusion of 1 L or Less for Protecting Foals Against Subclinical Pneumonia Attributed to Rhodococcus equi.

N. Cohen, K. Bevevino, G. Blodgett, 2019, Journal of equine veterinary science.

Immunogenicity of an Electron Beam Inactivated Rhodococcus equi Vaccine in Neonatal Foals

S. Pillai, N. Cohen, D. McMurray, 2014, PloS one.

Effect of hyperimmune plasma on the severity of pneumonia caused by Rhodococcus equi in experimentally infected foals.

S. McClure, N. Cohen, M. Chaffin, 2006, Veterinary therapeutics : research in applied veterinary medicine.

Application of Sartwell's model (lognormal distribution of incubation periods) to age at onset and age at death of foals with Rhodococcus equi pneumonia as evidence of perinatal infection.

N. Cohen, M. Chaffin, K. G. Magdesian, 2001, Journal of veterinary internal medicine.

Differential effects of selective and non-selective cyclooxygenase inhibitors on fecal microbiota in adult horses

N. Ajami, N. Cohen, C. Whitfield-Cargile, 2018, PloS one.

Non-invasive evaluation of the equine gastrointestinal mucosal transcriptome

N. Cohen, L. Davidson, I. Ivanov, 2020, PloS one.

Comparison of the microbiome, metabolome, and lipidome of obese and non-obese horses

N. Cohen, C. Whitfield-Cargile, M. Coleman, 2019, PloS one.

Association of racing performance with specific abnormal radiographic findings in Thoroughbred yearlings sold in Texas

N. Cohen, M. O'Conor, J. Watkins, 2006 .

Renosplenic entrapment of the large colon in horses: 57 cases (1983-1988).

N. Cohen, J. Watkins, A. Baird, 1991, Journal of the American Veterinary Medical Association.

Epidemiology of colic.

N. Cohen, 1997, The Veterinary clinics of North America. Equine practice.

Musculoskeletal problems associated with lameness and poor performance in cutting horses: 200 cases (2007-2015).

N. Cohen, C. Honnas, R. Dabareiner, 2019, Journal of the American Veterinary Medical Association.

Musculoskeletal problems associated with lameness and poor performance among horses used for barrel racing: 118 cases (2000-2003).

N. Cohen, R. Dabareiner, W. Moyer, 2005, Journal of the American Veterinary Medical Association.

Lameness and poor performance in horses used for team roping: 118 cases (2000-2003).

N. Cohen, R. Dabareiner, W. Moyer, 2005, Journal of the American Veterinary Medical Association.

Duodenitis/proximal jejunitis in horses

N. Cohen, J. Schumacher, T. Seahorn, 1994 .

Epidemiology of Colic: Risk Factors

N. Cohen, 2017 .

Comparison of novel wearable cardiac monitors to yield accurate exercising ECG and heart rate data in horses

N. Cohen, J. Haughan, C. N. D. Solís, 2021 .

Evaluation of the efficacy of gallium maltolate for chemoprophylaxis against pneumonia caused by Rhodococcus equi infection in foals.

N. Cohen, M. Chaffin, M. O'Conor, 2011, American journal of veterinary research.

Novel lipoprotein density profiling in laminitic, obese, and healthy horses.

N. Cohen, R. Walzem, J. Suchodolski, 2019, Domestic animal endocrinology.

Evaluation of the Polymerase Chain Reaction for the Detection of Salmonella enteritidis in Experimentally Inoculated Eggs and Eggs from Experimentally Challenged Hens.

N. Cohen, B. Hargis, A. Mcelroy, 1996, Journal of food protection.

Arytenoidectomy for advanced unilateral chondropathy with accompanying lesions.

N. Cohen, P. Dean, 1990, Veterinary surgery : VS.

Feasibility of a point-of-care ultrasound protocol for cardiorespiratory evaluation of horses in different clinical settings.

N. Cohen, K. Bevevino, C. Navas de Solis, 2023, Journal of veterinary internal medicine.

Evaluation of a Centrifugation Method for the Detection of Salmonella enteritidis in Experimentally Contaminated Chicken Eggs.

N. Cohen, B. Hargis, A. Mcelroy, 1995, Journal of Food Protection.

Rhodococcus equi Infections in Goats: Characterization of Virulence Plasmids

N. Cohen, L. Stranahan, S. Lawhon, 2018, Veterinary pathology.

Antimicrobial activity of tulathromycin and 14 other antimicrobials against virulent Rhodococcus equi in vitro.

N. Cohen, M. Libal, S. Lawhon, 2010, Veterinary therapeutics : research in applied veterinary medicine.

In Vitro Susceptibility of Equine-Obtained Isolates of Corynebacterium pseudotuberculosis to Gallium Maltolate and 20 Other Antimicrobial Agents

N. Cohen, S. Lawhon, K. Kuskie, 2014, Journal of Clinical Microbiology.

Uptake and replication in Acanthamoeba castellanii of a virulent (pVAPA-positive) strain of Rhodococcus equi and its isogenic, plasmid-cured strain.

N. Cohen, R. Barhoumi, A. Bordin, 2021, Veterinary microbiology.

Maternal vaccination with dPNAG protects foals against the intracellular pathogen Rhodococcus equi

N. Cohen, G. Pier, C. Cywes-Bentley, 2016, The Journal of Immunology.

Association of pneumonia with concentrations of virulent Rhodococcus equi in fecal swabs of foals before and after intrabronchial infection with virulent R. equi

N. Cohen, A. Bordin, B. P. da Silveira, 2022, Journal of veterinary internal medicine.

Association of soil concentrations of Rhodococcus equi and incidence of pneumonia attributable to Rhodococcus equi in foals on farms in central Kentucky.

N. Cohen, H. M. Scott, M. Chaffin, 2008, American journal of veterinary research.

Study of serum amyloid A concentrations as a means of achieving early diagnosis of Rhodococcus equi pneumonia.

N. Cohen, M. Vandenplas, J. Moore, 2010, Equine veterinary journal.

Composition and Diversity of the Fecal Microbiome and Inferred Fecal Metagenome Does Not Predict Subsequent Pneumonia Caused by Rhodococcus equi in Foals

S. Dowd, N. Cohen, G. Browning, 2015, PloS one.

Associations between the Exposure to Airborne Virulent Rhodococcus equi and the Incidence of R equi Pneumonia among Individual Foals

S. Sinha, N. Cohen, M. Chaffin, 2011 .

Evaluation of equine breeding farm characteristics as risk factors for development of Rhodococcus equi pneumonia in foals.

N. Cohen, M. Chaffin, R. Martens, 2003, Journal of the American Veterinary Medical Association.

Investigation of effects of omeprazole on the fecal and gastric microbiota of healthy adult horses.

N. Cohen, S. Giguère, C. Whitfield-Cargile, 2019, American journal of veterinary research.

Effect of selective versus nonselective cyclooxygenase inhibitors on gastric ulceration scores and intestinal inflammation in horses

N. Cohen, C. Whitfield-Cargile, A. Chamoun-Emanuelli, 2018, Veterinary surgery : VS.

Evaluation of acetaminophen absorption in horses with experimentally induced delayed gastric emptying.

N. Cohen, K. Lohmann, A. Roussel, 2002, American journal of veterinary research.

Cystic nasal concha in a calf.

N. Cohen, J. Schumacher, J. Vacek, 1991, Journal of the American Veterinary Medical Association.

Phenotypic Effects of Cattle Mitochondrial DNA in American Bison

P. Hedrick, N. Cohen, D. Hedgecock, 2012, Conservation biology : the journal of the Society for Conservation Biology.

A Randomized, Self-Controlled Case Series Evaluating Core Osteostixis of Osseous Cyst-Like Lesions of the Navicular Bone to Improve Lameness in Horses with Podotrochlear Syndrome

N. Cohen, M. Barrett, C. Honnas, 2023, Veterinary medicine.

Safe and effective aerosolization of in vitro transcribed mRNA to the respiratory tract epithelium of horses without a transfection agent

N. Cohen, J. Pollet, Cristina Poveda, 2021, Scientific Reports.

[Epidemiological information obtained from anti-hepatitis C virus screening in blood donors and candidates for autologous transfusion from 1992 to 1996 in the Alpes-Maritimes region].

D. Ouzan, N. Cohen, R. Follana, 2000, Gastroenterologie clinique et biologique.

Effects of iron modulation on growth and viability of Rhodococcus equi and expression of virulence-associated protein A.

L. Dangott, N. Cohen, E. Weinberg, 2003, American journal of veterinary research.

The non-invasive exfoliated transcriptome (exfoliome) reflects the tissue-level transcriptome in a mouse model of NSAID enteropathy

N. Cohen, L. Davidson, I. Ivanov, 2017, Scientific Reports.

Chloroquine inhibits Rhodococcus equi replication in murine and foal alveolar macrophages by iron-starvation.

N. Cohen, L. Gressler, A. Bordin, 2016, Veterinary microbiology.

Variations in equid SLC11A1 (NRAMP1) genes and associations with Rhodococcus equi pneumonia in horses.

N. Cohen, N. Halbert, N. Slovis, 2006, Journal of veterinary internal medicine.

Protective Role of Neutrophils in Mice Experimentally Infected with Rhodococcus equi

T. Moore, N. Cohen, J. Edwards, 2005, Infection and Immunity.

Gallium Therapy: A Novel Metal-Based Antimicrobial Strategy for Potential Control of Rhodococcus equi Foal Pneumonia

Robert J. Taylor, N. Cohen, M. Chaffin, 2006 .

Association of disease with isolation and virulence of Rhodococcus equi from farm soil and foals with pneumonia.

N. Cohen, M. Chaffin, H. Liu, 2000, Journal of the American Veterinary Medical Association.

Antibody to Poly-N-acetyl glucosamine provides protection against intracellular pathogens: Mechanism of action and validation in horse foals challenged with Rhodococcus equi

N. Cohen, G. Pier, T. Zaidi, 2018, PLoS pathogens.

Epidemiology of Colic: Principles for Practice

N. Cohen, 2017 .

Equine epidemiology: counting for something in equine practice.

N. Cohen, 2011 .

Play-Doh and water-soaked gauze sponges as alternative bolus material for cobalt-60 teletherapy.

Daniel I. Menchaca, N. Cohen, M. Walker, 2005, Veterinary Radiology & Ultrasound.

Factors influencing pre-race serum concentration of total carbon dioxide in Thoroughbred horses racing in California.

N. Cohen, S. Stanley, R. Arthur, 2006, Equine Veterinary Journal.

Effects of Administration of Live or Inactivated Virulent Rhodococccus equi and Age on the Fecal Microbiome of Neonatal Foals

S. Pillai, S. Dowd, N. Cohen, 2013, PloS one.

Wound swabs versus biopsies to detect methicillin resistant Staphylococcus aureus in experimental equine wounds.

N. Cohen, E. Cosgriff-Hernandez, S. Lawhon, 2022, Veterinary surgery : VS.

Differences in the genome, methylome, and transcriptome do not differentiate isolates of Streptococcus equi subsp. equi from horses with acute clinical signs from isolates of inapparent carriers

N. Cohen, A. Aspán, M. Riihimäki, 2021, PloS one.

Tendonitis of the deep digital flexor tendon in 78 horses.

N. Cohen, R. Dabareiner, T. Swor, 2004 .

Guinea pig infection with the intracellular pathogen Rhodococcus equi.

N. Cohen, J. Cirillo, L. Gressler, 2016, Veterinary Microbiology.

Evaluation of equine breeding farm management and preventative health practices as risk factors for development of Rhodococcus equi pneumonia in foals.

N. Cohen, M. Chaffin, R. Martens, 2003, Journal of the American Veterinary Medical Association.

Statistical Evaluation of the Regulatory Guidelines for Use of Furosemide in Race Horses

K K Chu, N Wang, S Stanley, 2001, Biometrics.

A Thoroughbred racehorse with a unicortical palmar lateral condylar fracture returned to training 14 days after surgery: a hypothesis on the role of a single bone screw on crack propagation

J. J. Mecholsky, N. Cohen, J. Vogler, 2019, Journal of equine science.

Genomic imprinting does not reduce the dosage of UBE3A in neurons

N. Cohen, Ryan N. Doan, Xu Wang, 2017, Epigenetics & Chromatin.

In vitro evaluation of complement deposition and opsonophagocytic killing of Rhodococcus equi mediated by poly‐N‐acetyl glucosamine hyperimmune plasma compared to commercial plasma products

N. Cohen, G. Pier, C. Cywes-Bentley, 2019, Journal of veterinary internal medicine.

Control and prevention of Rhodococcus equi foal pneumonia.

N. Cohen, W. Moyer, 2010 .

Evaluation of 5 serologic assays to detect Rhodococcus equi pneumonia in foals.

N. Cohen, M. Chaffin, S. Takai, 2002, Journal of the American Veterinary Medical Association.

Investigation into intraoral approach for nerve block injection at the mental foramen in the horse

N. Cohen, C. Griffin, S. Marx, 2019 .

Immunoassay for detection of feline immunodeficiency virus core antigen

N. Cohen, C. Seymour, Q. Tonelli, 1990, Journal of clinical microbiology.

Persistent thrombocytopenia in a case of equine infectious anemia.

N. Cohen, G. K. Carter, 1991, Journal of the American Veterinary Medical Association.

Application and machine accuracy of a new frameless computed tomography-guided stereotactic brain biopsy system in dogs.

N. Cohen, J. Griffin, J. Levine, 2013, Veterinary radiology & ultrasound : the official journal of the American College of Veterinary Radiology and the International Veterinary Radiology Association.

Emergence of Resistance to Macrolides and Rifampin in Clinical Isolates of Rhodococcus equi from Foals in Central Kentucky, 1995 to 2017

N. Cohen, C. Carter, S. Giguère, 2018, Antimicrobial Agents and Chemotherapy.

Fitness cost conferred by the novel erm(51) and rpoB mutation on environmental multidrug resistant-Rhodococcus equi.

S. Sinha, N. Cohen, L. Huber, 2022, Veterinary microbiology.

A Common Practice of Widespread Antimicrobial Use in Horse Production Promotes Multi-Drug Resistance

N. Cohen, S. Giguère, N. Slovis, 2020, Scientific Reports.

Segmental ischemic necrosis of the small intestine in two postparturient mares.

N. Cohen, L. Crossland, T. S. Ford, 1993, Journal of the American Veterinary Medical Association.

Equine bronchial epithelial cells are susceptible to cell entry with a SARS-CoV-2 pseudovirus but reveal low replication efficiency.

N. Oezguen, N. Cohen, J. Pollet, 2023, American Journal of Veterinary Research.

Infection of equine bronchial epithelial cells with a SARS-CoV-2 pseudovirus

N. Oezguen, N. Cohen, J. Pollet, 2023, bioRxiv.