C. Galmarini

发表

p53 as a target for anti-cancer drug development.

B. Bouchet, C. Caron de Fromentel, A. Puisieux, 2006, Critical reviews in oncology/hematology.

Survivorship in untreated breast cancer patients

C. Galmarini, O. Trédan, F. Galmarini, 2015, Medical Oncology.

Original Article Expression of XPG protein in human normal and tumor tissues

Luis García Fernández, C. Galmarini, M. Aracil, 2013 .

Drug resistance and the solid tumor microenvironment.

I. Tannock, C. Galmarini, O. Trédan, 2007, Journal of the National Cancer Institute.

Acknowledgement

D. Busch, H. Einsele, M. Dhodapkar, 1987, Hearing Research.

Lessons from Hippocrates: Time to Change the Cancer Paradigm

C. Galmarini, 2020, International journal of chronic diseases.

C. Galmarini, C. Dumontet, L. Jordheim, 2004, Leukemia & lymphoma.

CD8 Expression in a Case of Chronic Lymphocytic Leukemia with Trisomy 12

C. Galmarini, Christian Chena, I. Slavutsky, 2000, Acta Haematologica.

Weekly administration of paclitaxel induces long-term aneugenicity in nude mice

B. Bouchet, A. Puisieux, C. Galmarini, 2007, Cancer biology & therapy.

Role of macrophage targeting in the antitumor activity of trabectedin.

M. Zucchetti, P. Allavena, A. Mantovani, 2013, Cancer cell.

Dual inhibition of ATR and ATM potentiates the activity of trabectedin and lurbinectedin by perturbing the DNA damage response and homologous recombination repair

A. Escargueil, C. Galmarini, J. Henriques, 2016, Oncotarget.

βIII-Tubulin is required for interphase microtubule dynamics in untransformed human mammary epithelial cells.

B. Bouchet, A. Puisieux, C. Galmarini, 2011, European journal of cell biology.

Synthesis and antiproliferative evaluation of pyrazolo[1,5-a]-1,3,5-triazine myoseverin derivatives.

C. Galmarini, F. Kozielski, F. Popowycz, 2009, Bioorganic & medicinal chemistry.

Lurbinectedin reduces tumour-associated macrophages and the inflammatory tumour microenvironment in preclinical models

P. Allavena, A. Mantovani, C. Galmarini, 2017, British Journal of Cancer.

Dynamic cellular maps of molecular species: Application to drug-target interactions

C. Galmarini, J. F. Martínez-Leal, M. Lillo, 2018, Scientific Reports.

ROBUST COVID-19-RELATED CONDITION CLASSIFICATION NETWORK

C. Galmarini, M. Lucius, M. Belvisi, 2020, medRxiv.

ATLANTIS: a Phase III study of lurbinectedin/doxorubicin versus topotecan or cyclophosphamide/doxorubicin/vincristine in patients with small-cell lung cancer who have failed one prior platinum-containing line.

L. Paz-Ares, C. Galmarini, A. Farago, 2019, Future oncology.

MI130004, a Novel Antibody–Drug Conjugate Combining Trastuzumab with a Molecule of Marine Origin, Shows Outstanding In Vivo Activity against HER2-Expressing Tumors

C. Galmarini, J. F. Martínez-Leal, S. Munt, 2018, Molecular Cancer Therapeutics.

c-Jun N-Terminal Kinase Phosphorylation Is a Biomarker of Plitidepsin Activity

C. Galmarini, M. Pollán, A. Muñoz, 2013, Marine drugs.

New interfacial microtubule inhibitors of marine origin, PM050489/PM060184, with potent antitumor activity and a distinct mechanism.

I. Barasoain, C. Galmarini, M. Peñalva, 2013, ACS chemical biology.

Pyrimidine nucleoside analogs in cancer treatment

C. Galmarini, C. Dumontet, L. Jordheim, 2003, Expert review of anticancer therapy.

Drug resistance associated with loss of p53 involves extensive alterations in microtubule composition and dynamics

V. Hervieu, A. Puisieux, C. Galmarini, 2003, British Journal of Cancer.

Aplidin (plitidepsin) is a novel anti-myeloma agent with potent anti-resorptive activity mediated by direct effects on osteoclasts

C. Galmarini, G. Roodman, N. Kurihara, 2019, Oncotarget.

Hypoxia Reduces the Efficiency of Elisidepsin by Inhibiting Hydroxylation and Altering the Structure of Lipid Rafts

J. Szöllősi, C. Galmarini, R. Rühl, 2013, Marine drugs.

Indolobenzazepin-7-ones and 6-, 8-, and 9-membered ring derivatives as tubulin polymerization inhibitors: synthesis and structure--activity relationship studies.

C. Galmarini, F. Kozielski, Q. Do, 2009, Journal of medicinal chemistry.

Resistance to gemcitabine in a human follicular lymphoma cell line is due to partial deletion of the deoxycytidine kinase gene

J. Mackey, C. Galmarini, C. Dumontet, 2004, BMC pharmacology.

Expression of a non‐functional p53 affects the sensitivity of cancer cells to gemcitabine

J. Mackey, A. Puisieux, C. Galmarini, 2002, International journal of cancer.

Increased expression of the large subunit of ribonucleotide reductase is involved in resistance to gemcitabine in human mammary adenocarcinoma cells

C. Galmarini, C. Dumontet, L. Jordheim, 2005, Molecular Cancer Therapeutics.

Characterization of a Gemcitabine-Resistant Murine Leukemic Cell Line

J. Mackey, C. Galmarini, C. Dumontet, 2004, Clinical Cancer Research.

F-ara-AMP is a substrate of cytoplasmic 5′-nucleotidase II (cN-II): HPLC and NMR studies of enzymatic dephosphorylation

C. Galmarini, C. Dumontet, L. Jordheim, 2006, Nucleosides, nucleotides & nucleic acids.

Efficient overcoming of drug resistance to anticancer nucleoside analogs by nanodelivery of active phosphorylated drugs.

C. Galmarini, S. Vinogradov, G. Warren, 2010, International journal of pharmaceutics.

What does over-expression of cN-II enzyme signify in haematological malignancies?

C. Galmarini, 2007, Leukemia research.

Role of IMP-SELECTIVE 5′-NUCLEOTIDASE (cN-II) in HEMATOLOGICAL MALIGNANCIES

C. Galmarini, C. Dumontet, L. Jordheim, 2003, Leukemia & lymphoma.

Analysis of transcriptomic responses to SARS-CoV-2 reveals plausible defective pathways responsible for increased susceptibility to infection and complications and helps to develop fast-track repositioning of drugs against COVID-19

Enrique J. deAndrés-Galiana, A. Kloczkowski, J. Fernández-Martínez, 2022, Computers in Biology and Medicine.

Substrate cycles and drug resistance to 1-beta-D-arabinofuranosylcytosine (araC)

C. Galmarini, C. Dumontet, L. Jordheim, 2005, Leukemia & lymphoma.

Unique features of trabectedin mechanism of action

C. Galmarini, M. D’Incalci, A. Larsen, 2016, Cancer Chemotherapy and Pharmacology.

The Activity of the Lipophilic Nucleoside Derivatives Elacytarabine and CP-4126 in a Panel of Tumor Cell Lines Resistant to Nucleoside Analogues

G. Peters, C. Galmarini, M. Sandvold, 2010, Nucleosides, nucleotides & nucleic acids.

Comparison of in vitro and in vivo biological effects of trabectedin, lurbinectedin (PM01183) and Zalypsis® (PM00104)

P. Allavena, C. Galmarini, M. D’Incalci, 2013, International journal of cancer.

Molecular pharmacology and antitumor activity of Zalypsis in several human cancer cell lines.

Juan A. Bueren-Calabuig, J. Bueren-Calabuig, F. Gago, 2009, Biochemical pharmacology.

Correlation of hENT1 expression and function with gemcitabine cytotoxicity in mantle cell lymphoma lines and clinical samples.

C. Galmarini, 2006, Haematologica.

A Review of Trabectedin (ET-743): A Unique Mechanism of Action

C. Galmarini, M. D’Incalci, 2010, Molecular Cancer Therapeutics.

Inhibitory effects of marine‐derived DNA‐binding anti‐tumour tetrahydroisoquinolines on the Fanconi anaemia pathway

F. Gago, C. Galmarini, J. Bueren, 2013, British journal of pharmacology.

PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti‐tumour activity

Juan A. Bueren-Calabuig, J. Bueren-Calabuig, F. Gago, 2010, British journal of pharmacology.

hanism of Action

C. Galmarini, D'Incalci, 2010 .

Actionof Trabectedin (ET-743): A Unique Mechanism of

C. Galmarini, M. D’Incalci, 2010 .

Action A Review of Trabectedin ( ET-743 ) : A Unique Mechanism of Updated

C. Galmarini, M. D’Incalci, 2010 .

eview of Trabectedin ( ET-743 ) : A Unique Ther hanism of Action zio

C. Galmarini, D'Incalci, 2010 .

PM060184, a new tubulin binding agent with potent antitumor activity including P-glycoprotein over-expressing tumors.

I. Barasoain, B. Bouchet, C. Galmarini, 2014, Biochemical pharmacology.

dCK for: aaa cct gaa cga tgg tct ttt tac c 5'-Fam-caa aca tat gcc tgt ctc agt rev: ctt tga gct tgc cat tca gag a cga ata aga gct c-Tamra UMP/ for: gggcatattctttgcttcca SYBR Green CMP-K rev: tgcatttcaaggttccactg

C. Galmarini, C. Dumontet, X. Thomas, 2005 .

The prognostic value of cN-II and cN-III enzymes in adult acute myeloid leukemia.

C. Galmarini, C. Dumontet, X. Thomas, 2005, Haematologica.

Potential mechanisms of resistance to cytarabine in AML patients.

C. Galmarini, C. Dumontet, X. Thomas, 2002, Leukemia research.

Does p16ink4a expression increase with the number of cell doublings in normal and malignant lymphocytes?

C. Galmarini, Y. Bertrand, M. Ffrench, 2007, Leukemia research.

Ecteinascidin-743 (Yondelis®), Aplidin®, and Irvalec®

C. Galmarini, S. Munt, P. Avilés, 2011 .

Predictive Factors of Sensitivity to Elisidepsin, a Novel Kahalalide F-Derived Marine Compound

I. Bièche, E. Raymond, C. Galmarini, 2013, Marine drugs.

Antiproliferative effects of sapacitabine (CYC682), a novel 2′-deoxycytidine-derivative, in human cancer cells

E. Raymond, C. Galmarini, S. Faivre, 2007, British Journal of Cancer.

Translation Elongation Factor eEF1A2 is a Novel Anticancer Target for the Marine Natural Product Plitidepsin

F. Gago, C. Galmarini, J. F. Martínez-Leal, 2016, Scientific Reports.

Influence of p53 and p21(WAF1) expression on sensitivity of cancer cells to cladribine.

A. Puisieux, C. Galmarini, N. Falette, 2003, Biochemical pharmacology.

A p21/WAF1 mutation favors the appearance of drug resistance to paclitaxel in human noncancerous epithelial mammary cells

B. Bouchet, A. Puisieux, C. Galmarini, 2006, International journal of cancer.

Frameshift mutation in the Dok1 gene in chronic lymphocytic leukemia

C. Galmarini, C. Dumontet, François Roy, 2004, Oncogene.

Immortalized Epstein-Barr virus-positive B-cell lines obtained by prolonged culture of peripheral blood mononuclear cells from human immunodeficiency virus type 1-positive patients.

C. Galmarini, M. F. Palacios, P. Baré, 2001, Journal of human virology.

Recent developments to improve the efficacy of cytotoxic nucleoside analogues.

C. Galmarini, C. Dumontet, L. Jordheim, 2006, Recent patents on anti-cancer drug discovery.

Concomitant resistance and early-breast cancer: should we change treatment strategies?

C. Galmarini, O. Trédan, F. Galmarini, 2014, Cancer and Metastasis Reviews.

The mechanism of action of plitidepsin.

C. Galmarini, T. Martínez, A. Muñoz, 2009, Current opinion in investigational drugs.

Multidrug resistance in cancer therapy: role of the microenvironment.

C. Galmarini, F. Galmarini, 2003, Current opinion in investigational drugs.

Synthesis and antiproliferative activity of clausine E, mukonine, and koenoline bioisosteres.

C. Galmarini, F. Popowycz, T. Besson, 2007, Bioorganic & medicinal chemistry.

Nucleoside analogues and nucleobases in cancer treatment.

J. Mackey, C. Galmarini, C. Dumontet, 2002, The Lancet. Oncology.

Trabectedin, a drug acting on both cancer cells and the tumour microenvironment

P. Allavena, C. Galmarini, M. D’Incalci, 2014, British Journal of Cancer.

XPF-dependent DNA breaks and RNA polymerase II arrest induced by antitumor DNA interstrand crosslinking-mimetic alkaloids.

Juan A. Bueren-Calabuig, J. Bueren-Calabuig, F. Gago, 2011, Chemistry & biology.

Molecular basis of resistance to the microtubule-depolymerizing antitumor compound plocabulin

C. Galmarini, M. Peñalva, Areti Pantazopoulou, 2018, Scientific Reports.

Cytotoxic nucleoside analogues: different strategies to improve their clinical efficacy.

C. Galmarini, F. Popowycz, B. Joseph, 2008, Current medicinal chemistry.

In vivo mechanisms of resistance to cytarabine in acute myeloid leukaemia

C. Galmarini, C. Dumontet, X. Thomas, 2002, British journal of haematology.

Gemcitabine resistance due to deoxycytidine kinase deficiency can be reverted by fruitfly deoxynucleoside kinase, DmdNK, in human uterine sarcoma cells

C. Galmarini, C. Dumontet, L. Jordheim, 2006, Cancer Chemotherapy and Pharmacology.

Cancer chemotherapy: a critical analysis of its 60 years of history.

Carlos M Galmarini, C. Galmarini, F. Galmarini, 2012, Critical reviews in oncology/hematology.

CP‐4055 and CP‐4126 are active in ara‐C and gemcitabine‐resistant lymphoma cell lines

C. Galmarini, M. Sandvold, F. Myhren, 2009, British journal of haematology.

Polymeric nanogels containing the triphosphate form of cytotoxic nucleoside analogues show antitumor activity against breast and colorectal cancer cell lines

C. Galmarini, E. Kohli, S. Vinogradov, 2008, Molecular Cancer Therapeutics.

Expression of high Km 5'-nucleotidase in leukemic blasts is an independent prognostic factor in adults with acute myeloid leukemia.

J. Mackey, C. Galmarini, C. Dumontet, 2001, Blood.

Mode of action of trabectedin in myxoid liposarcomas

C M Galmarini, M D'Incalci, F. Grosso, 2014, Oncogene.

Multicenter Phase II Study of Lurbinectedin in BRCA-Mutated and Unselected Metastatic Advanced Breast Cancer and Biomarker Assessment Substudy

J. Baselga, J. Garber, N. Tung, 2018, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Inactivation of wild-type p53 by a dominant negative mutant renders MCF-7 cells resistant to tubulin-binding agent cytotoxicity

A. Puisieux, C. Galmarini, N. Falette, 2001, British Journal of Cancer.

Abstract C93: Collateral sensitivity to cisplatin of trabectedin-resistant cell lines.

C. Galmarini, M. D’Incalci, E. Erba, 2013 .

Antitumor and anti-inflammatory effects of trabectedin on human myxoid liposarcoma cells.

P. Allavena, A. Mantovani, F. Grosso, 2010, Cancer research.

Lurbinectedin Specifically Triggers the Degradation of Phosphorylated RNA Polymerase II and the Formation of DNA Breaks in Cancer Cells

C. Galmarini, J. F. Martínez-Leal, J. Egly, 2016, Molecular Cancer Therapeutics.

Mutational Targets in Colorectal Cancer Cells with Microsatellite Instability

A. Puisieux, C. Galmarini, Qing Wang, 2005, Familial Cancer.

Correction: The PARP inhibitor olaparib enhances the sensitivity of Ewing sarcoma to trabectedin

J. Mora, C. Teodosio, D. Herrero-Martín, 2017, OncoTarget.

In vitro susceptibility of CD4+ and CD8+ T cell subsets to fludarabine.

C. Galmarini, C. Dumontet, L. Jordheim, 2003, Biochemical pharmacology.

Synergistic Effect of Trabectedin and Olaparib Combination Regimen in Breast Cancer Cell Lines

C. Galmarini, L. García-Fernández, Sonia Ávila-Arroyo, 2015, Journal of breast cancer.

Correction: The PARP inhibitor olaparib enhances the sensitivity of Ewing sarcoma to trabectedin

J. Mora, C. Teodosio, D. Herrero-Martín, 2017, Oncotarget.

p21(Cip1) regulates cell-substrate adhesion and interphase microtubule dynamics in untransformed human mammary epithelial cells.

A. Puisieux, C. Galmarini, F. Fauvet, 2011, European journal of cell biology.

Artificial intelligence: a disruptive tool for a smarter medicine.

C M Galmarini, M Lucius, C. Galmarini, 2020, European review for medical and pharmacological sciences.

Heterogeneous Distribution of Tumor Blood Supply Affects the Response to Chemotherapy in Patients with Head and Neck Cancer

C. Galmarini, F. Galmarini, D. Galmarini, 2000, Microcirculation.

P-glycoprotein expression by cancer cells affects cell cytotoxicity and cell-cycle perturbations induced by six chemotherapeutic drugs.

C. Galmarini, 2002, Journal of experimental therapeutics & oncology.

Phase II randomized study of PM01183 versus topotecan in patients with platinum-resistant/refractory advanced ovarian cancer

I. Ray-Coquard, C. Galmarini, D. Berton‐Rigaud, 2017, Annals of oncology : official journal of the European Society for Medical Oncology.

Lurbinectedin Inactivates the Ewing Sarcoma Oncoprotein EWS-FLI1 by Redistributing It within the Nucleus.

Joseph T. Roland, G. Hostetter, L. Turner, 2016, Cancer research.

Lurbinectedin inactivates the Ewing sarcoma oncoprotein EWS-FLI 1 by redistributing it within the nucleus Running Title : Lurbinectedin inhibits EWS-FLI 1 to promote differentiation

Joseph T. Roland, G. Hostetter, C. Galmarini, 2016 .

Trabectedin and Its C Subunit Modified Analogue PM01183 Attenuate Nucleotide Excision Repair and Show Activity toward Platinum-Resistant Cells

A. Escargueil, C. Galmarini, A. Sarasin, 2011, Molecular Cancer Therapeutics.

Trabectedin and Plitidepsin: Drugs from the Sea that Strike the Tumor Microenvironment

P. Allavena, C. Galmarini, M. D’Incalci, 2014, Marine drugs.

Increased sensitivity to platinum drugs of cancer cells with acquired resistance to trabectedin

C. Galmarini, M. D’Incalci, E. Erba, 2015, British Journal of Cancer.

Zalypsis: a novel marine-derived compound with potent antimyeloma activity that reveals high sensitivity of malignant plasma cells to DNA double-strand breaks.

X. Chen, J. Montero, A. Pandiella, 2009, Blood.

Modulation of the human equilibrative nucleoside transporter1 (hENT1) activity by IL-4 and PMA in B cells from chronic lymphocytic leukemia.

C. Galmarini, R. Rosenstein, R. Gamberale, 2008, Biochemical pharmacology.

Deoxycytidine kinase and cN‐II nucleotidase expression in blast cells predict survival in acute myeloid leukaemia patients treated with cytarabine

J. Mackey, C. Galmarini, C. Dumontet, 2003, British journal of haematology.

Nibrin is a marker of clinical outcome in patients with advanced serous ovarian cancer treated in the phase III OVA-301 trial.

B. Monk, C. Galmarini, S. Kaye, 2014, Gynecologic oncology.

Why we do what we do. A brief analysis of cancer therapies

C. Galmarini, 2020, EXCLI journal.

The Antitumor Drugs Trabectedin and Lurbinectedin Induce Transcription-Dependent Replication Stress and Genome Instability

C. Galmarini, A. Aguilera, E. Tumini, 2018, Molecular Cancer Research.

Binding of eEF1A2 to the RNA-dependent protein kinase PKR modulates its activity and promotes tumour cell survival

F. Gago, C. Galmarini, J. F. Martínez-Leal, 2018, British Journal of Cancer.

Expression of XPG protein in human normal and tumor tissues.

Luis García Fernández, C. Galmarini, J. Leal, 2013, International journal of clinical and experimental pathology.

Quantitative analysis of nucleoside transporter and metabolism gene expression in chronic lymphocytic leukemia (CLL): identification of fludarabine-sensitive and -insensitive populations.

J. Mackey, C. Cass, C. Galmarini, 2005, Blood.

Mechanism of action of trabectedin in desmoplastic small round cell tumor cells

S. Pilotti, C. Galmarini, M. D’Incalci, 2017, BMC Cancer.

Fludarabine-sensitive and -insensitive Populations Expression in Chronic Lymphocytic Leukemia (cll): Identification of Quantitative Analysis of Nucleoside Transporter and Metabolism Gene

J. Mackey, C. Cass, C. Galmarini, 2004 .

Title : Quantitative Analysis of Nucleoside Transporter and Metabolism Gene Expression in Chronic Lymphocytic Leukemia ( CLL ) – Identification of fludarabine-sensitive and insensitive populations Short title : Nucleoside transporter and metabolism expression in CLL

J. Mackey, C. Cass, C. Galmarini, 2004 .

Class III β-Tubulin Isotype Predicts Response in Advanced Breast Cancer Patients Randomly Treated Either with Single-Agent Doxorubicin or Docetaxel

D. Larsimont, M. Piccart, F. Cardoso, 2008, Clinical Cancer Research.

Deep Neural Frameworks Improve the Accuracy of General Practitioners in the Classification of Pigmented Skin Lesions

M. Lucius, J. De All, J. A. De All, 2020, medRxiv.

Drug evaluation: the thioredoxin inhibitor PX-12 in the treatment of cancer.

C. Galmarini, 2006, Current opinion in investigational drugs.

Preclinical Development Trabectedin and Its C Subunit Modified Analogue PM 01183 Attenuate Nucleotide Excision Repair and Show Activity toward Platinum-Resistant Cells

A. Escargueil, C. Galmarini, A. Sarasin, 2011 .

Oral ftorafur plus intramuscular thiotepa as adjuvant chemotherapy in patients with breast cancer

C. Galmarini, F. Galmarini, D. Galmarini, 2002, Medical oncology.

Antitumour activity of trabectedin in myelodysplastic/myeloproliferative neoplasms

M. Cazzola, P. Allavena, C. Galmarini, 2017, British Journal of Cancer.

Lurbinectedin induces depletion of tumor-associated macrophages, an essential component of its in vivo synergism with gemcitabine, in pancreatic adenocarcinoma mouse models

M. Hidalgo, P. Allavena, R. Mangues, 2016, Disease Models & Mechanisms.

Sensitization of ara‐C‐resistant lymphoma cells by a pronucleotide analogue

J. Mackey, C. Galmarini, C. Dumontet, 2003, International journal of cancer.

Study of the Efficacy of a Pronucleotide of 2-Chloro-2′-Deoxyadenosine in Deoxycytidine Kinase-Deficient Lymphoma Cells

C. Galmarini, F. Bontemps, J. Balzarini, 2006, Nucleosides, nucleotides & nucleic acids.

DNA Double Strand Breaks Induction by Zalypsis, a Novel Marine Compound, Results in Potent Antimyeloma Activity

E. Álava, J. Miguel, J. Montero, 2008 .

Plocabulin, a novel tubulin-binding agent, inhibits angiogenesis by modulation of microtubule dynamics in endothelial cells

Maud Martin, A. Akhmanova, C. Galmarini, 2018, BMC Cancer.

Temperature-induced melting of double-stranded DNA in the absence and presence of covalently bonded antitumour drugs: insight from molecular dynamics simulations

Juan A. Bueren-Calabuig, J. Bueren-Calabuig, F. Gago, 2011, Nucleic acids research.

334 Aplidin: first in class compound targeting EEF1A in tumor cells

F. Gago, C. Galmarini, L. García-Fernández, 2014 .

502 MI130004, an antibody–drug conjugate including a novel payload of marine origin: Evidences of in vivo activity

C. Galmarini, S. Munt, P. Avilés, 2014 .

345 Interaction of plitidepsin with eEF1A in living tumor cells

C. Galmarini, M. Lillo, A. Losada, 2014 .

58 Pipecolidepsin A, Stellatolide A and Irvalec: New cyclodepsipeptides of marine origin with antitumor activity

C. Galmarini, J. F. Martínez-Leal, V. Moneo, 2014 .

Clinical Outcome and Prognosis of Patients With Inflammatory Breast Cancer

C. Galmarini, F. Galmarini, D. Galmarini, 2002, American journal of clinical oncology.

Sagopilone, a microtubule stabilizer for the potential treatment of cancer.

C. Galmarini, 2009, Current opinion in investigational drugs.

The cytotoxic activity of Aplidin in chronic lymphocytic leukemia (CLL) is mediated by a direct effect on leukemic cells and an indirect effect on monocyte-derived cells

C. Galmarini, P. Nannini, C. Jancic, 2012, Investigational New Drugs.

Elisidepsin Interacts Directly with Glycosylceramides in the Plasma Membrane of Tumor Cells to Induce Necrotic Cell Death

C. Galmarini, J. F. Martínez-Leal, M. Lillo, 2015, PloS one.

Cabazitaxel, a new taxane with favorable properties.

C. Galmarini, B. P. Bouchet, 2010, Drugs of today.

Mechanism of action of trabectedin in desmoplastic small round cell tumor cells

S. Pilotti, C. Galmarini, M. D’Incalci, 2017, BMC Cancer.

Paclitaxel resistance in untransformed human mammary epithelial cells is associated with an aneuploidy-prone phenotype

A. Puisieux, C. Galmarini, N. Falette, 2007, British Journal of Cancer.

5'-(3')-nucleotidase mRNA levels in blast cells are a prognostic factor in acute myeloid leukemia patients treated with cytarabine.

J. Mackey, C. Galmarini, C. Dumontet, 2004, Haematologica.

ErbB protein modifications are secondary to severe cell membrane alterations induced by elisidepsin treatment.

C. Galmarini, G. Vereb, P. Nagy, 2011, European journal of pharmacology.

Irvalec Inserts into the Plasma Membrane Causing Rapid Loss of Integrity and Necrotic Cell Death in Tumor Cells

C. Galmarini, J. F. Martínez-Leal, M. Lillo, 2011, PloS one.

Plocabulin, a novel tubulin-binding agent, inhibits angiogenesis by modulation of microtubule dynamics in endothelial cells

Maud Martin, A. Akhmanova, C. Galmarini, 2018, BMC Cancer.

Editorial: Ageing and Carcinogenesis

C. Galmarini, R. Ruggiero, P. Chiarella, 2022, Frontiers in Oncology.

The PARP inhibitor olaparib enhances the sensitivity of Ewing sarcoma to trabectedin

J. Mora, C. Teodosio, D. Herrero-Martín, 2015, Oncotarget.

Nucleoside analogues: mechanisms of drug resistance and reversal strategies

J. Mackey, C. Galmarini, C. Dumontet, 2001, Leukemia.

Abstract 1284: Lurbinectedin reduces tumor-associated macrophages and the production of inflammatory cytokines, chemokines, and angiogenic factors in preclinical models

P. Allavena, C. Galmarini, M. D’Incalci, 2016 .

Binding of eEF1A2 to the RNA-dependent protein kinase PKR modulates its activity and promotes tumour cell survival

F. Gago, C. Galmarini, M. Muñoz-Alonso, 2018, British Journal of Cancer.

Concomitant resistance and early-breast cancer: should we change treatment strategies?

C. Galmarini, O. Trédan, F. Galmarini, 2013, Cancer and Metastasis Reviews.

Lurbinectedin induces depletion of tumor-associated macrophages, an essential component of its in vivo synergism with gemcitabine, in pancreatic adenocarcinoma mouse models

M. Hidalgo, P. Allavena, R. Mangues, 2016, Disease Models & Mechanisms.

Inhibitory effects of marine‐derived DNA‐binding anti‐tumour tetrahydroisoquinolines on the Fanconi anaemia pathway

F. Gago, C. Galmarini, J. Bueren, 2013, British journal of pharmacology.

fludarabine-sensitive and -insensitive populations expression in chronic lymphocytic leukemia (CLL): identification of Quantitative analysis of nucleoside transporter and metabolism gene

C. Cass, C. Galmarini, D. Glubrecht, 2013 .

Zalypsis has in vitro activity in acute myeloid blasts and leukemic progenitor cells through the induction of a DNA damage response

X. Chen, E. Colado, J. Flores-Montero, 2011, Haematologica.

Zalypsis: a novel marine-derived compound with potent antimyeloma activity that reveals high sensitivity of malignant plasma cells to DNA double-strand breaks.

X. Chen, J. Montero, A. Pandiella, 2009, Blood.