X. Thomas

E. Wattel, X. Thomas, C. Rioufol, 2016, Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation.

High burden of BK virus-associated hemorrhagic cystitis in patients undergoing allogeneic hematopoietic stem cell transplantation

G. Salles, X. Thomas, F. Barraco, 2014, Bone Marrow Transplantation.

A single dose pegfilgrastim for supporting neutrophil recovery in patients treated for high-risk acute myeloid leukemia by the EMA 2000 schedule

X. Thomas, M. Elhamri, F. Barraco, 2010, Hematology.

Dose-escalation study of single dose mitoxantrone in combination with timed sequential chemotherapy in patients with refractory or relapsing acute myelogenous leukemia.

A. Vekhoff, X. Thomas, E. Archimbaud, 2000, Leukemia research.

Mobilization of CD34(+)CD38(-) hematopoietic stem cells after priming in acute myeloid leukemia.

A. Plesa, C. Dumontet, X. Thomas, 2013, World journal of stem cells.

Isolation of Human CD4/CD8 Double-Positive, Graft-Versus-Host Disease–Protective, Minor Histocompatibility Antigen–Specific Regulatory T Cells and of a Novel HLA-DR7–Restricted HY-Specific CD4 Clone

C. Addey, P. Tiberghien, C. Ferrand, 2013, The Journal of Immunology.

Using EasyMatch® to anticipate the identification of an HLA identical unrelated donor: A validated efficient time and cost saving method.

X. Thomas, Y. Bertrand, F. Barraco, 2016, Human immunology.

Late autologous transplantation in chronic myelogenous leukemia with peripheral blood progenitor cells mobilized by G-CSF and interferon-α

C. Vigouroux, C. Dumontet, X. Thomas, 2000, Leukemia.

Clofarabine Improves Relapse-Free Survival of Acute Myeloid Leukemia in Younger Adults with Micro-Complex Karyotype

H. Dombret, C. Preudhomme, X. Thomas, 2019, Cancers.

All trans retinoic acid in combination with intermediate-dose cytarabine and idarubicin in patients with relapsed or refractory non promyelocytic acute myeloid leukemia: a phase II randomized trial.

H. Dombret, A. Vekhoff, E. Wattel, 2002, The hematology journal : the official journal of the European Haematology Association.

Effect of priming with granulocyte–macrophage colony-stimulating factor in younger adults with newly diagnosed acute myeloid leukemia: a trial by the Acute Leukemia French Association (ALFA) Group

J. Bourhis, H. Dombret, B. Quesnel, 2007, Leukemia.

Oncogene- and drug resistance-associated alternative exon usage in acute myeloid leukemia (AML)

D. Auboeuf, M. Thénoz, E. Wattel, 2015, Oncotarget.

Chromatin redistribution of the DEK oncoprotein represses hTERT transcription in leukemias.

M. Thénoz, E. Wattel, X. Thomas, 2014, Neoplasia.

Telomere deregulations possess cytogenetic, phenotype, and prognostic specificities in acute leukemias.

E. Gilson, E. Wattel, C. Preudhomme, 2011, Experimental hematology.

Hypermethylation of calcitonin gene in adult acute leukemia at diagnosis and during complete remission.

J. Magaud, R. Rimokh, X. Thomas, 1999, Hematology and cell therapy.

Impact of anti-HLA antibodies on allogeneic hematopoietic stem cell transplantation outcomes after reduced-intensity conditioning regimens.

X. Thomas, F. Barraco, F. Nicolini, 2012, Experimental hematology.

Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype.

J. Cayuela, H. Dombret, C. Preudhomme, 2005, Blood.

Acute Myeloid Leukemia in the Elderly Patient: New Strategies

X. Thomas, Xavier Thomas, Xavier Thomas, 2015, Rare Cancers and Therapy.

Hydroxycarbamine: from an Old Drug Used in Malignant Hemopathies to a Current Standard in Sickle Cell Disease

X. Thomas, G. Cannas, S. Poutrel, 2017, Mediterranean journal of hematology and infectious diseases.

Treatment of Elderly Patients With Acute Myeloid Leukemia

X. Thomas, C. Le Jeune, 2017, Current Treatment Options in Oncology.

Cigarette Smoking and Acute Leukemia

X. Thomas, Y. Chelghoum, 2004, Leukemia & lymphoma.

Clinical and biological characteristics of adult de novo and secondary acute myeloid leukemia with balanced 11q23 chromosomal anomaly or MLL gene rearrangement compared to cases with unbalanced 11q23 anomaly: confirmation of the existence of different entities with 11q23 breakpoint

J. Magaud, R. Rimokh, X. Thomas, 1998, Leukemia.

Understanding leukemic hematopoiesis as a complex adaptive system.

X. Thomas, 2015, World journal of stem cells.

Running head: TIPIFARNIB IN REFRACTORY OR RELAPSED AML

J. Reiffers, J. Lancet, X. Thomas, 2007 .

Brief Report Results and Discussion

H. Dombret, C. Bastard, C. Preudhomme, 2022 .

Fractionated gemtuzumab ozogamicin combined with intermediate-dose cytarabine and daunorubicin as salvage therapy in very high-risk AML patients: a bridge to reduced intensity conditioning transplant?

G. Salles, A. Plesa, E. Wattel, 2017, Annals of Hematology.

Invasive aspergillosis: an important risk factor on the short- and long-term survival of acute myeloid leukemia (AML) patients

P. Vanhems, X. Thomas, F. Persat, 2011, European Journal of Clinical Microbiology & Infectious Diseases.

Comparison of high-dose cytarabine and timed-sequential chemotherapy as consolidation for younger adults with AML in first remission: the ALFA-9802 study.

J. Bourhis, H. Dombret, B. Quesnel, 2011, Blood.

Minimally differentiated acute myeloid leukemia (FAB AML-M0): prognostic factors and treatment effects on survival--a retrospective study of 42 adult cases.

A. Plesa, C. Dumontet, X. Thomas, 2011, Leukemia research.

A single dose of pegfilgrastim compared with daily filgrastim for supporting neutrophil recovery in patients treated for low-to-intermediate risk acute myeloid leukemia: results from a randomized, double-blind, phase 2 trial

R. Herrmann, J. Sierra, J. Szer, 2008, BMC Cancer.

Salvage therapy in refractory acute myeloid leukemia: prediction of outcome based on analysis of prognostic factors.

X. Thomas, M. Elhamri, Q. Le, 2003, Leukemia research.

Impact of additional genetic alterations on the outcome of patients with NPM1-mutated cytogenetically normal acute myeloid leukemia

J. Cayuela, H. Dombret, C. Preudhomme, 2014, Haematologica.

Quantification of EVI1 transcript levels in acute myeloid leukemia by RT-qPCR analysis: A study by the ALFA Group.

H. Dombret, B. Quesnel, C. Preudhomme, 2015, Leukemia research.

Prospective multicentric molecular study for poor prognosis fusion transcripts at diagnosis in adult B-lineage ALL patients: the LALA 94 experience

H. Dombret, E. Macintyre, T. Fest, 2006, Leukemia.

High-dose imatinib mesylate combined with vincristine and dexamethasone (DIV regimen) as induction therapy in patients with resistant Philadelphia-positive acute lymphoblastic leukemia and lymphoid blast crisis of chronic myeloid leukemia

H. Dombret, X. Thomas, C. Récher, 2006, Leukemia.

Chronic Myeloid Leukemia The role of the K 247 R substitution in the ABL tyrosine kinase domain in sensitivity to imatinib

X. Thomas, P. Rousselot, F. Nicolini, 2006 .

Identification of a rare e6a2 BCR-ABL fusion gene during the disease progression of chronic myelomonocytic leukemia: a case report

X. Thomas, S. Hayette, I. Tigaud, 2004, Leukemia.

Spatially divergent clonal evolution in multiple myeloma: overcoming resistance to BRAF inhibition

H. Dombret, C. Preudhomme, X. Thomas, 2016 .

Results from a randomized phase III trial of decitabine versus supportive care or low-dose cytarabine for the treatment of older patients with newly diagnosed AML.

H. Kantarjian, F. Ravandi, X. Thomas, 2011, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Multicenter randomized phase II trial of idarubicin vs mitoxantrone, combined with VP-16 and cytarabine for induction/consolidation therapy, followed by a feasibility study of autologous peripheral blood stem cell transplantation in elderly patients with acute myeloid leukemia

R. Willemze, X. Thomas, E. Archimbaud, 1999, Leukemia.

Timed sequential chemotherapy for previously treated patients with acute myeloid leukemia: long-term follow-up of the etoposide, mitoxantrone, and cytarabine-86 trial.

P. Fenaux, X. Thomas, X. Troussard, 1995, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Impact of pre-induction therapy leukapheresis on treatment outcome in adult acute myelogenous leukemia presenting with hyperleukocytosis

X. Thomas, A. Thiébaut, E. Archimbaud, 2000, Annals of Hematology.

New emerging applications of molgramostim in acute myeloid leukaemia

X. Thomas, 2008 .

The role of timed sequential chemotherapy in adult acute myelogenous leukemia

X. Thomas, 2008, Current hematologic malignancy reports.

Autologous or allogeneic stem cell transplantation as post-remission therapy in refractory or relapsed acute myeloid leukemia after highly intensive chemotherapy

H. Dombret, A. Vekhoff, P. Fenaux, 2005, Leukemia & lymphoma.

Salvage by timed sequential chemotherapy in primary resistant acute myeloid leukemia: analysis of prognostic factors

X. Thomas, M. Elhamri, Q. Le, 2003, Annals of Hematology.

Autologous Stem Cell Transplantation in Acute Promyelocytic Leukemia Patients Achieving a Second Complete Remission

H. Dombret, A. Vekhoff, P. Fenaux, 2000 .

Potential anti-leukemic activity of iron chelation after allogeneic hematopoietic stem cell transplantation in patients with acute myeloid leukemia

X. Thomas, F. Barraco, F. Nicolini, 2017, Leukemia and Lymphoma.

Is there a role for all-trans retinoic acid in combination with recombinant erythropoetin in myelodysplastic syndromes? A report on 59 cases

A. Stamatoullas, P. Fenaux, L. Adès, 2009, Leukemia.

Bone Marrow Necrosis in Newly Diagnosed Acute Leukemia: Two Case Reports and Review of the Literature

G. Salles, A. Plesa, X. Thomas, 2017, Oncology and Therapy.

Allogeneic stem cell transplantation in second rather than first complete remission in selected patients with good-risk acute myeloid leukemia

H. Dombret, H. Tilly, C. Bastard, 2005, Bone Marrow Transplantation.

Influence of increased body mass index on drug toxicity in patients with acute promyelocytic leukemia

X. Thomas, E. Archimbaud, D. Fière, 1998, Leukemia.

Continuous-infusion daunorubicin and carboplatin for high-risk acute myeloid leukemia in the elderly.

C. Sebban, X. Thomas, E. Archimbaud, 1992, Leukemia.

dCK for: aaa cct gaa cga tgg tct ttt tac c 5'-Fam-caa aca tat gcc tgt ctc agt rev: ctt tga gct tgc cat tca gag a cga ata aga gct c-Tamra UMP/ for: gggcatattctttgcttcca SYBR Green CMP-K rev: tgcatttcaaggttccactg

C. Galmarini, C. Dumontet, X. Thomas, 2005 .

The prognostic value of cN-II and cN-III enzymes in adult acute myeloid leukemia.

C. Galmarini, C. Dumontet, X. Thomas, 2005, Haematologica.

The preclinical discovery of vosaroxin for the treatment of acute myeloid leukemia

X. Thomas, E. Paubelle, F. Zylbersztejn, 2017, Expert opinion on drug discovery.

Treatment with Low-Dose Cytarabine in Elderly Patients (Age 70 Years or Older) with Acute Myeloid Leukemia: A Single Institution Experience

G. Salles, A. Plesa, E. Wattel, 2016, Mediterranean journal of hematology and infectious diseases.

Effect of Age on Treatment Decision-Making in Elderly Patients With Acute Myeloid Leukemia.

A. Plesa, E. Wattel, X. Thomas, 2015, Clinical lymphoma, myeloma & leukemia.

A post hoc sensitivity analysis of survival probabilities in a multinational phase III trial of decitabine in older patients with newly diagnosed acute myeloid leukemia.

H. Kantarjian, X. Thomas, J. Delaunay, 2014, Clinical lymphoma, myeloma & leukemia.

Autologous hematopoietic stem cell transplantation for adults with acute myeloid leukemia in complete remission: The Edouard Herriot hospital experience

X. Thomas, M. Elhamri, A. Thiébaut, 2006, Hematology.

Lyon-University Hospital Experience with Gemtuzumab Ozogamicin Therapy in Acute Myeloid Leukemia: a ‘Real-Life’ Study

G. Salles, E. Wattel, X. Thomas, 2020, Mediterranean journal of hematology and infectious diseases.

Acute myeloid leukemia in the elderly (age 70 yr or older): long‐term survivors

G. Salles, E. Wattel, X. Thomas, 2017, European journal of haematology.

In vitro effects of recombinant hemopoietic growth factors on progenitor cells from patients with myelodysplastic syndromes.

X. Thomas, L. Campos, D. Guyotat, 1991, Leukemia research.

A Phase II Study of Post–Remission Therapy with Azacitidine (AZA) in Patients with AML Post-MDS and High-Risk MDS: A GFM Group Study.

H. Dombret, S. Chevret, P. Fenaux, 2009 .

Another pedigree with familial acute myeloid leukemia and germline CEBPA mutation

C. Preudhomme, X. Thomas, Y. Bertrand, 2009, Leukemia.

5LBA Results of a first-in-man phase I trial assessing OTX015, an orally available BET-bromodomain (BRD) inhibitor, in advanced hematologic malignancies

A. Palumbo, H. Dombret, B. Quesnel, 2014 .

Long-term follow-up of the imatinib GRAAPH-2003 study in newly diagnosed patients with de novo Philadelphia chromosome-positive acute lymphoblastic leukemia: a GRAALL study.

J. Cayuela, H. Dombret, A. Delannoy, 2013, Biology of Blood and Marrow Transplantation.

Dasatinib (Sprycel®) and Low Intensity Chemotherapy for First-Line Treatment In Elderly Patients with De Novo Philadelphia Positive ALL (EWALL-PH-01): Kinetic of Response, Resistance and Prognostic Significance

J. Cayuela, H. Dombret, A. Delannoy, 2010 .

Long-Term Results of the Imatinib GRAAPH-2003 Study in Newly-Diagnosed Patients with De Novo Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia

J. Cayuela, H. Dombret, E. Macintyre, 2009 .

Impact on outcome of MRD prior hematopoietic stem cell transplantation after FLAMSA-busulfan conditioning regimen: a retrospective monocentric study.

A. Plesa, X. Thomas, S. Hayette, 2022, Transplantation and cellular therapy.

Prognostic Value of Immunophenotyping in Elderly Patients with Acute Myeloid Leukemia: A Single Institution Experience.

A. Plesa, C. Dumontet, X. Thomas, 2007 .

The level of blast CD33 expression positively impacts the effect of gemtuzumab ozogamicin in patients with acute myeloid leukemia.

H. Dombret, A. Plesa, C. Preudhomme, 2016, Blood.

Mutational profile and benefit of gemtuzumab ozogamicin in acute myeloid leukemia patients treated in the ALFA0701 trial.

H. Dombret, C. Preudhomme, X. Thomas, 2019, Blood.

Outcome of treatment after first relapse in younger adults with acute myeloid leukemia initially treated by the ALFA-9802 trial.

J. Bourhis, H. Dombret, B. Quesnel, 2012, Leukemia research.

Blinatumomab in acute lymphoblastic leukemia

X. Thomas, C. Lejeune, 2016, Expert review of anticancer therapy.

Chemotherapy of acute leukemia in adults

X. Thomas, 2009, Expert opinion on pharmacotherapy.

Central nervous system involvement in adult acute lymphoblastic leukemia

X. Thomas, Q. Le, 2008, Hematology.

Alisertib: a new option for acute myeloid leukaemia.

X. Thomas, 2019, The Lancet. Haematology.

Is There a Role for ATRA in Combination to EPO in Lower Risk Myelodysplastic Syndrome? Preliminary Results of a Phase II Study.

A. Stamatoullas, P. Fenaux, L. Adès, 2005 .

Sequential Chemotherapy with Mitoxantrone, Etoposide and Cytarabine for Previously Treated Acute Myeloid Leukemia: EMA 86 Regimen

P. Fenaux, X. Thomas, X. Troussard, 1996 .

Arsenic Trioxide (ATO) and ATRA with Limited Chemotherapy (CT) in Newly Diagnosed Standard Risk APL in the Elderly. a Report By the French Belgian Swiss APL Group (APL 2006 trial)

S. Chevret, P. Fenaux, L. Adès, 2016 .

Genetic identification of patients with AML older than 60 years achieving long-term survival with intensive chemotherapy.

H. Dombret, C. Preudhomme, T. Cluzeau, 2021, Blood.

Prognostic Factors in Acute Promyelocytic Leukemia: A Retrospective Study of 67 Cases.

X. Thomas, E. Archimbaud, D. Fière, 1991, Leukemia & lymphoma.

Impact of post-remission therapy in patients aged 65–70 years with de novo acute myeloid leukemia: a comparison of two concomitant randomized ALFA trials with overlapping age inclusion criteria

H. Dombret, P. Fenaux, C. Gardin, 2011, Haematologica.

Conventional Therapy in Adult Acute Lymphoblastic Leukemia: Review of the LALA Program

X. Thomas, D. Fière, D. Fiére, 2008 .

Philadelphia chromosome positive adult acute lymphoblastic leukemia: characteristics, prognostic factors and treatment outcome.

X. Thomas, A. Thiébaut, C. Charrin, 1998, Hematology and cell therapy.

Treatment of Philadelphia chromosome-positive adult acute lymphoblastic leukemia

H. Dombret, X. Thomas, 2008, Leukemia & lymphoma.

Successful pregnancies in patients with BCR‐ABL‐positive leukemias treated with interferon‐alpha therapy during the tyrosine kinase inhibitors era

G. Salles, X. Thomas, M. Elhamri, 2018, European journal of haematology.

Potential mechanisms of resistance to cytarabine in AML patients.

C. Galmarini, C. Dumontet, X. Thomas, 2002, Leukemia research.

Promyelocytic sarcoma of the sternum: a case report and review of the literature

X. Thomas, Y. Chelghoum, 2011, The Korean journal of hematology.

Expression of heat-shock proteins is associated with major adverse prognostic factors in acute myeloid leukemia.

X. Thomas, Q. Le, S. Piselli, 2005, Leukemia research.

Fractionated Doses of Gemtuzumab Ozogamicin (GO) Combined to Standard Chemotherapy (CT) Improve Event-Free and Overall Survival in Newly-Diagnosed De Novo AML Patients Aged 50–70 Years Old: A Prospective Randomized Phase 3 Trial From the Acute Leukemia French Association (ALFA)

H. Dombret, S. Chevret, C. Preudhomme, 2011 .

Randomized Comparison of Standard Induction with Daunorubicin (DNR) for 3 Days vs Idarubicin (IDA) for 3 or 4 Days in AML pts Aged 50 to 70 and of Maintenance with Interleukin 2. Final Analysis of the ALFA 9801 Study.

J. Bourhis, H. Dombret, S. Chevret, 2007 .

Actinomycosis after allogeneic hematopoietic stem cell transplantation despite penicillin prophylaxis

X. Thomas, F. Barraco, F. Valour, 2016, Transplant infectious disease : an official journal of the Transplantation Society.

Minimal residual disease monitoring in acute myeloid leukemia with non-A/B/D NPM1 mutations by digital polymerase chain reaction: feasibility and clinical use

H. Dombret, C. Preudhomme, S. de Botton, 2020, Haematologica.

A Phase II Study of Coltuximab Ravtansine (SAR3419) Monotherapy in Patients With Relapsed or Refractory Acute Lymphoblastic Leukemia.

H. Dombret, H. Kantarjian, J. Cortes, 2016, Clinical lymphoma, myeloma & leukemia.

Recurrent involvement of the MLL gene in adult T-lineage acute lymphoblastic leukemia.

J. Magaud, R. Rimokh, X. Thomas, 2002, Blood.

Recurrent in-frame insertion in C/EBPα TAD2 region is a polymorphism without prognostic value in AML

P. Amouyel, H. Dombret, D. Cottel, 2008, Leukemia.

Abstract CT231: BET-bromodomain inhibitor OTX015 shows clinically meaningful activity at nontoxic doses: interim results of an ongoing phase I trial in hematologic malignancies

A. Palumbo, H. Dombret, B. Quesnel, 2014 .

Treatment of Newly Diagnosed Acute Promyelocytic Leukemia (APL) in the Elderly: A Joint Analysis of the French -Belgian-Swiss and PETHEMA Groups.

H. Dombret, E. Vellenga, S. Chevret, 2009 .

Late first relapses in APL treated with all-trans-retinoic acid- and anthracycline- based chemotherapy: the European APL group experience (APL 91 and APL 93 trials)

H. Dombret, A. Vekhoff, S. Chevret, 2006, Leukemia.

Late Relapses in APL Treated with ATRA and Anthracycline Based Chemotherapy: The European APL Group Experience (APL 91 and APL 93 Trials).

H. Dombret, A. Vekhoff, S. Chevret, 2005 .

Hypodiploidy with 30-39 chromosomes and near-triploidy: two possible expressions of a sole entity conferring poor prognosis in Adult Acute Lymphoblastic Leukemia (ALL). A report from the LALA-94 and LALA-SA Groups

A. Bernheim, C. Bastard, L. Michaux, 2004 .

Chemotherapy plus ponatinib: a new standard for Ph-positive ALL?

X. Thomas, 2015, The Lancet. Oncology.

Donor-Derived Leukemia in a Recipient of Double-Unit Cord Blood Transplantation for Acute Myeloid Leukemia: A Case Study and Literature Review

A. Plesa, X. Thomas, S. Hayette, 2022, Oncology and Therapy.

Which AML Subsets Benefit from Leukemic Cell Priming during Chemotherapy? Long-Term Analysis of the ALFA-9802 GM-CSF Study

J. Bourhis, H. Dombret, C. Preudhomme, 2008 .

Is AraC Required In the Treatment of Standard Risk APL? Long Term Results of a Randomized Trial (APL 2000) From the French Belgian Swiss APL Group

H. Dombret, A. Stamatoullas, S. Chevret, 2010 .

Potential role for non-HLA-restricted cytotoxic cells in the immune surveillance of acute leukemia.

X. Thomas, E. Archimbaud, L. Campos, 1993, Immunology letters.

Susceptibility of acute myelogenous leukemia blasts to lysis by lymphokine-activated killer (LAK) cells and its clinical relevance.

X. Thomas, E. Archimbaud, J. Doré, 1992, Leukemia research.

Long-term follow-up confirms the benefit of all-trans retinoic acid in acute promyelocytic leukemia. European APL group.

H. Dombret, S. Chevret, M. Fey, 2000, Leukemia.

Profile of inotuzumab ozogamicin and its potential in the treatment of acute lymphoblastic leukemia

X. Thomas, 2014 .

Treatment of Acute Lymphoblastic Leukemia in the Elderly: An Evaluation of Interferon Alpha Given as a Single Agent After Complete Remission

R. Bouabdallah, H. Dombret, A. Delannoy, 2002, Leukemia & lymphoma.

Effects of Hematopoietic Growth Factors on Myelodysplastic Syndrome Progenitors

X. Thomas, L. Campos, D. Guyotat, 1990 .

Influence of malignant cell clonogenic capacities and position along the maturation pathway on their susceptibility to lymphokine-activated killer cell cytotoxicity.

P. Adeleine, X. Thomas, E. Archimbaud, 1998, Leukemia & lymphoma.

Invasive aspergillosis: an important risk factor on the short- and long-term survival of acute myeloid leukemia (AML) patients

P. Vanhems, X. Thomas, F. Persat, 2012, European Journal of Clinical Microbiology & Infectious Diseases.

Gemtuzumab Ozogamicin (Mylotarg®) as Single Agent Treatment for Adult Patients with Acute Myeloid Leukemia (AML).

X. Thomas, M. Elhamri, A. Thiébaut, 2005 .

A phase 1 study of chemosensitization with plerixafor plus G-CSF in adults with relapsed acute myeloid leukemia.

A. Plesa, X. Thomas, M. Elhamri, 2018, Leukemia research.

Randomized comparison of double induction and timed-sequential induction to a "3 + 7" induction in adults with AML: long-term analysis of the Acute Leukemia French Association (ALFA) 9000 study.

H. Dombret, H. Tilly, S. Chevret, 2004, Blood.

Autologous transplantation in acute myeloid leukemia: peripheral blood stem cell harvest after mobilization in steady state by granulocyte colony-stimulating factor alone

X. Thomas, I. Philip, Q. Le, 2001, Annals of Hematology.

Response of hematopoietic precursor cells to hematopoietic growth factors in the myelodysplastic syndromes.

X. Thomas, L. Campos, D. Guyotat, 1990, Nouvelle revue francaise d'hematologie.

Incidence and prognostic impact of c-Kit, FLT3, and Ras gene mutations in core binding factor acute myeloid leukemia (CBF-AML)

H. Dombret, A. Baruchel, G. Leverger, 2006, Leukemia.

[Acute lymphoblastic leukemia with Philadelphia chromosome: treatment with kinase inhibitors].

X. Thomas, 2007, Bulletin du Cancer.

Clinician Concepts of Cure in Adult Relapsed and Refractory Philadelphia-Negative B Cell Precursor Acute Lymphoblastic Leukemia: A Delphi Study

X. Thomas, J. McKendrick, B. Barber, 2019, Advances in Therapy.

Supportive care in patients with acute leukaemia: historical perspectives.

X. Thomas, G. Cannas, 2015, Blood transfusion = Trasfusione del sangue.

Occurrence of T-cell lymphoma in a patient with acute myelogenous leukemia

X. Thomas, E. Archimbaud, B. Anglaret, 1996, Annals of Hematology.

A Personalized Approach to Guide Allogeneic Stem Cell Transplantation in Younger Adults with Acute Myeloid Leukemia.

J. Bourhis, H. Dombret, S. Chevret, 2020, Blood.

Added prognostic value of secondary AML-like gene mutations in ELN intermediate-risk older AML: ALFA-1200 study results.

J. Bourhis, H. Dombret, C. Preudhomme, 2020, Blood advances.

Clofarabine-Based Consolidation Improves Relapse-Free Survival of Younger Adults with Non-Favorable Acute Myeloid Leukemia (AML) in First Remission: Results of the Randomized ALFA-0702/Clara Study (NCT 00932412)

H. Dombret, S. Chevret, C. Preudhomme, 2015 .

High-dose cytarabine in induction treatment improves the outcome of adult patients younger than age 46 years with acute myeloid leukemia: results of the EORTC-GIMEMA AML-12 trial.

A. Hagemeijer, M. Vignetti, F. Mandelli, 2014, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Sequential combination of gemtuzumab ozogamicin and standard chemotherapy in older patients with newly diagnosed acute myeloid leukemia: results of a randomized phase III trial by the EORTC and GIMEMA consortium (AML-17).

M. Vignetti, R. Latagliata, A. Ho, 2013, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Prospective evaluation of gene mutations and minimal residual disease in patients with core binding factor acute myeloid leukemia.

J. Cayuela, H. Dombret, S. Chevret, 2013, Blood.

Superior long-term outcome with idarubicin compared with high-dose daunorubicin in patients with acute myeloid leukemia age 50 years and older.

H. Dombret, S. Chevret, B. Quesnel, 2013, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Multicenter, randomized, open-label, phase III trial of decitabine versus patient choice, with physician advice, of either supportive care or low-dose cytarabine for the treatment of older patients with newly diagnosed acute myeloid leukemia.

M. Minden, H. Kantarjian, F. Ravandi, 2012, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Effect of gemtuzumab ozogamicin on survival of adult patients with de-novo acute myeloid leukaemia (ALFA-0701): a randomised, open-label, phase 3 study

H. Dombret, S. Chevret, C. Preudhomme, 2012, The Lancet.

Randomized study of intensified anthracycline doses for induction and recombinant interleukin-2 for maintenance in patients with acute myeloid leukemia age 50 to 70 years: results of the ALFA-9801 study.

J. Bourhis, H. Dombret, S. Chevret, 2010, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Use of glycosylated recombinant human G-CSF (lenograstim) during and/or after induction chemotherapy in patients 61 years of age and older with acute myeloid leukemia: final results of AML-13, a randomized phase-3 study.

M. Vignetti, F. Mandelli, G. Leone, 2005, Blood.

Postinduction Minimal Residual Disease Predicts Outcome and Benefit From Allogeneic Stem Cell Transplantation in Acute Myeloid Leukemia With NPM1 Mutation: A Study by the Acute Leukemia French Association Group.

J. Cayuela, H. Dombret, C. Preudhomme, 2017, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Which AML subsets benefit from leukemic cell priming during chemotherapy? Long‐term analysis of the ALFA‐9802 GM‐CSF study

H. Dombret, C. Preudhomme, C. Gardin, 2010, Cancer.

Combined medico‐surgical strategy for invasive sino‐orbito‐cerebral breakthrough fungal infection with Hormographiella aspergillata in an acute leukaemia patient

X. Thomas, J. Saison, C. Chidiac, 2015, Mycoses.

Acute myeloid leukemia in the pregnant patient

X. Thomas, 2015, European journal of haematology.

Acute myeloid leukemia in the pregnant patient.

X. Thomas, 2015, European journal of haematology.

Invasive aspergillosis in patients with hematologic malignancies: incidence and description of 127 cases enrolled in a single institution prospective survey from 2004 to 2009

Antoine Duclos, Stéphane Picot, N. Voirin, 2011, Haematologica.

Risk factors for invasive aspergillosis in acute myeloid leukemia patients prophylactically treated with posaconazole.

P. Vanhems, X. Thomas, F. Nicolini, 2011, Medical mycology.

Outcome and long-term follow-up of alloreactive donor lymphocyte infusions given for relapse after myeloablative allogeneic hematopoietic stem cell transplantations (HSCT)

X. Thomas, S. Hayette, F. Nicolini, 2005, Bone Marrow Transplantation.

Infectious complications in adult acute myeloid leukemia: analysis of the Acute Leukemia French Association-9802 prospective multicenter clinical trial

H. Dombret, B. Quesnel, P. Fenaux, 2012, Leukemia & lymphoma.

HHV-6 infection after allogeneic hematopoietic stem cell transplantation: From chromosomal integration to viral co-infections and T-cell reconstitution patterns.

X. Thomas, V. Escuret, F. Barraco, 2016, The Journal of infection.

Allogeneic hematopoietic stem-cell transplantation after nonmyeloablative preparative regimens: impact of pretransplantation and posttransplantation factors on outcome.

D. Blaise, P. Moreau, X. Thomas, 2001, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Long-term outcome after allogeneic hematopoietic stem cell transplantation for advanced stage acute myeloblastic leukemia: a retrospective study of 379 patients reported to the Société Française de Greffe de Moelle (SFGM)

A. Baruchel, H. Tilly, D. Blaise, 2000, Bone Marrow Transplantation.

A new signaling cascade linking BMP4, BMPR1A, ΔNp73 and NANOG impacts on stem-like human cell properties and patient outcome

C. Caron de Fromentel, T. Voeltzel, X. Thomas, 2018, Cell Death & Disease.

Is cytarabine useful in the treatment of acute promyelocytic leukemia? Results of a randomized trial from the European Acute Promyelocytic Leukemia Group.

H. Dombret, A. Vekhoff, S. Chevret, 2006, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

L-Asparaginase Loaded into Erythrocytes (GRASPA): Principle and Interests in Acute Lymphoblastic Leukemia.

X. Thomas, Y. Bertrand, Y. Godfrin, 2007 .

Blinatumomab versus Chemotherapy for Advanced Acute Lymphoblastic Leukemia

W. Klapper, H. Dombret, R. Foà, 2017, The New England journal of medicine.

T-cell acute lymphoblastic leukemia: promising experimental drugs in clinical development

X. Thomas, 2022, Expert opinion on investigational drugs.

Early Response-Based Therapy Stratification Improves Survival in Adult Early Thymic Precursor Acute Lymphoblastic Leukemia: A Group for Research on Adult Acute Lymphoblastic Leukemia Study.

H. Dombret, E. Macintyre, S. Spicuglia, 2017, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Prognostic factors and treatment effects on survival in acute myeloid leukemia of M6 subtype: a retrospective study of 54 cases.

X. Thomas, C. Charrin, Y. Chelghoum, 2001, Annals of oncology : official journal of the European Society for Medical Oncology.

Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients

A. Plesa, P. Saintigny, V. Marcel, 2017, PloS one.

Prognostic significance of DNA methyltransferase 3A mutations in cytogenetically normal acute myeloid leukemia: a study by the Acute Leukemia French Association

H. Dombret, C. Preudhomme, P. Fenaux, 2011, Leukemia.

Prognostic impact of isocitrate dehydrogenase enzyme isoforms 1 and 2 mutations in acute myeloid leukemia: a study by the Acute Leukemia French Association group.

H. Dombret, B. Quesnel, C. Preudhomme, 2010, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Wilms tumor 1 gene mutations are associated with a higher risk of recurrence in young adults with acute myeloid leukemia

H. Dombret, C. Preudhomme, X. Thomas, 2009, Cancer.

Favorable prognostic significance of CEBPA mutations in patients with de novo acute myeloid leukemia: a study from the Acute Leukemia French Association (ALFA).

J. Cayuela, H. Dombret, C. Preudhomme, 2002, Blood.

Core-binding factor acute myeloid leukemia in first relapse: a retrospective study from the French AML Intergroup.

H. Dombret, J. Tamburini, T. Cluzeau, 2014, Blood.

Initial absolute lymphocyte count as a prognostic factor for outcome in acute myeloid leukemia

C. Dumontet, X. Thomas, M. Elhamri, 2014, Leukemia & lymphoma.

Outcome of older patients with acute myeloid leukemia in first relapse

H. Dombret, S. Chevret, B. Quesnel, 2013, American journal of hematology.

Acute myeloid leukemia in the elderly

X. Thomas, 2012 .

Wilms' tumor 1 single-nucleotide polymorphism rs16754 does not predict clinical outcome in adult acute myeloid leukemia

X Thomas, H. Dombret, C. Preudhomme, 2011, Leukemia.

Decitabine for the treatment of adult patients (age ≥65 years) with newly diagnosed de novo or secondary acute myeloid leukemia

X. Thomas, M. Elhamri, M. Heiblig, 2013 .

In vivo mechanisms of resistance to cytarabine in acute myeloid leukaemia

C. Galmarini, C. Dumontet, X. Thomas, 2002, British journal of haematology.

The rationale and use of hypomethylation agents in adult acute myeloid leukemia

X. Thomas, F. Barraco, Y. Chelghoum, 2009, Expert opinion on drug discovery.

A phase II study of elacytarabine in combination with idarubicin and of human equilibrative nucleoside transporter 1 expression in patients with acute myeloid leukemia and persistent blasts after the first induction course

R. Schlenk, A. Gianella-Borradori, X. Thomas, 2014, Leukemia & lymphoma.

Vosaroxin plus cytarabine versus placebo plus cytarabine in patients with first relapsed or refractory acute myeloid leukaemia (VALOR): a randomised, controlled, double-blind, multinational, phase 3 study.

Arnaud Pigneux, Gary Acton, Michael Heuser, 2015, The Lancet. Oncology.

Acute Promyelocytic Leukemia: A History over 60 Years—From the Most Malignant to the most Curable Form of Acute Leukemia

X. Thomas, 2019, Oncology and Therapy.

Arsenic trioxide is required in the treatment of newly diagnosed acute promyelocytic leukemia. Analysis of a randomized trial (APL 2006) by the French Belgian Swiss APL group

H. Dombret, S. Chevret, P. Chevallier, 2018, Haematologica.

Reducing mortality in newly diagnosed standard-risk acute promyelocytic leukemia in elderly patients treated with arsenic trioxide requires major reduction of chemotherapy: a report by the French Belgian Swiss APL group (APL 2006 trial)

S. Chevret, P. Fenaux, L. Adès, 2018, Haematologica.

Pefloxacin and vancomycin vs. gentamicin, colistin sulphate and vancomycin for prevention of infections in granulocytopenic patients: a randomised double-blind study.

X. Thomas, E. Archimbaud, C. Ploton, 1991, European journal of cancer.

Expression of high Km 5'-nucleotidase in leukemic blasts is an independent prognostic factor in adults with acute myeloid leukemia.

J. Mackey, C. Galmarini, C. Dumontet, 2001, Blood.

Results of a randomized phase 3 study of oral sapacitabine in elderly patients with newly diagnosed acute myeloid leukemia (SEAMLESS)

P. Venugopal, M. Buyse, G. Gaidano, 2021, Cancer.

Pediatric-inspired intensified therapy of adult T-ALL reveals the favorable outcome of NOTCH1/FBXW7 mutations, but not of low ERG/BAALC expression: a GRAALL study.

H. Dombret, E. Macintyre, S. Leprêtre, 2011, Blood.

Bromodomain inhibitor OTX015 in patients with acute leukaemia: a dose-escalation, phase 1 study.

H. Dombret, B. Quesnel, P. Hérait, 2016, The Lancet. Haematology.

Prognostic and oncogenic relevance of TLX1/HOX11 expression level in T-ALLs.

J. Soulier, E. Clappier, H. Dombret, 2007, Blood.

The Impact of DNMT3A Status on NPM1 MRD Predictive Value and Survival in Elderly AML Patients Treated Intensively

C. Preudhomme, X. Thomas, S. Hayette, 2021, Cancers.

Prognostic Value of Genetic Alterations in Elderly Patients with Acute Myeloid Leukemia: A Single Institution Experience

G. Salles, A. Plesa, E. Wattel, 2019, Cancers.

Prognostic implication of FLT3 and Ras gene mutations in patients with acute promyelocytic leukemia (APL): a retrospective study from the European APL Group

H. Dombret, A. Vekhoff, S. Chevret, 2005, Leukemia.

Prognostic significance of FLT3 internal tandem repeat in patients with de novo acute myeloid leukemia treated with reinforced courses of chemotherapy

X Thomas, F. Sigaux, J. Cayuela, 2002, Leukemia.

Prognostic significance of concurrent gene mutations in intensively treated patients with IDH-mutated AML, an ALFA study.

H. Dombret, C. Preudhomme, L. Adès, 2021, Blood.

Cerebral venous thrombosis in adult patients with acute lymphoblastic leukemia or lymphoblastic lymphoma during induction chemotherapy with l‐asparaginase: The GRAALL experience

H. Dombret, P. Chevallier, X. Thomas, 2015, American journal of hematology.

High DNA Methyltransferase DNMT3B Levels: A Poor Prognostic Marker in Acute Myeloid Leukemia

G. Salles, A. Plesa, J. Magaud, 2012, PloS one.

The p16(INK4A)/pRb pathway and telomerase activity define a subgroup of Ph+ adult Acute Lymphoblastic Leukemia associated with inferior outcome.

G. Salles, H. Dombret, M. Béné, 2015, Leukemia research.

T-ALLs Prognostic and oncogenic relevance of TLX1/HOX11 expression level in

J. Soulier, E. Clappier, H. Dombret, 2013 .

lymphoblastic leukemia: a LALA-94 study Impact of TCR status and genotype on outcome in adult T-cell acute

J. Cayuela, H. Dombret, E. Macintyre, 2013 .

Impact of TCR status and genotype on outcome in adult T-cell acute lymphoblastic leukemia: a LALA-94 study.

J. Cayuela, H. Dombret, E. Macintyre, 2005, Blood.

Outcome of treatment after first relapse in adults with acute lymphoblastic leukemia initially treated by the LALA-94 trial

H. Dombret, A. Stamatoullas, A. Delannoy, 2007, Leukemia.

Should adolescents with acute lymphoblastic leukemia be treated as old children or young adults? Comparison of the French FRALLE-93 and LALA-94 trials.

J. Cayuela, H. Dombret, A. Baruchel, 2003, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

TET2 exon 2 skipping is an independent favorable prognostic factor for cytogenetically normal acute myelogenous leukemia (AML): TET2 exon 2 skipping in AML.

D. Maucort-Boulch, D. Auboeuf, E. Wattel, 2017, Leukemia research.

Phase I studies of AVE9633, an anti-CD33 antibody-maytansinoid conjugate, in adult patients with relapsed/refractory acute myeloid leukemia

A. Vekhoff, D. DeAngelo, C. Dumontet, 2012, Investigational New Drugs.

Improved outcome of acute promyelocytic leukemia with high WBC counts over the last 15 years: the European APL Group experience.

H. Dombret, S. Chevret, P. Chevallier, 2009, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Treatment of newly diagnosed acute promyelocytic leukemia (APL): a comparison of French-Belgian-Swiss and PETHEMA results.

H. Dombret, A. Vekhoff, E. Vellenga, 2008, Blood.

Additional chromosomal abnormalities in patients with acute promyelocytic leukaemia (APL) do not confer poor prognosis: results of APL 93 trial.

J. Miguel, H. Dombret, A. Stamatoullas, 2000 .

Additional chromosomal abnormalities in patients with acute promyelocytic leukaemia (APL) do not confer poor prognosis: results of APL 93 trial

H. Dombret, A. Stamatoullas, E. Solary, 2000, British journal of haematology.

Long-term follow-up confirms the benefit of all-trans retinoic acid in acute promyelocytic leukemia

H. Dombret, S. Chevret, M. Fey, 2000, Leukemia.

Randomized study of reduced-intensity chemotherapy combined with imatinib in adults with Ph-positive acute lymphoblastic leukemia.

J. Cayuela, H. Dombret, S. Leprêtre, 2015, Blood.

Emerging treatment approaches in acute lymphoblastic and acute myeloid leukemias

X. Thomas, 2012 .

Sequentisl induction chemotherapy with vincristine, daunorubicin cyclophosphamide, and prednisone in adult acute lymphoblastic leukemia

C. Sebban, X. Thomas, E. Archimbaud, 1995, Annals of Hematology.

Prognostic Factors in Adult Acute Lymphoblastic Leukemia

X. Thomas, Q. Le, 2003, Hematology.

Emerging drugs for adult acute lymphoblastic leukaemia

X. Thomas, 2005, Expert opinion on emerging drugs.

Sequential induction chemotherapy with vincristine, daunorubicin, cyclophosphamide, and prednisone in adult acute lymphoblastic leukemia.

X. Thomas, P. Dufour, B. Corront, 1995, Annals of hematology.

Clinical relevance of IDH1/2 mutant allele burden during follow-up in acute myeloid leukemia. A study by the French ALFA group

H. Dombret, C. Preudhomme, X. Thomas, 2018, Haematologica.

Diagnostics of the AML with immunophenotypical data

Gabriela Ciuperca, L. Pujo-Menjouet, A. Plesa, 2006 .

Current Management of Adult Acute Lymphoblastic Leukaemia: Emerging Insights and Outstanding Questions

X. Thomas, C. Le Jeune, 2016, EMJ Hematology.

Role of allogeneic stem cell transplantation in adult patients with Ph-negative acute lymphoblastic leukemia.

J. Bourhis, H. Dombret, P. Chevallier, 2015, Blood.

Oncogenetics and minimal residual disease are independent outcome predictors in adult patients with acute lymphoblastic leukemia.

J. Cayuela, H. Dombret, E. Macintyre, 2014, Blood.

Outcome of treatment in adults with acute lymphoblastic leukemia: analysis of the LALA-94 trial.

H. Dombret, A. Stamatoullas, A. Delannoy, 2004, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Acute lymphoblastic leukemia in the elderly: The Edouard Herriot hospital experience

J. Magaud, X. Thomas, C. Charrin, 2001, American journal of hematology.

Structural rearrangements of chromosome 3 in 57 patients with acute myeloid leukemia: clinical, hematological and cytogenetic features.

J. Magaud, X. Thomas, C. Charrin, 2002, The hematology journal : the official journal of the European Haematology Association.

Intensified Therapy of Acute Lymphoblastic Leukemia in Adults: Report of the Randomized GRAALL-2005 Clinical Trial.

H. Dombret, E. Macintyre, S. Leprêtre, 2018, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Rituximab in B-Lineage Adult Acute Lymphoblastic Leukemia.

H. Dombret, S. Chevret, P. Chevallier, 2016, The New England journal of medicine.

Pediatric-inspired therapy in adults with Philadelphia chromosome-negative acute lymphoblastic leukemia: the GRAALL-2003 study.

H. Dombret, E. Macintyre, A. Delannoy, 2009, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Phase 3 randomized, placebo-controlled, double-blind study of high-dose continuous infusion cytarabine alone or with laromustine (VNP40101M) in patients with acute myeloid leukemia in first relapse.

M. Tallman, W. Stock, D. DeAngelo, 2009, Blood.

Antiemetic activity of high-dose methylprednisolone associated with continuous-infusion metoclopramide and oral alprazolam during multiple-day chemotherapy

X. Thomas, E. Archimbaud, G. Salles, 2004, Cancer Chemotherapy and Pharmacology.

Long-term follow-up of patients with newly diagnosed adult acute lymphoblastic leukemia: a single institution experience of 378 consecutive patients over a 21-year period

C. Sebban, J. Magaud, X. Thomas, 2001, Leukemia.

Central nervous system involvement in adult acute lymphoblastic leukemia at diagnosis and/or at first relapse: results from the GET-LALA group.

H. Dombret, A. Stamatoullas, A. Delannoy, 2007, Leukemia research.

Rescue therapy combining intermediate-dose cytarabine with amsacrine and etoposide in relapsed adult acute lymphoblastic leukemia.

A. Stamatoullas, A. Delannoy, C. Gardin, 2004, The Hematology Journal.

Long-Term Survival after Stem Cell Transplant in Adult Acute Lymphoblastic Leukemia

C. Sebban, X. Thomas, M. Michallet, 2003 .

Adult acute lymphocytic leukemia study testing chemotherapy and autologous and allogeneic transplantation. A follow-up report of the French protocol LALA 87.

C. Sebban, É. Lepage, J. Reiffers, 2000, Hematology/oncology clinics of North America.

High-Dose Cytarabine Combined to Mitoxantrone in the Treatment of Refractory and Relapsed Acute Lymphoblastic Leukemia

X. Thomas, D. Fiére, N. Bouheddou, 2001 .

Healthcare burden and reimbursement of hospitalization during chemotherapy for adults with Ph-negative relapsed or refractory B-cell precursor acute lymphoblastic leukemia in France: a retrospective chart review

H. Dombret, P. Chevallier, M. Mohty, 2016, Journal of Medical Economics.

Autologous stem cell transplantation in adults with acute lymphoblastic leukemia in first complete remission: analysis of the LALA-85, -87 and -94 trials

H. Dombret, A. Delannoy, J. Gabert, 2006, Leukemia.

Heat shock proteins and acute leukemias

X. Thomas, Q. Le, L. Campos, 2005, Hematology.

Erythrocyte encapsulated l-asparaginase (GRASPA) in acute leukemia.

X. Thomas, C. Le Jeune, 2016, International journal of hematologic oncology.

Ferritin heavy/light chain (FTH1/FTL) expression, serum ferritin levels, and their functional as well as prognostic roles in acute myeloid leukemia

X. Thomas, C. Récher, E. Delabesse, 2018, European journal of haematology.

Adult T‐biphenotypic acute leukaemia: clinical and biological features and outcome

X. Thomas, O. Reman, C. Boucheix, 2003, British journal of haematology.

First contributors in the history of leukemia

X. Thomas, 2013 .

Epstein-Barr Virus (EBV) Reactivation, Its Treatment with Rituximab and Their Impact on Relapse after Allogeneic Hematopoietic Stem Cell Transplantation for Hematological Malignancies

X. Thomas, C. Rioufol, B. Lina, 2016 .

A matched case-control study of toxoplasmosis after allogeneic haematopoietic stem cell transplantation: still a devastating complication.

G. Salles, X. Thomas, M. Rabodonirina, 2016, Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases.

First Results of a Prospective Study on Erythropoietin Biosimilar (Epoetin zeta) Use in Patients Undergoing Allogeneic Hematopoietic Stem Cell Transplantation for Hematological Malignancies

X. Thomas, F. Barraco, F. Nicolini, 2015 .

Very long-term outcome of acute promyelocytic leukemia after treatment with all-trans retinoic acid and chemotherapy: the European APL Group experience.

H. Dombret, E. Solary, S. Chevret, 2009, Blood.

Initial and late prognostic factors to predict survival in adult acute lymphoblastic leukaemia

R. Écochard, X. Thomas, Q. Le, 2006, European journal of haematology.

Philadelphia Chromosome-positive Acute Lymphoblastic Leukemia in the Elderly: Prognostic Factors and Treatment Outcome

R. Houot, X. Thomas, A. Thiébaut, 2004, Hematology.

Autologous and allogeneic stem-cell transplantation as salvage treatment of acute promyelocytic leukemia initially treated with all-trans-retinoic acid: a retrospective analysis of the European acute promyelocytic leukemia group.

J. Bourhis, H. Dombret, S. Chevret, 2005, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Emerging pharmacotherapies for elderly acute myeloid leukemia patients

X. Thomas, M. Elhamri, M. Heiblig, 2020, Expert review of hematology.

Differential Allelic Expression in Leukoblast from Patients with Acute Myeloid Leukemia Suggests Genetic Regulation of CDA, DCK, NT5C2, NT5C3, and TP53

S. Tavtigian, C. Dumontet, X. Thomas, 2008, Drug Metabolism and Disposition.

Deoxycytidine kinase and cN‐II nucleotidase expression in blast cells predict survival in acute myeloid leukaemia patients treated with cytarabine

J. Mackey, C. Galmarini, C. Dumontet, 2003, British journal of haematology.

A phase 2 study of the oral farnesyltransferase inhibitor tipifarnib in patients with refractory or relapsed acute myeloid leukemia.

Pierre Fenaux, R. Stone, P. Fenaux, 2007, Blood.

Treating adults with acute lymphocytic leukemia: new pharmacotherapy options

X. Thomas, C. Le Jeune, 2016, Expert opinion on pharmacotherapy.

The development of agents targeting the BCR-ABL tyrosine kinase as Philadelphia chromosome-positive acute lymphoblastic leukemia treatment

X. Thomas, M. Heiblig, 2016, Expert opinion on drug discovery.

Treatment and outcome of Philadelphia chromosome-positive acute lymphoblastic leukemia in adults after relapse

X. Thomas, M. Balsat, M. Carré, 2020, Expert review of anticancer therapy.

Phase I Clinical Evaluation of Topotecan Combined with Idarubicin and Cytarabine in Patients with Refractory or Relapsed Acute Myeloid Leukemia

X. Thomas, M. Elhamri, A. Thiébaut, 2003 .

The safety of treatment options for elderly people with acute myeloid leukemia

X. Thomas, C. Le Jeune, 2016, Expert opinion on drug safety.

Outcome of acute promyelocytic leukemia (APL) in children and adolescents: an analysis in two consecutive trials of the European APL Group.

H. Dombret, A. Baruchel, G. Leverger, 2012, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Treatment of relapsing acute promyelocytic leukemia by all-trans retinoic acid therapy followed by timed sequential chemotherapy and stem cell transplantation

H. Dombret, A. Stamatoullas, A. Vekhoff, 2000, Leukemia.

Adult T-cell acute lymphoblastic leukemias with IL7R pathway mutations are slow-responders who do not benefit from allogeneic stem-cell transplantation

H. Dombret, E. Macintyre, S. Leprêtre, 2020, Leukemia.

Ponatinib-based therapy in adults with relapsed or refractory Philadelphia chromosome-positive acute lymphoblastic leukemia: results of the real-life OPAL study

H. Dombret, S. Leprêtre, P. Chevallier, 2020, Leukemia & lymphoma.

Elderly Patients (Age 70 Years or Older) With Secondary Acute Myeloid Leukemia or Acute Myeloid Leukemia Developed Concurrently to Another Malignant Disease

G. Salles, E. Wattel, X. Thomas, 2018, Clinical lymphoma, myeloma & leukemia.

Alloreaction increases or restores CD40, CD54, and/or HLA molecule expression in acute myelogenous leukemia blasts, through secretion of inflammatory cytokines: dominant role for TNFβ, in concert with IFNγ

X. Thomas, J. Snick, D. Rigal, 2006, Leukemia.

HLA Matching Is More Critical Than CMV Matching in Predicting Non-Relapse-Mortality of Patients Undergoing HSCT From An Unrelated Donor: A Retrospective Monocenter Study.

X. Thomas, F. Barraco, F. Nicolini, 2009 .

Monitoring of asparagine depletion and anti-l-asparaginase antibodies in adult acute lymphoblastic leukemia treated in the pediatric-inspired GRAALL-2005 trial

H. Dombret, X. Thomas, N. Ifrah, 2018, Blood Cancer Journal.

Allogeneic H ematopoietic S tem-Cell T ransplantation A fter Nonmyeloablative P reparative R egimens: I mpact o f Pretransplantati on a nd P osttransplantat ion F actors on O utcome

D. Blaise, P. Moreau, X. Thomas, 2001 .

Specific T cells for the treatment of cytomegalovirus and/or adenovirus in the context of hematopoietic stem cell transplantation.

C. Picard, P. Chevallier, C. Elie, 2016, The Journal of allergy and clinical immunology.

Impact of chimaerism analysis and kinetics on allogeneic haematopoietic stem cell transplantation outcome after conventional and reduced‐intensity conditioning regimens

X. Thomas, F. Nicolini, V. Dubois, 2005, British journal of haematology.

Mixed Chimerism at Three Months after Allogeneic Hematopoietic Stem Cell Transplantation Is a Significant Predictor of Disease Relapse in High-Risk Acute Myeloid Leukemia Patients in First Complete Remission

X. Thomas, I. Mollet, F. Barraco, 2015 .

Machine learning identifies the independent role of dysplasia in the prediction of response to chemotherapy in AML

H. Dombret, B. Quesnel, C. Preudhomme, 2021, Leukemia.

Bone marrow biopsy in adult acute lymphoblastic leukemia: morphological characteristics and contribution to the study of prognostic factors.

X. Thomas, M. Ffrench, Q. Le, 2002, Leukemia research.

J. Esteve, H. Dombret, P. Fenaux, 2003, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Allogeneic stem cell transplantation improves the outcome of adults with t(1;19)/E2A-PBX1 and t(4;11)/MLL-AF4 positive B-cell acute lymphoblastic leukemia: results of the prospective multicenter LALA-94 study

H. Dombret, A. Delannoy, J. Gabert, 2006, Leukemia.

Extramedullary relapse in acute promyelocytic leukemia treated with all-trans retinoic acid and chemotherapy

H. Dombret, S. Chevret, B. Quesnel, 2006, Leukemia.

Hox expression in AML identifies a distinct subset of patients with intermediate cytogenetics

A. Baron, R. Gemmill, H. Drabkin, 2004, Leukemia.

Anthracycline-related toxicity requiring cardiac transplantation in long-term disease-free survivors with acute promyelocytic leukemia

X. Thomas, Q. Le, D. Fiére, 2002, Annals of Hematology.

Efficacy of All-Trans-Retinoic Acid in High-Risk Acute Myeloid Leukemia with Overexpression of EVI1

G. Salles, A. Plesa, X. Thomas, 2019, Oncology and Therapy.

An evaluation of glasdegib for the treatment of acute myelogenous leukemia

X. Thomas, M. Heiblig, 2020, Expert opinion on pharmacotherapy.

Evaluation of allogeneic hematopoietic SCT in younger adults with adverse karyotype AML

H. Dombret, C. Preudhomme, P. Fenaux, 2012, Bone Marrow Transplantation.

Acute myeloid leukemia with translocation (8;21) or inversion (16) in elderly patients treated with conventional chemotherapy: a collaborative study of the French CBF-AML intergroup.

H. Dombret, B. Esterni, B. Quesnel, 2009, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Outcome of older (≥70 years) APL patients frontline treated with or without arsenic trioxide—an International Collaborative Study

R. Schlenk, M. Tormo, P. Fenaux, 2020, Leukemia.

Outcome of acute promyelocytic leukemia treated with all trans retinoic acid and chemotherapy in elderly patients: the European group experience

J. Miguel, J. Bourhis, H. Dombret, 2005, Leukemia.

Superiority of an arsenic trioxide-based regimen over a historic control combining all-trans retinoic acid plus intensive chemotherapy in the treatment of relapsed acute promyelocytic leukemia.

P. Fenaux, X. Thomas, E. Raffoux, 2006, Haematologica.

Impact of the type of anthracycline and of stem cell transplantation in younger patients with acute myeloid leukaemia: Long‐term follow up of a phase III study

J. Bourhis, M. Vignetti, P. Chiusolo, 2020, American journal of hematology.

Genetic polymorphisms in ARID5B, CEBPE, IKZF1 and CDKN2A in relation with risk of acute lymphoblastic leukaemia in adults: a Group for Research on Adult Acute Lymphoblastic Leukaemia (GRAALL) study

Arnaud Pigneux, Elizabeth Macintyre, H. Dombret, 2012, British journal of haematology.

Cryptic XPO1-MLLT10 translocation is associated with HOXA locus deregulation in T-ALL.

E. Macintyre, S. Spicuglia, X. Thomas, 2014, Blood.

A comparison of flow cytometry detection of minimal residual disease and chimerism kinetics in chronic lymphocytic leukemia patients after allogeneic hematopoietic stem cell transplantation

A. Plesa, C. Dumontet, X. Thomas, 2011 .

Inotuzumab ozogamicin in the treatment of B-cell acute lymphoblastic leukemia

X. Thomas, 2012, Expert opinion on investigational drugs.

Decitabine improves outcomes in older patients with acute myeloid leukemia and higher blast counts

M. Minden, H. Kantarjian, T. Kadia, 2015, American journal of hematology.

Higher percentage of CD34 + CD38− cells detected by multiparameter flow cytometry from leukapheresis products predicts unsustained complete remission in acute myeloid leukemia

A. Plesa, C. Dumontet, X. Thomas, 2015, Leukemia & lymphoma.

A Phase 1 Study of the BET-Bromodomain Inhibitor OTX015 in Patients with Advanced Acute Leukemia

H. Dombret, B. Quesnel, P. Hérait, 2014 .

Allogeneic hematopoietic stem cell transplant for hematological malignancies from mismatched 9/10 human leukocyte antigen unrelated donors: comparison with transplants from 10/10 unrelated donors and human leukocyte antigen identical siblings

X. Thomas, F. Barraco, F. Nicolini, 2015, Leukemia & lymphoma.

Expression of surface adhesion molecules CD54 (ICAM-1) and CD58 (LFA-3) in adult acute leukemia: relationship with initial characteristics and prognosis.

J. Magaud, X. Thomas, E. Archimbaud, 1992, Leukemia.

Prognostic impact of DDX41 germline mutations in intensively treated acute myeloid leukemia patients: an ALFA-FILO study.

J. Soulier, E. Clappier, H. Dombret, 2022, Blood.

Safety and Efficacy from a Phase 1b/2 Study of IMGN632 in Combination with Azacitidine and Venetoclax for Patients with CD123-Positive Acute Myeloid Leukemia

M. Konopleva, G. Gaidano, H. Kantarjian, 2021, Blood.

Expression of beta1-integrins and pseudo-immunoglobulins on acute promyelocytic leukemia cells and its modifications during in vitro differentiation.

X. Thomas, A. Thiébaut, E. Archimbaud, 1998, Leukemia research.

Genetic Identification of AML Patients Older than 60 years Achieving Long-term Survival with Intensive Chemotherapy.

H. Dombret, C. Preudhomme, T. Cluzeau, 2021, Blood.

Broad Activity for the Pivekimab Sunirine (PVEK, IMGN632), Azacitidine, and Venetoclax Triplet in High-Risk Patients with Relapsed/Refractory Acute Myeloid Leukemia (AML)

P. Vyas, M. Konopleva, G. Gaidano, 2022, Blood.

Prospective genetically randomized comparison between intensive postinduction chemotherapy and bone marrow transplantation in adults with newly diagnosed acute myeloid leukemia.

X. Thomas, E. Archimbaud, M. Michallet, 1994, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Expression of VLA molecules on acute leukemia cells: relationship with disease characteristics.

X. Thomas, E. Archimbaud, L. Campos, 1995, Experimental hematology.

Differential adhesiveness between blood and marrow leukemic cells having similar pattern of VLA adhesion molecule expression.

J. Magaud, X. Thomas, E. Archimbaud, 1998, Leukemia research.

Expression of N-CAM (CD56) on acute leukemia cells: relationship with disease characteristics and outcome.

X. Thomas, E. Archimbaud, L. Campos, 1995, Leukemia & lymphoma.

ABCA3 Expression Predicts Response to Gemtuzumab Ozogamicin in AML

D. Maucort-Boulch, H. Dombret, E. Wattel, 2016 .

An Open Label, Dose Escalation Study of AVE9633 Administered as a Single Agent by Intravenous (IV) Infusion Weekly for 2 Weeks in 4-Week Cycle to Patients with Relapsed or Refractory CD33-Positive Acute Myeloid Leukemia (AML).

J. Miguel, C. Dumontet, X. Thomas, 2007 .

Prospective Comparison of Outcomes with Azacitidine and Decitabine in AML Patients Ineligible for Intensive Chemotherapy.

H. Döhner, W. Jędrzejczak, J. Issa, 2022, Blood.

Toward a NOTCH1/FBXW7/RAS/PTEN-based oncogenetic risk classification of adult T-cell acute lymphoblastic leukemia: a Group for Research in Adult Acute Lymphoblastic Leukemia study.

B. Nadel, H. Dombret, E. Macintyre, 2013, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Outcome of treatment in adults with Philadelphia chromosome-positive acute lymphoblastic leukemia--results of the prospective multicenter LALA-94 trial.

J. Bourhis, J. Cayuela, H. Dombret, 2002, Blood.

A randomized study of pegylated liposomal doxorubicin versus continuous-infusion doxorubicin in elderly patients with acute lymphoblastic leukemia: the GRAALL-SA1 study

Philippe Rousselot, H. Dombret, A. Delannoy, 2011, Haematologica.

The bone marrow stromal environment is a major factor in myeloma cell resistance to dexamethasone.

I. Grigorieva, X. Thomas, J. Epstein, 1998, Experimental hematology.

Susceptibility of adult acute lymphoblastic leukemia blasts to lysis by lymphokine-activated killer cells.

J. Magaud, X. Thomas, E. Archimbaud, 1991, Leukemia.

Tisagenlecleucel-T for the treatment of acute lymphocytic leukemia

X. Thomas, E. Paubelle, 2018, Expert opinion on biological therapy.

Addition of Rituximab Improves the Outcome of Adult Patients with CD20-Positive, Ph-Negative, B-Cell Precursor Acute Lymphoblastic Leukemia (BCP-ALL): Results of the Randomized Graall-R 2005 Study

H. Dombret, S. Chevret, P. Chevallier, 2015 .

The Omission of High-Dose Cytarabine during Consolidation Therapy of Ph-Positive ALL Patients Treated with Nilotinib and Low-Intensity Chemotherapy Results in an Increased Risk of Relapses Despite Non-Inferior Levels of Late BCR-ABL1 MRD Response. First Results of the Randomized Graaph-2014 Study

F. Pasquier, E. Clappier, J. Cayuela, 2021, Blood.

Imatinib Combined with Intensive HAM Chemotherapy as Consolidation of Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia (Ph1-ALL). Preliminary Results of the AFR03 Phase I/II Study.

J. Cayuela, H. Dombret, A. Vekhoff, 2004 .

Chimeric Antigen Receptor-Engineered T Cell Therapy in Acute Myeloid Leukaemia

X. Thomas, E. Paubelle, C. Rocher, 2018, European Medical Journal.

Acute lymphoblastic leukemia relapsing after first-line pediatric-inspired therapy: a retrospective GRAALL study

H. Dombret, S. Leprêtre, M. Bernard, 2016, Blood Cancer Journal.

Allogeneic bone marrow tranplantation for young adult patients with newly diagnosed acute myeloid leukemia: HLA-Matched sibling donor availability does not improve treatment ouctome

X. Thomas, C. Charrin, Q. Le, 2000 .

Continuous-infusion carboplatin in combination with idarubicin or mitoxantrone for high-risk acute myeloid leukemia: a randomised phase II study.

E. Wattel, X. Thomas, E. Archimbaud, 1999, Leukemia & lymphoma.

Late Relapses in Adult Acute Myelogenous Leukemia: A Retrospective Study of Characteristics and Outcome in 76 Cases

X. Thomas, E. Archimbaud, L. Vila, 1997 .

Antibody‐based therapies in B‐cell lineage acute lymphoblastic leukaemia

X. Thomas, C. Le Jeune, 2015, European journal of haematology.

FLT3‐TKD Mutations Associated With NPM1 Mutations Define a Favorable‐risk Group in Patients With Acute Myeloid Leukemia

G. Salles, X. Thomas, S. Hayette, 2018, Clinical lymphoma, myeloma & leukemia.

Postremission treatment of elderly patients with acute myeloid leukemia in first complete remission after intensive induction chemotherapy: results of the multicenter randomized Acute Leukemia French Association (ALFA) 9803 trial.

J. Bourhis, H. Dombret, C. Preudhomme, 2007, Blood.

Effect of Priming with Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) in Younger Adults with Newly Diagnosed Acute Myeloid Leukemia (AML): A Trial by the Acute Leukemia French Association (ALFA) Group.

J. Bourhis, H. Dombret, B. Quesnel, 2005 .

The management and treatment of acute leukemias in the elderly population

X. Thomas, 2017, Expert review of hematology.

Surface marker expression in acute myeloid leukaemia at first relapse

X. Thomas, E. Archimbaud, L. Campos, 1992, British journal of haematology.

A white blood cell index as the main prognostic factor in t ( 8 ; 21 ) acute myeloid leukemia ( AML ) : a survey of 161 cases from the French AML Intergroup

H. Dombret, G. Leverger, D. Blaise, 2002 .

Impact of induction regimen and allogeneic hematopoietic cell transplantation on outcome in younger adults with acute myeloid leukemia with a monosomal karyotype

A. Hagemeijer, F. Baron, R. Willemze, 2018, Haematologica.

Azacitidine in untreated acute myeloid leukemia: A report on 149 patients

H. Dombret, A. Stamatoullas, B. Quesnel, 2014, American journal of hematology.

Risk factors and decision criteria for intensive chemotherapy in older patients with acute myeloid leukemia

H. Dombret, C. Gardin, X. Thomas, 2008, Haematologica.

Hyper-CVAD + epratuzumab as a salvage regimen for younger patients with relapsed/refractory CD22-positive precursor B-cell acute lymphocytic leukemia

H. Dombret, P. Chevallier, M. Béné, 2017, Haematologica.

Outcome of High-Risk and Refractory AML/MDS Patients Receiving a Flamsa Sequential Chemotherapy Regimen Followed by Reduced-Intensity Conditioning (RIC) and Allogeneic Hematopoeitic Stem Cell Transplantation (allo-HSCT)

P. Chevallier, M. Mohty, X. Thomas, 2011 .

Immune stimulation during chemotherapy increases incidence of acute graft versus host disease in acute myeloid leukemia: A study on behalf of SFGM-TC and ALFA.

H. Dombret, I. Yakoub-Agha, E. Deconinck, 2017, Leukemia research.

Reduction of invasive aspergillosis incidence among immunocompromised patients after control of environmental exposure.

P. Vanhems, X. Thomas, A. Thiébaut, 2007, Clinical infectious diseases : an official publication of the Infectious Diseases Society of America.

Randomized Phase II Study of Clofarabine-Based Consolidation for Younger Adults With Acute Myeloid Leukemia in First Remission.

H. Dombret, S. Chevret, C. Preudhomme, 2017, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Daunorubicin versus mitoxantrone versus idarubicin as induction and consolidation chemotherapy for adults with acute myeloid leukemia: the EORTC and GIMEMA Groups Study AML-10.

M. Vignetti, F. Mandelli, R. Willemze, 2009, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

CD10 Expression in T-Lineage Adult Acute Lymphoblastic Leukemia

J. Magaud, X. Thomas, C. Charrin, 2001 .

Economic analysis of blood product transfusions according to the treatment of acute myeloid leukemia in the elderly.

X. Thomas, G. Cannas, J. Fattoum, 2015, Transfusion clinique et biologique : journal de la Societe francaise de transfusion sanguine.

Outcomes following hematopoietic stem cell transplantation in patients treated with standard chemotherapy with or without gemtuzumab ozogamicin for acute myeloid leukemia

H. Dombret, R. Benner, X. Thomas, 2021, Bone Marrow Transplantation.

Clonal dominance is an adverse prognostic factor in acute myeloid leukemia treated with intensive chemotherapy

J. Soulier, E. Clappier, H. Dombret, 2020, Leukemia.

Prognostic Significance of Concurrent Gene Mutations in Intensively Treated Patients with IDH1/2 Mutated AML

H. Dombret, C. Preudhomme, L. Adès, 2019, Blood.

CD34 expression is associated with major adverse prognostic factors in adult acute lymphoblastic leukemia.

J. Magaud, X. Thomas, C. Charrin, 1995, Leukemia.

Long-term follow-up of autologous stem cell transplantation after intensive chemotherapy in patients with myelodysplastic syndrome or secondary acute myeloid leukemia.

H. Dombret, A. Stamatoullas, E. Wattel, 2006, Haematologica.

Leukocytosis and circulating blasts in older adults with newly diagnosed acute myeloid leukemia: are they valuable factors for therapeutic decision-making?

C. Dumontet, X. Thomas, M. Elhamri, 2011, Clinical lymphoma, myeloma & leukemia.

Prognostic Index for Older Adult Patients with Newly Diagnosed Acute Myeloid Leukemia: The Edouard Herriot Hospital Experience

E. Wattel, C. Dumontet, X. Thomas, 2008 .

Prognostic value of immunophenotyping in elderly patients with acute myeloid leukemia

A. Plesa, C. Dumontet, X. Thomas, 2008, Cancer.

Non-infusional vs intravenous consolidation chemotherapy in elderly patients with acute myeloid leukemia: final results of the EORTC-GIMEMA AML-13 randomized phase III trial

F. Mandelli, G. Leone, R. Willemze, 2006, Leukemia.

A phase 1/2 trial of lenalidomide and dexamethasone in adult patients with refractory/relapsed acute lymphoblastic leukemia

X. Thomas, F. Tinquaut, A. Bourmaud, 2017, Hematology.

Potential for bispecific T-cell engagers: role of blinatumomab in acute lymphoblastic leukemia

X. Thomas, C. Le Jeune, 2016, Drug design, development and therapy.

Distribution of carboxypeptidase M on lymphoid and myeloid cells parallels the other zinc-dependent proteases CD10 and CD13.

J. Banchereau, S. Ho, X. Thomas, 1995, Blood.

Long‐term follow‐up of European APL 2000 trial, evaluating the role of cytarabine combined with ATRA and Daunorubicin in the treatment of nonelderly APL patients

H. Dombret, A. Vekhoff, S. Chevret, 2013, American journal of hematology.

Impact of Central Nervous System Involvement in Adult Patients with Acute Lymphoblastic Leukemia Treated in a Pediatrics-Inspired Protocol - a Graall Study

F. Pasquier, H. Dombret, S. Leprêtre, 2021, Blood.

Hierarchical Evaluation of Baseline Poor-Prognosis Factors and Response to Initial Therapy in Younger Adults with Ph-Negative Acute Lymphoblastic Leukemia (ALL) Treated in the Risk-Adapted GRAALL-2003 Study.

H. Dombret, E. Macintyre, A. Delannoy, 2005 .

Treatment of Philadelphia-Positive Acute Lymphocytic Leukemia (Ph+ ALL) in the Elderly with Imatinib Mesylate (STI571) and Chemotherapy.

H. Dombret, E. Macintyre, A. Delannoy, 2005 .

Efficacy of granulocyte and granulocyte-macrophage colony-stimulating factors in the induction treatment of adult acute lymphoblastic leukemia: a multicenter randomized study.

C. Gardin, X. Thomas, O. Boulat, 2004, The hematology journal : the official journal of the European Haematology Association.

No Superiority of Autologous Stem Cell Transplantation over Chemotherapy Alone in Adult Ph-Negative ALL in First Complete Remission A Long Follow-Up Report Combining Results of LALA 85, 87 and 94 Trials

J. Gabert, X. Thomas, C. Charrin, 2002 .

PAX5 P80R mutation identifies a novel subtype of B-cell precursor acute lymphoblastic leukemia with favorable outcome.

F. Sigaux, J. Soulier, E. Clappier, 2019, Blood.

Gemtuzumab Ozogamicin-Based Salvage, Followed by Allogeneic Hematopoietic Stem Cell Transplantation, Is Highly Effective in Young Patients with Core Binding Factor (CBF) Acute Myeloid Leukemia (AML) in First Relapse

H. Dombret, J. Tamburini, T. Cluzeau, 2011 .

Replacing the Anthracycline By Gemtuzumab Ozogamicin in Older Patients with De Novo Standard-Risk Acute Myeloid Leukemia Treated Intensively - Results of the Randomized ALFA1401-Mylofrance 4 Study

H. Dombret, C. Preudhomme, C. Gardin, 2021, Blood.

Measurable residual disease including AML leukemia stem cell flow evaluation of CPX-351 therapy by multi-parameter flow cytometry.

A. Plesa, X. Thomas, M. Elhamri, 2021, Leukemia research.

The Upper Age Limit for a Pediatric-Inspired Therapy in Younger Adults with Ph-Negative Acute Lymphoblastic Leukemia (ALL)? Analysis of the Graall-2005 Study

H. Dombret, E. Macintyre, S. Leprêtre, 2016 .

Blinatumomab: a new era of treatment for adult ALL?

X. Thomas, 2015, The Lancet. Oncology.

Efficiency of blinatumomab in a t(8;21) acute myeloid leukemia expressing CD19

G. Salles, A. Plesa, X. Thomas, 2019, Haematologica.

Post hoc analysis of the relationship between baseline white blood cell count and survival outcome in a randomized Phase III trial of decitabine in older patients with newly diagnosed acute myeloid leukemia

H. Kantarjian, X. Thomas, J. Delaunay, 2015, Journal of blood medicine.

Multivariate and Subgroup Analyses of a Multinational Phase III Trial of Decitabine in Older Patients with Newly Diagnosed Acute Myeloid Leukemia

H. Kantarjian, X. Thomas, J. Delaunay, 2012 .

A Post Hoc Landmark Analysis of Survival Probabilities in a Multinational Phase III Trial of Decitabine in Older Patients with Newly Diagnosed Acute Myeloid Leukemia

H. Kantarjian, X. Thomas, J. Delaunay, 2012 .

PCN121 Decitabine Reduces Transfusion Dependence in Older Patients With Acute Myeloid Leukaemia: Results From a Post-Hoc Analysis of a Randomised Phase III Trial

A. Howes, X. Thomas, L. Xiu, 2012 .

High risk myelodysplastic syndrome coexistent with chronic lymphocytic leukemia for more than 9 years: inhibition of the myeloid clone by the lymphoid clone?

B. Coiffier, X. Thomas, C. Charrin, 1991, Leukemia.

H. Kantarjian, F. Ravandi, X. Thomas, 2014, BMC Cancer.

Targeting leukemia stem cells: The new goal of therapy in adult acute myeloid leukemia.

X. Thomas, 2009, World journal of stem cells.

Proportion of long‐term event‐free survivors and lifetime of adult patients not cured after a standard acute lymphoblastic leukemia therapeutic program

R. Écochard, X. Thomas, Q. Le, 2007, Cancer.

Trisomy 8 as sole anomaly or with other clonal aberrations in acute myeloid leukemia: impact on clinical presentation and outcome.

X. Thomas, M. Elhamri, I. Tigaud, 2007, Leukemia research.

Acute leukemia during pregnancy

S. de Botton, X. Thomas, N. Vey, 2005, Cancer.

Cytogenetic clonal heterogeneity is not an independent prognosis factor in 15–60-year-old AML patients: results on 1291 patients included in the EORTC/GIMEMA AML-10 and AML-12 trials

A. Hagemeijer, F. Baron, R. Willemze, 2018, Annals of Hematology.

Towards a Pediatric Approach in Adults with Acute Lymphoblastic Leukemia (ALL): The GRAALL-2003 Study.

H. Dombret, E. Macintyre, A. Delannoy, 2006 .

The K247R Substitution in ABL Tyrosine Kinase Domain Is Not a Mutation Leading to Imatinib Resistance but a Polymorphism Rarely Present in CML Patients and in Normal Subjects.

J. Cayuela, J. Magaud, X. Thomas, 2005 .

Antifungal Prophylaxis in AML Patients Receiving Intensive Induction Chemotherapy: A Prospective Observational Study From the Acute Leukaemia French Association (ALFA) Group.

H. Dombret, S. Leprêtre, R. Gressin, 2021, Clinical lymphoma, myeloma & leukemia.

Influence of cigarette smoking on the presentation and course of acute myeloid leukemia.

X. Thomas, C. Charrin, Q. Le, 2002, Annals of oncology : official journal of the European Society for Medical Oncology.

Idarubicin or Mitoxantrone, VP-16, and Cytarabine for Induction/Consolidation Therapy Followed by Autologous Stem Cell Transplantation in Elderly Patients with Acute Myeloid Leukemia: A Feasibility Study

X. Thomas, E. Archimbaud, Claude D Martin, 1997 .

NOTCH1/FBXW7 Mutation Identifies a Large Subgroup with Favorable Outcome in Adult T-ALL: A GRAALL Study.

H. Dombret, E. Macintyre, M. Béné, 2008 .

Persistence of retinoic acid sensitivity in relapsed acute promyelocytic leukemia with extramedullary involvement.

X. Thomas, E. Archimbaud, D. Fiére, 1994, Leukemia.

Acute Promyelocytic Leukemia

X. Thomas, M. Heiblig, 2020, Cancers.

Improved survival with enasidenib versus standard of care in relapsed/refractory acute myeloid leukemia associated with IDH2 mutations using historical data and propensity score matching analysis

B. Quesnel, A. Wei, B. Hutton, 2021, Cancer medicine.

NPM1 mutation is not associated with prolonged complete remission in acute myeloid leukemia patients treated with hypomethylating agents

C. Preudhomme, P. Fenaux, T. Cluzeau, 2018, Haematologica.

Myelodysplastic syndromes: A study of surface markers and in vitro growth patterns

X. Thomas, C. Charrin, O. Gentilhomme, 1990, American journal of hematology.

THE LONG-TERM OUTCOME OF ELDERLY PATIENTS WITH PHILADELPHIA-POSITIVE ACUTE LYMPHOBLASTIC LEUKEMIA (PH plus ALL) IN THE IMATINIB ERA

H. Dombret, A. Delannoy, M. Béné, 2009 .

Maintenance with low-dose cytarabine for acute myeloid leukemia in complete remission

C. Sebban, X. Thomas, E. Archimbaud, 1992, Annals of Hematology.

Hepatomegaly and fever at the time of neutrophil recovery revealing L-asparaginase toxicity in the treatment of acute lymphoblastic leukemia

F. Berger, X. Thomas, J. Saison, 2014, The American journal of case reports.

Enasidenib vs conventional care in mutant-IDH2 relapsed/refractory acute myeloidleukemia: a randomized, phase 3 trial.

H. Döhner, P. Vyas, F. Thol, 2022, Blood.

CPX-351: an attractive option for the treatment of older patients with high-risk or secondary acute myeloid leukaemia.

A. Plesa, X. Thomas, 2021, The Lancet. Haematology.

Isatuximab monotherapy in patients with refractory T‐acute lymphoblastic leukemia or T‐lymphoblastic lymphoma: Phase 2 study

P. Chevallier, X. Thomas, G. Rossi, 2022, Cancer medicine.

[Effectiveness of combined vancomycin and pefloxacine in gastrointestinal decontamination for preventing infections after chemotherapy-induced bone marrow aplasia. A randomized double-blind study].

X. Thomas, A. Thiébaut, E. Archimbaud, 2000, Presse medicale.

Randomized Phase 2 Trial of Lirilumab (anti-KIR monoclonal antibody, mAb) As Maintenance Treatment in Elderly Patients (pts) with Acute Myeloid Leukemia (AML): Results of the Effikir Trial

H. Dombret, D. Olive, S. Leprêtre, 2017 .

Patient-Reported Disease Burden in the Elderly Patients with Acute Myeloid Leukemia

X. Thomas, Renee Pierson, Jianming He, 2017 .

The role of the K247R substitution in the ABL tyrosine kinase domain in sensitivity to imatinib.

J. Cayuela, X. Thomas, S. Hayette, 2006, Haematologica.

Idarubicin and Ifosfamide in the Treatment of Refractory and Relapsed Acute Lymphoblastic Leukemia

J. Rossi, P. Fenaux, X. Thomas, 1998 .

The prophylactic use of granulocyte-colony stimulating factor during remission induction is associated with increased leukaemia-free survival of adults with acute lymphoblastic leukaemia: a joint analysis of five randomised trials on behalf of the EWALL.

U. Jaeger, X. Thomas, E. Koller, 2012, European journal of cancer.

Allogeneic Hematopoietic Stem Cell Transplantation (HSCT) In Adults With Philadelphia Chromosome (Ph)-Negative Acute Lymphoblastic Leukemia (ALL): Results From The Group For Research On Adult ALL (GRAALL)

H. Dombret, P. Chevallier, D. Blaise, 2013 .

Results from a Global Randomized Phase 3 Study of Guadecitabine (G) Vs Treatment Choice (TC) in 815 Patients with Treatment Naïve (TN) AML Unfit for Intensive Chemotherapy (IC) ASTRAL-1 Study: Analysis By Number of Cycles

H. Döhner, W. Jędrzejczak, J. Issa, 2019, Blood.

Progression Free Survival (PFS), and Event Free Survival (EFS) from a Global Randomized Phase 3 Study of Guadecitabine (G) Vs Treatment Choice (TC) in 815 Patients with Treatment Naïve (TN) AML Unfit for Intensive Chemotherapy (IC): ASTRAL-1 Study

H. Döhner, W. Jędrzejczak, J. Issa, 2019, Blood.

Prognostic Impact of Monoallelic Versus Biallelic TP53 Alterations in Intensively-Treated Adults AML Patients: A Retrospective Study from the ALFA Group

H. Dombret, C. Preudhomme, T. Cluzeau, 2022, Blood.

Oral Mucositis After Allogeneic Hematopoietic Stem Cell Transplantation: Important Impact Of The Presence Of Aciclovir-Resistant Herpes Simplex Virus (HSV-1) On Its Occurrence

X. Thomas, B. Lina, V. Escuret, 2013 .

Sickle cell disease and acute leukemia: one case report and an extensive review

X. Thomas, A. Hot, G. Cannas, 2023, Annals of Hematology.

Chronic disseminated candidiasis and acute leukemia: Impact on survival and hematopoietic stem cell transplantation agenda.

X. Thomas, M. Le Maréchal, M. Michallet, 2018, Medecine et maladies infectieuses.

The Odyssee Study: Prevention of Dysbiosis Complications with Autologous Fecal Microbiota Transfer (FMT) in Acute Myeloid Leukemia (AML) Patients Undergoing Intensive Treatment: Results of a Prospective Multicenter Trial

A. Vekhoff, P. Chevallier, M. Mohty, 2018, Blood.

PF263 DEEP RESPONSE AFTER CPX-351 TREATMENT IN T-AML AND MRC-AML: A REPORT FROM A MULTICENTRIC FRENCH COHORT

P. Chevallier, T. Cluzeau, M. Sébert, 2019, HemaSphere.

Impact of ATRA Duration during the Induction Treatment of Newly Diagnosed APL

H. Dombret, A. Vekhoff, S. Chevret, 2008 .

Allogenic Stem Cell Transplantation Abrogates Negative Impact on Outcome of AML Patients with KMT2A Partial Tandem Duplication

X. Thomas, S. Hayette, A. Bidet, 2021, Cancers.

5'-(3')-nucleotidase mRNA levels in blast cells are a prognostic factor in acute myeloid leukemia patients treated with cytarabine.

J. Mackey, C. Galmarini, C. Dumontet, 2004, Haematologica.

Case report: Purulent transformation of granulocytic sarcoma

G. Salles, X. Thomas, I. Tigaud, 2018, Medicine.

A new signaling cascade linking BMP4, BMPR1A, ΔNp73 and NANOG impacts on stem-like human cell properties and patient outcome

C. Caron de Fromentel, T. Voeltzel, X. Thomas, 2018, Cell Death & Disease.

Gut microbiota diversity after autologous fecal microbiota transfer in acute myeloid leukemia patients

A. Vekhoff, P. Chevallier, M. Mohty, 2021, Nature Communications.

Olutasidenib (FT-2102) induces durable complete remissions in patients with relapsed or refractory IDH1-mutated AML

J. Cortes, A. Khwaja, P. Fenaux, 2023, Blood advances.

Arsenic Trioxide (AS2O3) Therapy for Relapsed Acute Promyelocytic Leukemia (APL): Comparison with a Historic Control Combining All-Trans Retinoic Acid (ATRA) Plus Intensive Chemotherapy.

A. Stamatoullas, M. Bernard, P. Fenaux, 2005 .

Gene Mutations and Minimal Residual Disease (MRD) As Predictors of Remission Duration in Adults with Core Binding Factor (CBF) Acute Myeloid Leukemia (AML) Treated with High-Dose Cytarabine (HDAC) - First Results of the Prospective French Intergroup CBF-2006 Trial

J. Cayuela, H. Dombret, M. Béné, 2011 .

Clinical, pharmacokinetic and pharmacodynamic data for the MEK1/2 inhibitor pimasertib in patients with advanced hematologic malignancies

T. Kadia, F. Ravandi, D. DeAngelo, 2015, Blood Cancer Journal.

Clinical activity of ERY001 (erythrocyte encapsulated l-asparaginase) and native l-asparaginase (L-ASP) in combination with COOPRALL regimen in phase III randomized trial in patients with relapsed acute lymphoblastic leukemia (ALL).

A. Baruchel, J. Stéphan, X. Thomas, 2015 .

Leukemia stem cells and new strategies to overcome resistance to therapy.

X. Thomas, G. Cannas, 2010, Current Stem Cell Research & Therapy.

Imatinib combined with induction or consolidation chemotherapy in patients with de novo Philadelphia chromosome – positive acute lymphoblastic leukemia : results of the GRAAPH-2003 study

J. Cayuela, H. Dombret, E. Macintyre, 2007 .

T-cell lineage acute lymphoblastic leukemia with chromosome 5 abnormality in a patient with Crohn's disease and lipoid nephrosis

X. Thomas, C. Charrin, H. Jaumain, 2000, Annals of Hematology.

International phase 3 study of azacitidine vs conventional care regimens in older patients with newly diagnosed AML with >30% blasts.

R. Greil, H. Döhner, M. Minden, 2015, Blood.

A white blood cell index as the main prognostic factor in t(8;21) acute myeloid leukemia (AML): a survey of 161 cases from the French AML Intergroup.

H. Dombret, G. Leverger, D. Blaise, 2002, Blood.

Is ARAC Required in the Treatment of Newly Diagnosed APL? Results of a Randomized Trial (APL 2000).

H. Dombret, A. Stamatoullas, A. Vekhoff, 2004 .

lymphoblastic leukemia Recurrent involvement of the MLL gene in adult T-lineage acute

J. Magaud, R. Rimokh, X. Thomas, 2013 .

Treatment of Philadelphia-Positive Acute Lymphocytic Leukemia (Ph+ ALL) in the Elderly with Imatinib Mesylate (STI571) and Chemotherapy. an Interim Analysis of the GRAALL AFR09 Trial.

H. Dombret, E. Macintyre, A. Delannoy, 2004 .

Impact on Transplant Outcome of Karyotyping Analysis in Apheresis Products for Autologous PBSC Transplantation in De Novo Acute Leukemias (AL).

X. Thomas, I. Tigaud, C. Charrin, 2004 .

Potential for bispecific T-cell engagers: role of blinatumomab in acute lymphoblastic leukemia

X. Thomas, Caroline Le Jeune, 2016 .

Outcome of Treatment after First Relapse in Adults Patients with Acute Lymphoblastic Leukemia (ALL) Initially Treated by the LALA-94 Trial.

A. Stamatoullas, A. Delannoy, J. Gabert, 2006 .

Guadecitabine vs treatment choice in newly diagnosed acute myeloid leukemia: a global phase 3 randomized study

K. Döhner, H. Döhner, W. Jędrzejczak, 2023, Blood Advances.

Imatinib combined with induction or consolidation chemotherapy in patients with de novo Philadelphia chromosome – positive acute lymphoblastic leukemia : results of the GRAAPH-2003 study

J. Cayuela, H. Dombret, E. Macintyre, 2007 .

Preventive Versus Curative Platelet Transfusion Strategies in the Treatment of Acute Myeloid Leukemia Patients: A Comparative Study

X. Thomas, J. Rey, N. Vey, 2014 .

Core-binding factor acute myeloid leukemia in first relapse: a retrospective study from the French AML Intergroup.

H. Dombret, J. Tamburini, T. Cluzeau, 2014, Blood.

Current Management of Adult Acute Lymphoblastic Leukaemia: Emerging Insights and Outstanding Questions

X. Thomas, C. Le Jeune, 2016, EMJ Hematology.

Clofarabine for the treatment of adult acute myeloid leukemia.

H. Dombret, X. Thomas, M. Elhamri, 2009, Future oncology.

A randomized study of pegylated liposomal doxorubicin versus continuous-infusion doxorubicin in elderly patients with acute lymphoblastic leukemia: the GRAALL-SA1 study

H. Dombret, A. Delannoy, P. Chevallier, 2011, Haematologica.

Higher percentage of CD34 + CD38− cells detected by multiparameter flow cytometry from leukapheresis products predicts unsustained complete remission in acute myeloid leukemia

A. Plesa, C. Dumontet, X. Thomas, 2015, Leukemia & lymphoma.

Imatinib combined with induction or consolidation chemotherapy in patients with de novo Philadelphia chromosome-positive acute lymphoblastic leukemia: results of the GRAAPH-2003 study.

J. Cayuela, H. Dombret, E. Macintyre, 2007, Blood.

Rituximab in B-Lineage Adult Acute Lymphoblastic Leukemia.

H. Dombret, S. Chevret, P. Chevallier, 2016, The New England journal of medicine.

Impact of central nervous system involvement in adult patients with Philadelphia-negative acute lymphoblastic leukemia: a GRAALL-2005 study.

H. Dombret, S. Leprêtre, P. Chevallier, 2023, Haematologica.

Long-term use of liposomal nebulized amikacin and tedizolid for the treatment of disseminated nocardiosis after allogeneic hematopoietic stem cell transplantation

D. Lebeaux, X. Thomas, B. Lina, 2021, European Journal of Clinical Microbiology & Infectious Diseases.

Azacitidine in untreated acute myeloid leukemia: A report on 149 patients

H. Dombret, A. Stamatoullas, B. Quesnel, 2014, American journal of hematology.

HHV-6 infection after allogeneic hematopoietic stem cell transplantation: From chromosomal integration to viral co-infections and T-cell reconstitution patterns.

X. Thomas, V. Escuret, F. Barraco, 2016, The Journal of infection.

Invasive aspergillosis in patients with hematologic malignancies: incidence and description of 127 cases enrolled in a single institution prospective survey from 2004 to 2009

N. Voirin, P. Vanhems, X. Thomas, 2011, Haematologica.

A single dose pegfilgrastim for supporting neutrophil recovery in patients treated for high-risk acute myeloid leukemia by the EMA 2000 schedule

X. Thomas, M. Elhamri, F. Barraco, 2010, Hematology.

Impact of Post-Remission Treatments in Patients Aged 65–70 Years with De Novo AML: A Comparison of Two Concomitant Randomized ALFA Trials with Overlapping Age Inclusion Criteria

H. Dombret, C. Gardin, X. Thomas, 2008 .

Long-Term Survival Analysis in Older Patients with AML Treated Intensively: Positive Impact of Idarubicin in a Cure Fraction Estimation Model.

H. Dombret, S. Chevret, B. Quesnel, 2008 .

High-dose cytarabine in induction treatment improves the outcome of adult patients younger than age 46 years with acute myeloid leukemia: results of the EORTC-GIMEMA AML-12 trial.

A. Hagemeijer, M. Vignetti, F. Mandelli, 2014, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Randomized Phase II Study of Clofarabine-Based Consolidation for Younger Adults With Acute Myeloid Leukemia in First Remission.

H. Dombret, S. Chevret, C. Preudhomme, 2017, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Intensive Consolidation with Clofarabine and Intermediate-Dose Cytarabine (CLARA) in Patients with High-Risk AML in First CR: The ALFA-0702 Pilot Study.

J. Cayuela, H. Dombret, X. Thomas, 2008 .

A randomized phase 3 study of tipifarnib compared with best supportive care, including hydroxyurea, in the treatment of newly diagnosed acute myeloid leukemia in patients 70 years or older.

W. Jędrzejczak, H. Dombret, G. Martinelli, 2007, Blood.

Long-term follow-up of the imatinib GRAAPH-2003 study in newly diagnosed patients with de novo Philadelphia chromosome-positive acute lymphoblastic leukemia: a GRAALL study.

J. Cayuela, H. Dombret, M. Vekemans, 2013, Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation.

Frequency and Outcome of Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia with BCR-ABL1 Clonal Hematopoiesis after Blast Clearance: Results from the Graaph-2014 Trial

J. Soulier, E. Clappier, J. Cayuela, 2021, Blood.

The rationale and use of hypomethylation agents in adult acute myeloid leukemia

X. Thomas, F. Barraco, Y. Chelghoum, 2009, Expert opinion on drug discovery.

Sequential Chemotherapy Followed By Reduced Intensity Conditioning and Allogeneic Hematopoietic Transplantation For High Risk Acute Myeloid Leukemia Patients In First Complete Remission: A Prospective Pilot Study

X. Thomas, S. Hayette, I. Tigaud, 2013 .

Long-term follow-up of autologous stem cell transplantation after intensive chemotherapy in patients with myelodysplastic syndrome or secondary acute myeloid leukemia.

H. Dombret, A. Stamatoullas, E. Wattel, 2006, Haematologica.

Thrombopoietic factors potentially useful in the treatment of acute leukemia.

X. Thomas, E. Archimbaud, 1998, Leukemia research.