D. Chattopadhyay

发表

Inactivation of p21 by E1A Leads to the Induction of Apoptosis in DNA-Damaged Cells

D. Chattopadhyay, Mrinal K. Ghosh, A. Mal, 2001, Journal of Virology.

The tomato genome sequence provides insights into fleshy fruit evolution

Daniel W. A. Buchan, James R. White, James R. Knight, 2012, Nature.

A draft genome sequence of the pulse crop chickpea (Cicer arietinum L.).

Mukesh Jain, D. Chattopadhyay, A. Tyagi, 2013, The Plant journal : for cell and molecular biology.

Crystallization and preliminary X-ray diffraction analysis of protein L-isoaspartyl O-methyltransferase from wheat germ.

E. Meehan, D. Chattopadhyay, C. Smith, 2001, Acta crystallographica. Section D, Biological crystallography.

Structure of the RWJ-51084–bovine pancreatic β-trypsin complex at 1.8 Å

L. DeLucas, M. Carson, D. Chattopadhyay, 1999 .

Adaptation of plants to salt stress: the role of the ion transporters

D. Chattopadhyay, Paheli Malakar, 2021, Journal of Plant Biochemistry and Biotechnology.

Uropathogenic Escherichia coli Engages CD14-Dependent Signaling to Enable Bladder-Macrophage-Dependent Control of Acute Urinary Tract Infection.

M. Sweet, D. Chattopadhyay, D. Crossman, 2016, The Journal of infectious diseases.

Enhanced viral intergenic region-specific short interfering RNA accumulation and DNA methylation correlates with resistance against a geminivirus.

R. Yadav, D. Chattopadhyay, 2011, Molecular plant-microbe interactions : MPMI.

Oxygen Sensing : Life and Death of a Cell Insulin-induced activation of hypoxia-inducible factor-1 requires generation of reactive oxygen species by NADPH oxidase

S. Biswas, D. Chattopadhyay, M. Gupta, 2007 .

Biochemical and structural characterization of Cryptosporidium parvum Lactate dehydrogenase.

W. Cook, D. Chattopadhyay, O. Senkovich, 2015, International journal of biological macromolecules.

Bmc Structural Biology Crystal Structure of Vaccinia Virus Uracil-dna Glycosylase Reveals Dimeric Assembly

L. DeLucas, N. Schormann, D. Chattopadhyay, 2007 .

N-terminal region of P protein of Chandipura virus is responsible for phosphorylation-mediated homodimerization.

D. Chattopadhyay, S. Basak, A. Majumdar, 2000, Protein engineering.

Effect of Osmolytes and Chaperone-like Action of P-protein on Folding of Nucleocapsid Protein of Chandipura Virus*

Siddhartha Roy, S. Roy, D. Chattopadhyay, 2001, The Journal of Biological Chemistry.

P21 and Retinoblastoma Protein Control the Absence of DNA Replication in Terminally Differentiated Muscle Cells

T. Hunter, D. Chattopadhyay, A. Mal, 2000, The Journal of cell biology.

Crystal structure of Trypanosoma cruzi pteridine reductase 2 in complex with a substrate and an inhibitor.

L. DeLucas, N. Schormann, M. Carson, 2005, Journal of structural biology.

Crystal Structure of Cryptosporidium parvum Pyruvate Kinase

W. Cook, D. Chattopadhyay, O. Senkovich, 2012, PloS one.

Genome Analysis Gene Discovery and Tissue-Specific Transcriptome Analysis in Chickpea with Massively Parallel Pyrosequencing and Web Resource Development 1

Mukesh Jain, D. Chattopadhyay, A. Tyagi, 2011 .

A repeat length variation in myo-inositol monophosphatase gene contributes to seed size trait in chickpea

D. Chattopadhyay, V. Dwivedi, S. Parida, 2017, Scientific Reports.

The chickpea genomic web resource: visualization and analysis of the desi-type Cicer arietinum nuclear genome for comparative exploration of legumes

Mukesh Jain, D. Chattopadhyay, A. Tyagi, 2014, BMC Plant Biology.

Streptococcus agalactiae glyceraldehyde-3-phosphate dehydrogenase (GAPDH) elicits multiple cytokines from human cells and has a minor effect on bacterial persistence in the murine female reproductive tract

D. Chattopadhyay, G. Ulett, M. Sullivan, 2021, Virulence.

Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea

Mukesh Jain, D. Chattopadhyay, R. Gaur, 2015, PloS one.

Crystallization and preliminary X-ray diffraction analysis of three recombinant mutants of Vaccinia virus uracil DNA glycosylase.

N. Schormann, R. Ricciardi, D. Chattopadhyay, 2013, Acta crystallographica. Section F, Structural biology and crystallization communications.

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA Glycosylase

N. Schormann, R. Ricciardi, D. Chattopadhyay, 2015, BMC Structural Biology.

Small Molecule Inhibition of the Ubiquitin-specific Protease USP2 Accelerates cyclin D1 Degradation and Leads to Cell Cycle Arrest in Colorectal Cancer and Mantle Cell Lymphoma Models*

Jennifer T. Fox, Mindy I. Davis, L. DeLucas, 2016, The Journal of Biological Chemistry.

Novel structure of the N-terminal helical domain of BibA, a group B streptococcus immunogenic bacterial adhesin.

S. Narayana, A. Blom, D. Chattopadhyay, 2020, Acta crystallographica. Section D, Structural biology.

Genome duplication and transposon mediated gene alteration shapes the pathogenicity of Rhizoctonia solani AG1-IA

D. Chattopadhyay, G. Jha, Srayan Ghosh, 2022, bioRxiv.

Draft genome sequencing and secretome analysis of fungal phytopathogen Ascochyta rabiei provides insight into the necrotrophic effector repertoire

Rajesh Kumar Gazara, P. Verma, D. Chattopadhyay, 2016, Scientific Reports.

Lipophilic Antifolate Trimetrexate Is a Potent Inhibitor of Trypanosoma cruzi: Prospect for Chemotherapy of Chagas' Disease

D. Chattopadhyay, N. Garg, O. Senkovich, 2005, Antimicrobial Agents and Chemotherapy.

Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement

K. Sahu, Rishi Srivastava, D. Chattopadhyay, 2016, DNA research : an international journal for rapid publication of reports on genes and genomes.

Hemolytic activity and biofilm-formation among clinical isolates of group B streptococcus causing acute urinary tract infection and asymptomatic bacteriuria.

D. Chattopadhyay, G. Ulett, M. Sullivan, 2021, International journal of medical microbiology : IJMM.

Expression of CAP2, an APETALA2-Family Transcription Factor from Chickpea, Enhances Growth and Tolerance to Dehydration and Salt Stress in Transgenic Tobacco1[W]

D. Chattopadhyay, S. Raha, R. Shukla, 2006, Plant Physiology.

A Snapshot of the Emerging Tomato Genome Sequence

Giorgio Valle, Ying Wang, Vikrant Gupta, 2009 .

Tomato Genomic Resources Database: An Integrated Repository of Useful Tomato Genomic Information for Basic and Applied Research

K. Sahu, D. Chattopadhyay, Gopal Misra, 2014, PloS one.

Genome-wide sequence variations between wild and cultivated tomato species revisited by whole genome sequence mapping

K. Sahu, D. Chattopadhyay, 2017, BMC Genomics.

Isolation and sequence analysis of DREB2A homologues in three cereal and two legume species

Kenneth L. McNally, M. Baum, R. Varshney, 2009 .

Expression of CAP 2 , an APETALA 2-Family Transcription Factor from Chickpea , Enhances Growth and Tolerance to Dehydration and Salt Stress in Transgenic Tobacco 1 [ W ]

D. Chattopadhyay, S. Raha, R. Shukla, 2006 .

Single serine phosphorylation within the acidic domain of Chandipura virus P protein regulates the transcription in vitro.

D. Chattopadhyay, T. Raha, 1997, Virology.

Promoter of CaZF, a Chickpea Gene That Positively Regulates Growth and Stress Tolerance, Is Activated by an AP2-Family Transcription Factor CAP2

D. Jain, D. Chattopadhyay, 2013, PloS one.

Toxoplasma gondii adenosine kinase: expression, purification, characterization, crystallization and preliminary crystallographic analysis.

L. DeLucas, D. Chattopadhyay, A. Talalaev, 2000, Acta crystallographica. Section D, Biological crystallography.

Structural study of Escherichia coli NAD synthetase: overexpression, purification, crystallization, and preliminary crystallographic analysis.

L. DeLucas, D. Chattopadhyay, C. Ozment, 1999, Journal of structural biology.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of uracil phosphoribosyltransferase of Toxoplasma gondii.

L. DeLucas, J. Symerský, S. Narayana, 1999, Acta crystallographica. Section D, Biological crystallography.

Crystallization and preliminary cryogenic X‐ray diffraction analyses of protein L‐isoaspartyl O‐methyltransferase from human fetal brain

L. DeLucas, Craig D. Smith, T. Shirasawa, 1997, Proteins.

XXXIV Appendix ATTTGGATCTGTTAATGCTTGCAGGGGCAGTCTGAAAGTGGCAGAACGCCACCAT GAACGCTTCGTACTTCTGAATCAAACATCCATCGTTGTCAATACCCCACATTCCA ACGCTATCAAGAAATTGTGCATTCGTAACTGCATTTCGGGAACTTACACAACCTG GGTAACGTTCAAGGACGAAGAAGAAGATAGCTGTACTGGACGATATTCTAACAC CCTCCGAAATGCAATTATTTTATATTATGTATGGTTAAGCGATGTATCCTCACAAG TCGAT

S. Chakraborty, D. Chattopadhyay, P. Sahu, 2013 .

Tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus-specific short interfering RNA accumulation and defence-associated host gene expression.

N. Rai, S. Chakraborty, D. Chattopadhyay, 2010, Molecular plant pathology.

Conformationally Defined Rexinoids for the Prevention of Inflammation and Nonmelanoma Skin Cancers.

C. Elmets, M. Athar, D. Chattopadhyay, 2022, Journal of medicinal chemistry.

Development of Tn5 Mutants of Cicer-Rhizobium Strains Tolerant to Nitrate under Symbiotic Condition

D. Chattopadhyay, M. L. Lodha, 2012, Journal of Plant Biochemistry and Biotechnology.

Lignin deposition in chickpea root xylem under drought

N. Sharma, D. Chattopadhyay, S. Gupta, 2020, Plant signaling & behavior.

Soybean cultivar resistant to Mungbean Yellow Mosaic India Virus infection induces viral RNA degradation earlier than the susceptible cultivar.

R. Yadav, D. Chattopadhyay, R. Shukla, 2009, Virus research.

Differential soybean gene expression during early phase of infection with Mungbean yellow mosaic India virus

R. Yadav, D. Chattopadhyay, 2014, Molecular Biology Reports.

Identification of inhibitors that block vaccinia virus infection by targeting the DNA synthesis processivity factor D4.

N. Schormann, R. Ricciardi, D. Chattopadhyay, 2011, Journal of medicinal chemistry.

Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase.

N. Schormann, S. Velu, B. Chenna, 2010, Bioorganic & medicinal chemistry.

An Updated Conceptual Model on the Pathogenesis of Bacterial Vaginosis.

Christopher M. Taylor, D. Chattopadhyay, J. Schwebke, 2019, The Journal of infectious diseases.

Crystal structure of calcium bound domain VI of calpain at 1.9 Å resolution and its role in enzyme assembly, regulation, and inhibitor binding

L. DeLucas, M. Carson, G. Lin, 1997, Nature Structural Biology.

Role of DREB-Like Proteins in Improving Stress Tolerance of Transgenic Crops

D. Jain, D. Chattopadhyay, 2013 .

Long Term Transcript Accumulation during the Development of Dehydration Adaptation in Cicer arietinum1

P. Verma, D. Chattopadhyay, R. Shukla, 2004, Plant Physiology.

Display of disparate transcription phenotype by the phosphorylation negative P protein mutants of vesicular stomatitis virus, Indiana serotype, expressed in E. coli and eucaryotic cells.

J. Chen, D. Chattopadhyay, A. Banerjee, 1997, Gene expression.

Rapid Bladder Interleukin-10 Synthesis in Response to Uropathogenic Escherichia coli Is Part of a Defense Strategy Triggered by the Major Bacterial Flagellar Filament FliC and Contingent on TLR5

D. Chattopadhyay, D. Crossman, G. Ulett, 2019, mSphere.

Selective Phosphorylation of Antiviral Drugs by Vaccinia Virus Thymidine Kinase

S. Qiu, M. Luo, D. Chattopadhyay, 2007, Antimicrobial Agents and Chemotherapy.

Role of CIPK6 in root growth and auxin transport

Nazia Syed, D. Chattopadhyay, Ashverya Laxmi, 2009, Plant signaling & behavior.

Structures of vaccinia virus dUTPase and its nucleotide complexes.

L. DeLucas, N. Schormann, W. Cook, 2007, Acta crystallographica. Section D, Biological crystallography.

CIPK6, a CBL-interacting protein kinase is required for development and salt tolerance in plants.

D. Chattopadhyay, Ashverya Laxmi, V. Tripathi, 2009, The Plant journal : for cell and molecular biology.

Purification and characterization of heterodimeric human immunodeficiency virus type 1 (HIV-1) reverse transcriptase produced by in vitro processing of p66 with recombinant HIV-1 protease.

A. Tomasselli, R. Heinrikson, D. B. Evans, 1992, The Journal of biological chemistry.

Resolution of microheterogeneity associated with recombinant HIV-1 heterodimeric reverse transcriptase.

D. Chattopadhyay, H. Einspahr, M. Deibel, 1992, Protein expression and purification.

High density linkage mapping of genomic and transcriptomic SNPs for synteny analysis and anchoring the genome sequence of chickpea

Mukesh Jain, D. Chattopadhyay, R. Gaur, 2015, Scientific Reports.

High-Throughput SNP Discovery and Genotyping for Constructing a Saturated Linkage Map of Chickpea (Cicer arietinum L.)

Gitanjali Yadav, Sabhyata Bhatia, Akhilesh K. Tyagi, 2012, DNA research : an international journal for rapid publication of reports on genes and genomes.

Crystal structure of human carbonic anhydrase II complexed with an anti-convulsant sugar sulphamate.

D. Chattopadhyay, B. Maryanoff, R. Recacha, 2002, The Biochemical journal.

An advanced draft genome assembly of a desi type chickpea (Cicer arietinum L.)

Mukesh Jain, D. Chattopadhyay, Kashif Nawaz, 2015, Scientific Reports.

PLecDom: a program for identification and analysis of plant lectin domains

Gitanjali Yadav, Smriti Shridhar, Debasis Chattopadhyay, 2009, Nucleic Acids Res..

CaZF, a Plant Transcription Factor Functions through and Parallel to HOG and Calcineurin Pathways in Saccharomyces cerevisiae to Provide Osmotolerance

D. Jain, D. Chattopadhyay, N. Roy, 2009, PloS one.

CaZF, a Plant Transcription Factor Functions through and Parallel to HOG and Calcineurin Pathways in Saccharomyces cerevisiae to Provide Osmotolerance

D. Jain, D. Chattopadhyay, N. Roy, 2009, PloS one.

MicroRNA profiling provides insights into post-transcriptional regulation of gene expression in chickpea root apex under salinity and water deficiency

D. Chattopadhyay, M. Meena, Riti Roy, 2017, Scientific Reports.

Gene Discovery and Tissue-Specific Transcriptome Analysis in Chickpea with Massively Parallel Pyrosequencing and Web Resource Development1[W][OA]

Mukesh Jain, D. Chattopadhyay, A. Tyagi, 2011, Plant Physiology.

Crystal structures and mutagenesis of PPP-family ser/thr protein phosphatases elucidate the selectivity of cantharidin and novel norcantharidin-based inhibitors of PP5C.

Jennifer E. Golden, Wade H. Dunham, A. Gingras, 2016, Biochemical pharmacology.

The Tomato Sequencing Project, the First Cornerstone of the International Solanaceae Project (SOL)

Lukas A. Mueller, Antonio Granell, Dani Zamir, 2005, Comparative and functional genomics.

Two divergent genes encoding L-myo-inositol 1-phosphate synthase1 (CaMIPS1) and 2 (CaMIPS2) are differentially expressed in chickpea.

D. Chattopadhyay, G. Yadav, R. Shukla, 2008, Plant, cell & environment.

Light regulated modulation of Z-box containing promoters by photoreceptors and downstream regulatory components, COP1 and HY5, in Arabidopsis.

X. Deng, N. Wei, D. Chattopadhyay, 2002, The Plant journal : for cell and molecular biology.

Leader RNA binding ability of Chandipura virus P protein is regulated by its phosphorylation status: a possible role in genome transcription-replication switch.

D. Chattopadhyay, S. Basak, M. Shaila, 2003, Virology.

A chickpea genetic variation map based on the sequencing of 3,366 genomes

M. S. Pithia, Huanming Yang, Jian Wang, 2021, Nature.

Development of eSSR-Markers in Setaria italica and Their Applicability in Studying Genetic Diversity, Cross-Transferability and Comparative Mapping in Millet and Non-Millet Species

Sarika Gupta, D. Chattopadhyay, M. Muthamilarasan, 2013, PloS one.

Root‐specific expression of chickpea cytokinin oxidase/dehydrogenase 6 leads to enhanced root growth, drought tolerance and yield without compromising nodulation

N. Sharma, D. Chattopadhyay, S. Gupta, 2020, Plant biotechnology journal.

Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance

D. Jain, D. Chattopadhyay, 2010, BMC Plant Biology.

Structure of the catalytic domain of Plasmodium falciparum ARF GTPase-activating protein (ARFGAP).

W. Cook, D. Chattopadhyay, O. Senkovich, 2011, Acta crystallographica. Section F, Structural biology and crystallization communications.

Structure of the nucleotide-binding domain of Plasmodium falciparum rab6 in the GDP-bound form.

L. DeLucas, M. Carson, D. Chattopadhyay, 2000, Acta crystallographica. Section D, Biological crystallography.

Crystal structure of human carbonic anhydrase II complexed with an anticonvulsant sugar sulphamate

D. Chattopadhyay, B. Maryanoff, R. Recacha, 2022 .

A phosphorylation-induced major structural change in the N-terminal domain of the P protein of Chandipura virus.

S. Roy, D. Chattopadhyay, T. Raha, 1999, Biochemistry.

Cloning of the chandipura virus phosphoprotein encoding gene and its expression in Escherichia coli.

D. Chattopadhyay, 1994, Cellular & molecular biology research.

Identification of Protein-Protein Interaction Inhibitors Targeting Vaccinia Virus Processivity Factor for Development of Antiviral Agents

James W. Noah, Mark N. Prichard, N. Schormann, 2011, Antimicrobial Agents and Chemotherapy.

Identiﬁcation of Protein-Protein Interaction Inhibitors Targeting Vaccinia Virus Processivity Factor for Development of Antiviral Agents (cid:1) †

N. Schormann, R. Ricciardi, D. Chattopadhyay, 2011 .

Uracil‐DNA glycosylases—Structural and functional perspectives on an essential family of DNA repair enzymes

N. Schormann, R. Ricciardi, D. Chattopadhyay, 2014, Protein science : a publication of the Protein Society.

CAP2 enhances germination of transgenic tobacco seeds at high temperature and promotes heat stress tolerance in yeast

D. Jain, R. Yadav, D. Chattopadhyay, 2009, The FEBS journal.

The MicroRNA397b-LACCASE2 Module Regulates Root Lignification under Water and Phosphate Deficiency1

D. Chattopadhyay, A. Singh, H. Khandal, 2020, Plant Physiology.

A repeat length variation in myo-inositol monophosphatase gene contributes to seed size trait in chickpea

D. Chattopadhyay, V. Dwivedi, S. Parida, 2017, Scientific Reports.

Poxvirus uracil‐DNA glycosylase—An unusual member of the family I uracil‐DNA glycosylases

P. Prevelige, N. Schormann, R. Gillilan, 2016, Protein science : a publication of the Protein Society.

Vaccinia Virus D4 Mutants Defective in Processive DNA Synthesis Retain Binding to A20 and DNA

R. Ricciardi, D. Chattopadhyay, Janice Elaine Y. Silverman, 2010, Journal of Virology.

Crystal structure of adenosine kinase from Toxoplasma gondii at 1.8 Å resolution

L. DeLucas, W. Cook, D. Chattopadhyay, 2000, Protein science : a publication of the Protein Society.

Structure of Streptococcus agalactiae glyceraldehyde-3-phosphate dehydrogenase holoenzyme reveals a novel surface.

N. Schormann, D. Chattopadhyay, G. Ulett, 2014, Acta crystallographica. Section F, Structural biology communications.

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

W. Cook, D. Chattopadhyay, O. Senkovich, 2009, BMC Structural Biology.

Plasmodium falciparum rab6 GTPase: expression, purification, crystallization and preliminary crystallographic studies.

D. Chattopadhyay, C. Smith, G. Langsley, 2000, Acta crystallographica. Section D, Biological crystallography.

The Plasmodium falciparum family of Rab GTPases.

Emmanuel Quevillon, Edouard Yeramian, Gordon Langsley, 2003, Gene.

CBL-interacting protein kinase 6 negatively regulates immune response to Pseudomonas syringae in Arabidopsis

D. Chattopadhyay, A. Nandi, Atish Sardar, 2017, Journal of experimental botany.

Expression of chickpea CIPK25 enhances root growth and tolerance to dehydration and salt stress in transgenic tobacco

D. Chattopadhyay, M. Meena, V. Dwivedi, 2015, Front. Plant Sci..

Large-scale preparation of the Δ10 form of staphylokinase by in vitro processing of recombinant staphylokinase with purified human plasminogen

D. Chattopadhyay, J. Stewart, Lawrence J. DeLucas, 1998, Applied biochemistry and biotechnology.

Genome-Wide Development and Use of Microsatellite Markers for Large-Scale Genotyping Applications in Foxtail Millet [Setaria italica (L.)]

Sarika Gupta, D. Chattopadhyay, G. Pandey, 2013, DNA research : an international journal for rapid publication of reports on genes and genomes.

Mechanism of Nitrate Tolerance in Tn5 Mutants of Cicer-Rhizobium Strains

D. Chattopadhyay, M. L. Lodha, 1993, Journal of Plant Biochemistry and Biotechnology.

Expression, purification, crystallization and preliminary crystallographic analysis of recombinant pteridine reductase of Trypanosoma cruzi.

N. Schormann, D. Chattopadhyay, B. Pal, 2001, Acta crystallographica. Section D, Biological crystallography.

CBL-interacting protein kinase 25 contributes to root meristem development

D. Chattopadhyay, V. Tripathi, Mukesh Kumar Meena, 2018, Journal of experimental botany.

Crystal structure of the N-terminal domain of the fibronectin-binding protein PavA from Streptococcus pneumoniae.

S. Narayana, D. Chattopadhyay, K. Manne, 2019, Acta crystallographica. Section F, Structural biology communications.

Structure of human alpha-thrombin complexed with RWJ-51438 at 1.7 A: unusual perturbation of the 60A-60I insertion loop.

L. DeLucas, M. Carson, D. Chattopadhyay, 2000, Acta crystallographica. Section D, Biological crystallography.

Mosquito Bite-Induced Controlled Human Malaria Infection with Plasmodium vivax or P. falciparum Generates Immune Responses to Homologous and Heterologous Preerythrocytic and Erythrocytic Antigens

D. Chattopadhyay, E. Bergmann-Leitner, E. Angov, 2018, Infection and Immunity.

Investigation of Genes Encoding Calcineurin B-Like Protein Family in Legumes and Their Expression Analyses in Chickpea (Cicer arietinum L.)

D. Chattopadhyay, M. Meena, V. Dwivedi, 2015, PloS one.

Crystal structure of Plasmodium falciparum phosphoglycerate kinase: evidence for anion binding in the basic patch.

Craig D. Smith, D. Chattopadhyay, B. Pal, 2011, Biochemical and biophysical research communications.

A structural model for the inhibition of calpain by calpastatin: crystal structures of the native domain VI of calpain and its complexes with calpastatin peptide and a small molecule inhibitor.

G. Lin, S. Narayana, M. Maki, 2003, Journal of molecular biology.

Structure of the uracil complex of Vaccinia virus uracil DNA glycosylase

N. Schormann, R. Ricciardi, D. Chattopadhyay, 2013, Acta crystallographica. Section F, Structural biology and crystallization communications.

Structure of a complex of human lactoferrin N-lobe with pneumococcal surface protein a provides insight into microbial defense mechanism.

W. Cook, D. Chattopadhyay, D. Briles, 2007, Journal of molecular biology.

Crystal Structures of Group B Streptococcus Glyceraldehyde-3-Phosphate Dehydrogenase: Apo-Form, Binary and Ternary Complexes

N. Schormann, D. Chattopadhyay, G. Ulett, 2016, PloS one.

Biochemical characterization and crystallization of recombinant 3-phosphoglycerate kinase of Plasmodium falciparum.

D. Chattopadhyay, B. Pybus, B. Pal, 2004, Biochimica et Biophysica Acta.

An overview of structure, function, and regulation of pyruvate kinases

N. Schormann, D. Chattopadhyay, Surajit Banerjee, 2019, Protein science : a publication of the Protein Society.

Trypanosoma cruzi genome encodes a pteridine reductase 2 protein.

N. Schormann, D. Chattopadhyay, B. Pal, 2003, Molecular and biochemical parasitology.

Short communication Trypanosoma cruzigenome encodes a pteridine reductase 2 protein

N. Schormann, D. Chattopadhyay, B. Pal, 2003 .

Plasmodium falciparum ARFGAP: expression and crystallization of the catalytic domain.

D. Chattopadhyay, O. Senkovich, 2004, Biochimica et biophysica acta.

Chlamydia trachomatis glyceraldehyde 3‐phosphate dehydrogenase: Enzyme kinetics, high‐resolution crystal structure, and plasminogen binding

N. Schormann, D. Chattopadhyay, G. Ulett, 2020, Protein science : a publication of the Protein Society.

A simple and reliable method for determination of optimum pH in coupled enzyme assays.

D. Chattopadhyay, D. Bzik, Katherine L. Hayden, 2020, BioTechniques.

Crystal structure and induced stability of trimeric BxpB: implications for the assembly of BxpB-BclA complexes in the exosporium of Bacillus anthracis

J. Kearney, D. Chattopadhyay, Charles L. Turnbough, Jr, 2023, mBio.

Phylogenetic lineage and pilus protein Spb1/SAN1518 affect opsonin-independent phagocytosis and intracellular survival of Group B Streptococcus.

D. Chattopadhyay, G. Ulett, R. Webb, 2011, Microbes and infection.

Purification and crystallization of recombinant lactate dehydrogenase of Plasmodium falciparum

L. DeLucas, S. Narayana, D. Chattopadhyay, 1996 .

A pathogenesis related-10 protein CaARP functions as aldo/keto reductase to scavenge cytotoxic aldehydes

D. Jain, D. Chattopadhyay, J. Khurana, 2015, Plant Molecular Biology.

Malaria Immunoepidemiology in Low Transmission: Correlation of Infecting Genotype and Immune Response to Domains of Plasmodium falciparum Merozoite Surface Protein 3

J. Rayner, O. Branch, D. Chattopadhyay, 2011, Infection and Immunity.

Crystallization of three key glycolytic enzymes of the opportunistic pathogen Cryptosporidium parvum.

D. Chattopadhyay, G. Zhu, K. Bradley, 2005, Biochimica et biophysica acta.

Cloning of bHLH promoter fragment in pGEMT vector using E. coli (Migula) strain for various stress tolerance in chickpea

S. Singh, D. Chattopadhyay, V. Sharma, 2020 .

Stabilization of active-site loops in NH3-dependent NAD+ synthetase from Bacillus subtilis.

L. DeLucas, J. Symerský, D. Chattopadhyay, 2001, Acta crystallographica. Section D, Biological crystallography.

Co-crystal structures of PP5 in complex with 5-methyl-7-oxabicyclo[2.2.1]heptane-2,3-dicarboxylic acid

A. Wierzbicki, D. Chattopadhyay, E. A. Salter, 2016 .

The structure of the Plasmodium falciparum EBA175 ligand domain and the molecular basis of host specificity.

J. Rayner, D. Chattopadhyay, J. Adams, 2006, Trends in parasitology.

Merozoite Surface Protein 3 Domains of Plasmodium falciparum Genotype and Immune Response to Transmission: Correlation of Infecting Malaria Immunoepidemiology in Low

J. Rayner, D. Chattopadhyay, R. Oster, 2014 .

Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

L. DeLucas, N. Schormann, D. Chattopadhyay, 2007, BMC Structural Biology.

CAP2 enhances germination of transgenic tobacco seeds at high temperature and promotes heat stress tolerance in yeast

D. Jain, R. Yadav, D. Chattopadhyay, 2009, The FEBS journal.

CIPK6, a CBL-interacting protein kinase is required for development and salt tolerance in plants.

D. Chattopadhyay, Ashverya Laxmi, V. Tripathi, 2009, The Plant journal : for cell and molecular biology.

Structure‐based approach to pharmacophore identification, in silico screening, and three‐dimensional quantitative structure–activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function

A. Anderson, N. Schormann, D. Chattopadhyay, 2008, Proteins.

Correction: CaZF, a Plant Transcription Factor Functions through and Parallel to HOG and Calcineurin Pathways in Saccharomyces cerevisiae to Provide Osmotolerance

D. Jain, D. Chattopadhyay, N. Roy, 2009, PLoS ONE.

Structures of dihydrofolate reductase-thymidylate synthase of Trypanosoma cruzi in the folate-free state and in complex with two antifolate drugs, trimetrexate and methotrexate.

N. Schormann, D. Chattopadhyay, O. Senkovich, 2009, Acta crystallographica. Section D, Biological crystallography.

Crystal structures and mutagenesis of PPP-family ser/thr protein phosphatases elucidate the selectivity of cantharidin and novel norcantharidin-based inhibitors of PP5C.

Chad E. Schroeder, Jennifer E. Golden, A. Gingras, 2016, Biochemical pharmacology.

Genome-Wide Development and Use of Microsatellite Markers for Large-Scale Genotyping Applications in Foxtail Millet [Setaria italica (L.)]

Sarika Gupta, D. Chattopadhyay, G. Pandey, 2013, DNA Research.