G. Trooskens

发表

Next‐generation technologies and data analytical approaches for epigenomics

O. Thas, Klaas Mensaert, S. Denil, 2014, Environmental and molecular mutagenesis.

Quality Evaluation of Methyl Binding Domain Based Kits for Enrichment DNA-Methylation Sequencing

Gerben Menschaert, Geert Trooskens, Tim De Meyer, 2013, PloS one.

Transcriptome analysis of rice mature root tissue and root tips in early development by massive parallel sequencing.

G. Gheysen, W. Van Criekinge, S. Denil, 2012, Journal of experimental botany.

Combining in silico prediction and ribosome profiling in a genome-wide search for novel putatively coding sORFs

Gerben Menschaert, Walter Luyten, Geert Trooskens, 2013, BMC Genomics.

Genome-wide DNA methylation detection by MethylCap-seq and Infinium HumanMethylation450 BeadChips: an independent large-scale comparison

M. Delorenzi, R. Stupp, M. Hegi, 2015, Scientific Reports.

Dynamic epigenetic changes to VHL occur with sunitinib in metastatic clear cell renal cancer

D. Deforce, D. Harrison, Christophe Van Neste, 2016, Oncotarget.

Interaction of the Tobacco Lectin with Histone Proteins1[C][W][OA]

W. D. De Vos, K. Gevaert, P. Proost, 2011, Plant Physiology.

Epigenetic effects of casein-derived opioid peptides in SH-SY5Y human neuroblastoma cells

S. Walker, G. Trooskens, M. Trivedi, 2015, Nutrition & Metabolism.

Strategies for validation and testing of DNA methylation biomarkers.

H. Gohlke, T. Liloglou, M. Wielscher, 2014, Epigenomics.

Staphylococcal enterotoxin B influences the DNA methylation pattern in nasal polyp tissue: a preliminary study

C. Bachert, P. Van cauwenberge, C. Pérez-Novo, 2013, Allergy, Asthma & Clinical Immunology.

ViVar: A Comprehensive Platform for the Analysis and Visualization of Structural Genomic Variation

Tom Sante, Wigard P. Kloosterman, Sarah Vergult, 2014, PloS one.

SNP-guided identification of monoallelic DNA-methylation events from enrichment-based sequencing data

W. V. Berghe, Klaas Mensaert, S. Denil, 2014, bioRxiv.

Detection of High-grade Prostate Cancer Using a Urinary Molecular Biomarker-Based Risk Score.

Geert Trooskens, Wim Van Criekinge, Theo M de Reijke, 2016, European urology.

Transcriptional analysis through RNA sequencing of giant cells induced by Meloidogyne graminicola in rice roots

G. Gheysen, K. Lindsey, W. D. De Vos, 2013, Journal of experimental botany.

Transcriptional reprogramming by root knot and migratory nematode infection in rice.

G. Gheysen, S. Denil, G. Trooskens, 2012, The New phytologist.

Food-derived opioid peptides inhibit cysteine uptake with redox and epigenetic consequences.

G. Trooskens, M. Trivedi, R. Deth, 2014, The Journal of nutritional biochemistry.

Genome-wide DNA Methylation Profiling Reveals Methylation Markers Associated with 3q Gain for Detection of Cervical Precancer and Cancer

C. Meijer, P. Snijders, G. Wisman, 2017, Clinical Cancer Research.

DCR1 promoter hypermethylation and response to irinotecan in metastatic colorectal cancer

J. Herman, I. Nagtegaal, B. Ylstra, 2016 .

WRN Promoter CpG Island Hypermethylation Does Not Predict More Favorable Outcomes for Patients with Metastatic Colorectal Cancer Treated with Irinotecan-Based Therapy

J. Herman, I. Nagtegaal, P. Welcsh, 2016, Clinical Cancer Research.

Expression of type 2 orexin receptor in human endometrium and its epigenetic silencing in endometrial cancer.

C. Munaut, P. Delvenne, M. Rehli, 2013, The Journal of clinical endocrinology and metabolism.

Differential methylation as a mediator of COVID-19 susceptibility

G. Trooskens, J. Delanghe, S. Steyaert, 2020 .

Multicenter Optimization and Validation of a 2-Gene mRNA Urine Test for Detection of Clinically Significant Prostate Cancer Prior to Initial Prostate Biopsy.

A. Haese*, M. Brawer, J. Schalken, 2019, The Journal of urology.

ATAGTTTTCGAGGGTTATTCGC CCTAAACACAACGCCGACC PRKCB 1 GTATCGCGTTTAGGTTTCGTTT CCGACGCTACAAAACTACGA PROK 2 ATAAAGGTTAGTTTCGTCGTGA ACACGTACTCGTCTAAAAACCG PROP 1 CGAGTTATGGAAGTAGAAAGGAGGC ATAATCGAAATCCCAATAACCGA PTGS 2 TTACGGAAATGAGAAAATCGG GCCTAAAACGATAAAACTCGAAA RASSF 1 GCGTATTGTAGGTTTTTGCGT TAATCCCTAACC

G. Trooskens, P. Snaebjornsson, 2013 .

Methylation‐specific digital karyotyping of HPV16E6E7‐expressing human keratinocytes identifies novel methylation events in cervical carcinogenesis

K. Polyak, C. Meijer, P. Snijders, 2013, The Journal of pathology.

Phylogenetic trees: visualizing, customizing and detecting incongruence

Geert Trooskens, Wim Van Criekinge, David De Beule, 2005, Bioinform..

Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer

J. Herman, I. Nagtegaal, B. Ylstra, 2017, Oncotarget.

Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer

J. Herman, I. Nagtegaal, B. Ylstra, 2017, Oncotarget.

Exploratory analysis of the human breast DNA methylation profile upon soymilk exposure

L. Godderis, P. Blondeel, H. Depypere, 2018, Scientific Reports.

ChApTEr 4 Genome-wide DNA methylation profiling reveals methylation markers associated with 3 q gain for detection of cervical precancer and cancer

P. Snijders, G. Wisman, G. Trooskens, 2018 .

Phylogenetic trees: visualizing, customizing and detecting incongruence

G. Trooskens, W. Criekinge, Frederik Decouttere, 2005, Bioinform..

Combining in silico prediction and ribosome profiling in a genome-wide search for novel putatively coding sORFs

W. Luyten, G. Trooskens, G. Menschaert, 2013, BMC Genomics.

Expression of type 2 orexin receptor in human endometrium and its epigenetic silencing in endometrial cancer.

C. Munaut, P. Delvenne, M. Rehli, 2013, The Journal of clinical endocrinology and metabolism.