F. Derosa

发表

Polymer-Lipid Nanoparticles for Systemic Delivery of mRNA to the Lungs.

Daniel G Anderson, Daniel G. Anderson, Owen S Fenton, 2016, Angewandte Chemie.

Poly(glycoamidoamine) Brushes Formulated Nanomaterials for Systemic siRNA and mRNA Delivery in Vivo.

Benjamin C. Tang, Daniel G. Anderson, R. Langer, 2016, Nano letters.

AUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGU UCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAU CGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCC GUGUUGGGUGCCCUGUUCAUCGGUGUGGCUGUGGCCCCAGCUAAC GACAUCUACAACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCC AGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUCCU CAACGUGCAAAAGAAGCUAC

Daniel G. Anderson, Kevin J. Kauffman, M. Webber, 2016 .

Efficacy and immunogenicity of unmodified and pseudouridine-modified mRNA delivered systemically with lipid nanoparticles in vivo.

Daniel G. Anderson, M. Webber, James C. Kaczmarek, 2016, Biomaterials.

Nitric oxide-releasing fabrics and other acrylonitrile-based diazeniumdiolates.

M. Kibbe, L. Keefer, F. Derosa, 2007, Journal of the American Chemical Society.

The promise of mRNA vaccines: a biotech and industrial perspective

S. Gurunathan, F. Derosa, D. Casimiro, 2020, npj Vaccines.

Synthesis and Biological Evaluation of Ionizable Lipid Materials for the In Vivo Delivery of Messenger RNA to B Lymphocytes

Mark W. Tibbitt, Daniel G. Anderson, Kevin J. Kauffman, 2017, Advanced materials.

Inhaled Nanoformulated mRNA Polyplexes for Protein Production in Lung Epithelium

Robert Langer, Suman Bose, Daniel G Anderson, 2019, Advanced materials.

Customizable Lipid Nanoparticle Materials for the Delivery of siRNAs and mRNAs.

Daniel G. Anderson, Kevin J. Kauffman, Owen S. Fenton, 2018, Angewandte Chemie.

Therapeutic efficacy in a hemophilia B model using a biosynthetic mRNA liver depot system

Kevin J. Kauffman, L. Smith, B. Guild, 2016, Gene Therapy.

Chromium(III) complexes for photochemical nitric oxide generation from coordinated nitrite: synthesis and photochemistry of macrocyclic complexes with pendant chromophores, trans-[Cr(L)(ONO)(2)]BF(4).

X. Bu, F. Derosa, P. Ford, 2005, Inorganic chemistry.

Synthesis and photophysical properties of new chromium(III) complexes of N-derivatized 1,4,8,11-tetraazacyclotetradecane ligands cis-[Cr(1,8-R(2)cyclam)Cl(2)]Cl, where R is a pendant chromophore. exclusive formation of the cis isomer.

X. Bu, F. Derosa, P. Ford, 2003, Inorganic chemistry.

Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in Vivo with Fractional Factorial and Definitive Screening Designs.

Daniel G. Anderson, Kevin J. Kauffman, Owen S. Fenton, 2015, Nano letters.

mRNA Delivery for Therapeutic Anti-HER2 Antibody Expression In Vivo.

Daniel G. Anderson, Piotr S. Kowalski, M. Heartlein, 2019, Molecular therapy : the journal of the American Society of Gene Therapy.

Optimization of a Degradable Polymer-Lipid Nanoparticle for Potent Systemic Delivery of mRNA to the Lung Endothelium and Immune Cells.

Kaitlyn Sadtler, Daniel G Anderson, Daniel G. Anderson, 2018, Nano letters.

Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery

Mark W. Tibbitt, Daniel G. Anderson, Kevin J. Kauffman, 2016, Advanced materials.

Improved Efficacy in a Fabry Disease Model Using a Systemic mRNA Liver Depot System as Compared to Enzyme Replacement Therapy

M. Heartlein, F. Derosa, Jing Pan, 2019, Molecular therapy : the journal of the American Society of Gene Therapy.

The promise of mRNA vaccines: a biotech and industrial perspective

S. Gurunathan, F. Derosa, D. Casimiro, 2020, npj Vaccines.

Immunogenicity and efficacy of mRNA COVID-19 vaccine MRT5500 in preclinical animal models

F. Derosa, D. Casimiro, T. Fu, 2021, npj Vaccines.

Immunogenicity and efficacy of mRNA COVID-19 vaccine MRT5500 in preclinical animal models

F. Derosa, D. Casimiro, T. Fu, 2021, NPJ vaccines.

Pan-SARS neutralizing responses after third boost vaccination in non-human primate immunogenicity model

F. Derosa, D. Casimiro, T. Fu, 2022, Vaccine.

Development of multivalent mRNA vaccine candidates for seasonal or pandemic influenza

F. Derosa, Sophia T. Mundle, D. Casimiro, 2021, NPJ vaccines.

Systemic delivery of mRNA and DNA to the lung using polymer-lipid nanoparticles.

Daniel G. Anderson, James C. Kaczmarek, A. Patel, 2021, Biomaterials.

Development of multivalent mRNA vaccine candidates for seasonal or pandemic influenza

F. Derosa, Sophia T. Mundle, D. Casimiro, 2021, npj Vaccines.

Immunogenicity of novel mRNA COVID-19 vaccine MRT5500 in mice and non-human primates

F. Derosa, D. Casimiro, T. Fu, 2020, bioRxiv.

Nitric oxide reacts with methoxide.

L. Keefer, F. Derosa, J. Hrabie, 2008, The Journal of organic chemistry.

THE DISRUPTIVE PATRON

F. Derosa, 1982 .

Inhalable dry powder product (DPP) of mRNA lipid nanoparticles (LNPs) for pulmonary delivery

F. Derosa, S. Karve, P. Patel, 2023, Drug delivery and translational research.

Understanding structure activity relationships of good HEPES lipids for lipid nanoparticle mRNA vaccine applications

F. Derosa, R. Goldman, S. Karve, 2023, Biomaterials.

Intramolecular reductive nitrosylation: reaction of nitric oxide and a copper(II) complex of a cyclam derivative with pendant luminescent chromophores.

F. Derosa, K. Tsuge, Mark D. Lim, 2004, Journal of the American Chemical Society.

Efficacy and immunogenicity of unmodified and pseudouridine-modified mRNA delivered systemically with lipid nanoparticles in vivo.

Daniel G. Anderson, Kevin J. Kauffman, M. Webber, 2016, Biomaterials.