B. Sauer

发表

Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae.

B. Sauer, B Sauer, 1987, Molecular and cellular biology.

Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1.

N. Henderson, B. Sauer, N. Henderson, 1988, Proceedings of the National Academy of Sciences of the United States of America.

Multiplex Cre/lox recombination permits selective site-specific DNA targeting to both a natural and an engineered site in the yeast genome.

B. Sauer, Brian Sauer, 1996, Nucleic acids research.

Segmental genomic replacement in embryonic stem cells by double lox targeting.

B. Sauer, S. Soukharev, J. Miller, 1999, Nucleic acids research.

Stoichiometry of the Cre recombinase bound to the lox recombining site.

B. Sauer, R. Hoess, K. Abremski, 1992, Nucleic acids research.

Identification of cryptic lox sites in the yeast genome by selection for Cre-mediated chromosome translocations that confer multiple drug resistance.

B. Sauer, Brian Sauer, 1992, Journal of molecular biology.

Recycling selectable markers in yeast.

B. Sauer, 1994, BioTechniques.

Targeted oncogene activation by site-specific recombination in transgenic mice.

B. Mosinger, H. Westphal, B. Sauer, 1992, Proceedings of the National Academy of Sciences of the United States of America.

Interaction of satellite phage P4 with phage 186 helper.

B. Sauer, E. Six, R. Calendar, 1982, Virology.

Mutants of satellite bacteriophage P4 that are defective in the suppression of transcriptional polarity.

D. Ow, B. Sauer, R. Calendar, 1981, Journal of molecular biology.

Cre‐mediated site‐specific recombination in zebrafish embryos

M. Sarras, C. T. Burket, R. Thummel, 2005, Developmental dynamics : an official publication of the American Association of Anatomists.

A simple polymerase chain reaction screen for homologous targeting in embryonic stem cells.

B. Sauer, Ying Zhao, J. McDermott, 2004, Analytical Biochemistry.

Cre-stimulated recombination at loxP-containing DNA sequences placed into the mammalian genome.

N. Henderson, B. Sauer, N. Henderson, 1989, Nucleic acids research.

Targeted insertion of exogenous DNA into the eukaryotic genome by the Cre recombinase.

N. Henderson, B. Sauer, Brian Sauer, 1990, The New biologist.

Glucose Utilization and Ethanolic Fermentation by Wild Type and Extrachromosomal Mutants of Neurospora crassa

B. Sauer, K. D. Munkres, H. Colvin, 1973, Journal of bacteriology.

Laron Dwarfism and Non-Insulin-Dependent Diabetes Mellitus in the Hnf-1α Knockout Mouse

B. Sauer, Ying‐Hue Lee, F. Gonzalez, 1998, Molecular and Cellular Biology.

Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae

B. Sauer, 1987 .

Generation of Cre recombinase-specific monoclonal antibodies, able to characterize the pattern of Cre expression in cre-transgenic mouse strains.

C. Kocks, K. Rajewsky, R. Kühn, 1997, Journal of immunological methods.

Conditional gene knockout using cre recombinase

B. Sauer, Y. Le, 2001, Methods in molecular biology.

Genomic targeting with purified Cre recombinase.

B. Sauer, W. Baubonis, Wendy Baubonis, 1993, Nucleic acids research.

Far‐upstream elements are dispensable for tissue‐specific proenkephalin expression using a Cre‐mediated knock‐in strategy

D. Agoston, B. Sauer, A. Dobi, 2003, Journal of neurochemistry.

Mouse Knockout α Hnf-1 Diabetes Mellitus in the Laron Dwarfism and Non-Insulin-Dependent

F. Gonzalez, B. Sauer, Ying‐Hue Lee, 1998 .

Genetic analysis of bacteriophage P4 using P4-plasmid ColE1 hybrids

D. Ow, B. Sauer, M. Kahn, 1980, Molecular and General Genetics MGG.

The cyclization of linear DNA in Escherichia coli by site-specific recombination.

N. Henderson, B. Sauer, 1988, Gene.

A cell-free recombination system for site-specific integration of multigenic shuttle plasmids into the herpes simplex virus type 1 genome

J. Glorioso, B. Sauer, P. Gage, 1992, Journal of virology.

TACGTAGGCCTAATTGGCCGTCGACATTTAGGTG ATGCATCCGGATTAACCGGCAGCTGTAAATCCAC promoter BamHI ACACTATAGAAGGATCCTCTCCCTATAGTGAGTC TGTGATATCTTCCTAGGAGAGGGATATCACTCAG N T 7 promoter NotI cl binding site GTATTAGCGGCCGCAAATTTATTAGAGCAATATA CATAATCGCCGGCGTTTAAATAATCTCGTTATAT E . coli promoter GTCCTACAATGTCAAGCTCGA

B. Sauer, J. Pierce, 2022 .

Construction of isogenic cell lines expressing human and rat angiotensin II AT1 receptors by cre-mediated site-specific recombination

B. Sauer, S. Fukushige, L. Santomenna, 1992 .

Targeted Disruption of the Acid α-Glucosidase Gene in Mice Causes an Illness with Critical Features of Both Infantile and Adult Human Glycogen Storage Disease Type II*

N. Raben, K. Nagaraju, B. Sauer, 1998, The Journal of Biological Chemistry.

Efficient in vivo manipulation of mouse genomic sequences at the zygote stage.

F. Alt, J. Gorman, H. Westphal, 1996, Proceedings of the National Academy of Sciences of the United States of America.

Transgenic Mice Over-expressing Endothelin-1 in Testis Transactivated by a Cre/loxP System Showed Decreased Testicular Capillary Blood Flow

S. Chung, B. Sauer, Sookja K. Chung, 2004, Transgenic Research.

Conditional gene knockout using Cre recombinase.

B. Sauer, Y. Le, 2001, Molecular biotechnology.

Disruption of the c/ebp a Gene in Adult Mouse Liver

P. Johnson, B. Sauer, Ying‐Hue Lee, 1997 .

DNA polymerase alpha from Drosophila melanogaster embryos. Subunit structure.

I. Lehman, B. Sauer, G. Villani, 1980, The Journal of biological chemistry.

Cre–lox‐Inducible Gene Targeting

B. Sauer, 2006 .

Analysis of Cre-loxP interaction by surface plasmon resonance: influence of spermidine on cooperativity.

B. Sauer, P. Neuenschwander, A. Rüfer, 2002, Analytical biochemistry.

Genomic targeting with a positive-selection lox integration vector allows highly reproducible gene expression in mammalian cells.

B. Sauer, S. Fukushige, Brian Sauer, 1992, Proceedings of the National Academy of Sciences of the United States of America.

High-performance liquid chromatographic separations of nystatin and their influence on the antifungal activity.

B. Sauer, R. Matusch, 1994, Journal of chromatography. A.

Segmental genomic replacement in embryonic stem cells by double lox targeting.

B. Sauer, S. Soukharev, J. Miller, 1999, Nucleic acids research.

Organization of the mouse ASGR1 gene encoding the major subunit of the hepatic asialoglycoprotein receptor.

J. Hanover, B. Sauer, S. Soukharev, 2000, Gene.

Segmental genomic replacement by Cre-mediated recombination: genotoxic stress activation of the p53 promoter in single-copy transformants.

B. Sauer, B. Bethke, 1997, Nucleic acids research.

Bacteriophage P1 cre gene and its regulatory region. Evidence for multiple promoters and for regulation by DNA methylation.

B. Sauer, R. Hoess, K. Abremski, 1986, Journal of molecular biology.

Intestinal polyposis in mice with a dominant stable mutation of the β‐catenin gene

M. Taketo, T. Ishikawa, M. Oshima, 1999, The EMBO journal.

A positive selection vector for cloning high molecular weight DNA by the bacteriophage P1 system: improved cloning efficacy.

B. Sauer, N. Sternberg, J. Pierce, 1992, Proceedings of the National Academy of Sciences of the United States of America.

Inducible gene targeting in mice using the Cre/lox system.

B. Sauer, 1998, Methods.

A mouse genomic library in the bacteriophage P1 cloning system: organization and characterization

B. Sauer, N. Sternberg, Brian Sauer, 2004, Mammalian Genome.

GFPcre fusion vectors with enhanced expression.

J. Miller, B. Sauer, Y. Le, 1999, Analytical biochemistry.

Chromosome Manipulation by Cre-lox Recombination

B. Sauer, 2002 .

Manipulation of transgenes by site-specific recombination: use of Cre recombinase.

B. Sauer, 1993, Methods in enzymology.

Rapid generation of isogenic mammalian cell lines expressing recombinant transgenes by use of Cre recombinase.

B. Sauer, B. Bethke, 2000, Methods in molecular biology.

Brief expression of a GFP cre fusion gene in embryonic stem cells allows rapid retrieval of site-specific genomic deletions.

B. Sauer, J. Miller, S. Gagneten, 1997, Nucleic acids research.

Site-specific insertion of DNA into a pseudorabies virus vector.

L. Enquist, B. Sauer, M. Whealy, 1987, Proceedings of the National Academy of Sciences of the United States of America.

Site-specific recombination: developments and applications.

B. Sauer, 1994, Current opinion in biotechnology.

Site-directed recombination in the genome of transgenic tobacco

P. Caimi, B. Sauer, J. Odell, 1990, Molecular and General Genetics MGG.

Nuclear targeting determinants of the phage P1 cre DNA recombinase.

B. Sauer, D. Tombaccini, S. Gagneten, 1999, Nucleic acids research.

Unrestraining genetic processes with a protein-DNA hinge.

T. Tomonaga, David Levens, D. Libutti, 1998, Molecular cell.

A bacterial mutation blocking P2 phage late gene expression.

B. Sauer, M. Sunshine, 1975, Proceedings of the National Academy of Sciences of the United States of America.

DNA recombination with a heterospecific Cre homolog identified from comparison of the pac-c1 regions of P1-related phages.

B. Sauer, J. McDermott, 2004, Nucleic acids research.

P2 Growth Restriction on an rpoC Mutant Is Suppressed by Alleles of the Rz1 Homolog lysC

K. Severinov, B. Sauer, G. Christie, 2004, Journal of bacteriology.

Growth Restriction on an rpoC Mutant Is Suppressed by Alleles of the Rz 1 Homolog lysC

K. Severinov, B. Sauer, G. Christie, 2004 .

Bacteriophage P1 genes involved in the recognition and cleavage of the phage packaging site (pac).

B. Sauer, N. Sternberg, K. Skorupski, 1992, Journal of molecular biology.

Dual chromogenic reporter gene detection in mammalian cells with lacZ and arabinofuranosidase.

B. Sauer, W. Berlin, Tomiko Tsuchida, 2004, BioTechniques.

In SituColor Detection of α-L-Arabinofuranosidase, a “No-Background” Reporter Gene, with 5-Bromo-3- indolyl-α-L-arabinofuranoside

B. Sauer, W. Berlin, 1996 .

Altered visual function in monocarboxylate transporter 3 (Slc16a8) knockout mice.

E. Pugh, B. Sauer, N. Philp, 2008, American Journal of Physiology - Cell Physiology.

Neuron-specific expression of Cre recombinase during the late phase of brain development

A. Kulkarni, J. Julien, B. Sauer, 2001, Neuroscience Research.

Immunological comparison of purified DNA polymerase alpha from embryos of Drosophila melanogaster with forms of the enzyme present in vivo.

I. Lehman, B. Sauer, 1982, The Journal of biological chemistry.

Non-contact positions impose site selectivity on Cre recombinase

Brian Sauer, Andreas W. Rüfer, B. Sauer, 2002, Nucleic Acids Res..

Disruption of the c/ebp alpha gene in adult mouse liver

F. Gonzalez, Y. Lee, P. Johnson, 1997, Molecular and cellular biology.

Functional Mapping of Cre Recombinase by Pentapeptide Insertional Mutagenesis*

V. Petyuk, B. Sauer, J. McDermott, 2004, Journal of Biological Chemistry.

Cre Recombination‐Mediated Cassette Exchange for Building Versatile Transgenic Human Embryonic Stem Cells Lines

Su-Chun Zhang, B. Sauer, Z. Du, 2009, Stem cells.

In situ color detection of alpha-L-arabinofuranosidase, a "no-background" reporter gene, with 5-bromo-3-indolyl-alpha-L-arabinofuranoside.

B. Sauer, W. Berlin, 1996, Analytical biochemistry.

Cre/Iox: One more step in the taming of the genome

B. Sauer, 2002, Endocrine.

Kinetics of nitroanilide cleavage by astacin.

B. Sauer, W. Stöcker, R. Zwilling, 1991, Biological chemistry Hoppe-Seyler.

Faithful cleavage of the P1 packaging site (pac) requires two phage proteins, PacA and PacB, and two Escherichia coli proteins, IHF and HU.

B. Sauer, N. Sternberg, K. Skorupski, 1994, Journal of molecular biology.

Cre-mediated site-specific recombination in zebrafish embryos

M. Sarras, C. T. Burket, D. Hyde, 2006 .

Determination of transport kinetics of chick MCT3 monocarboxylate transporter from retinal pigment epithelium by expression in genetically modified yeast.

B. Sauer, N. Philp, E. Grollman, 2000, Biochemistry.

Double lox targeting for neural cell transgenesis.

Ling Wei, D. Gottlieb, Aizhen Yang, 2003, Brain research. Molecular brain research.

Altered visual function in monocarboxylate transporter 3 (Slc16a8) knockout mice.

E. Pugh, B. Sauer, N. Philp, 2008, American journal of physiology. Cell physiology.

The effects of nitrogen source upon respiration of Neurospora crassa.

B. Sauer, K. D. Munkres, H. Colvin, 1973, Biochemical and biophysical research communications.