A. Jia

发表

Hydrogen sulfide mediates nicotine biosynthesis in tobacco (Nicotiana tabacum) under high temperature conditions.

Yujie Jia, Liwei Hu, Xiaoming Zhang, 2016, Plant physiology and biochemistry : PPB.

Jasmonate mediates salt-induced nicotine biosynthesis in tobacco (Nicotiana tabacum L.)

Liwei Hu, Xiaoming Zhang, Hong Hu, 2016, Plant diversity.

Deletion of clock gene Per2 exacerbates cholestatic liver injury and fibrosis in mice.

Jianfa Zhang, Wei Dong, A. Jia, 2013, Experimental and toxicologic pathology : official journal of the Gesellschaft fur Toxikologische Pathologie.

Chlorophyll Degradation in the Gut of Generalist and Specialist Lepidopteran Caterpillars

W. Boland, A. Jia, Amarsanaa Badgaa, 2014, Journal of Chemical Ecology.

Palladium-catalyzed selective oxidative olefination and arylation of 2-pyridones

A. Jia, Fen Wang, Xingwei Li, 2012 .

Isolation of azomethine ylides and their complexes: iridium(III)-mediated cyclization of nitrone substrates containing alkynes.

Keli Han, A. Jia, Xingwei Li, 2011, Angewandte Chemie.

OTT_A_220453 10811..10825

A. Jia, Meixiao Zhan, Xu He, 2019 .

Camellia nitidissima Chi Extract Potentiates the Sensitivity of Gastric Cancer Cells to Paclitaxel via the Induction of Autophagy and Apoptosis

A. Jia, Meixiao Zhan, Xu He, 2019, OncoTargets and therapy.

Results of a 90-day safety assessment study in mice fed a glucan produced by Agrobacterium sp. ZX09.

Jianfa Zhang, Wei Dong, A. Jia, 2011, Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association.

Transcriptional analysis and target genes discovery of Pseudomonas aeruginosa biofilm developed ex vivo chronic wound model

A. Jia, Yifan Zhang, Xiaojuan Tan, 2021, AMB Express.

The AhR ligand phthiocol and vitamin K analogs as Pseudomonas aeruginosa quorum sensing inhibitors

Jiapeng Fu, P. Wu, A. Jia, 2022, Frontiers in Microbiology.

Gold- and iodine-mediated internal oxygen transfer of nitrone- and sulfoxide-functionalized alkynes.

A. Jia, Xingwei Li, Dan Chen, 2011, The Journal of organic chemistry.

Isolation of azomethine ylides and their complexes: iridium(III)-mediated cyclization of nitrone substrates containing alkynes.

Keli Han, A. Jia, Xingwei Li, 2011, Angewandte Chemie.

Synthesis of Isoquinolines via Rhodium(III)-Catalyzed Dehydrative C-C and C-N Coupling between Oximines and Alkynes

A. Jia, J. Zhao, Xingwei Li, 2011 .

Phytochemicals from Camellia nitidissima Chi Flowers Reduce the Pyocyanin Production and Motility of Pseudomonas aeruginosa PAO1

A. Jia, Ying Guan, Jinwei Zhou, 2018, Front. Microbiol..

Protective effects of salecan against carbon tetrachloride‐induced acute liver injury in mice

Zhongqiu Wang, Jianfa Zhang, Wei Dong, 2012, Journal of applied toxicology : JAT.

A Novel Soluble Beta-Glucan Salecan Protects against Acute Alcohol-Induced Hepatotoxicity in Mice

X. Yang, Zhongqiu Wang, Jianfa Zhang, 2011, Bioscience, biotechnology, and biochemistry.

Inhibition of Quorum Sensing and Biofilm Formation of Esculetin on Aeromonas Hydrophila

A. Jia, Zhennan Wang, Bing Sun, 2021, Frontiers in Microbiology.

Scavenging of Toxic Acrolein by Resveratrol and Hesperetin and Identification of Adducts.

A. Jia, L. Gu, J. Rocca, 2015, Journal of agricultural and food chemistry.

A review of approaches to control bacterial leaf blight in rice

Kyung-Min Kim, A. Jia, S. F. Syed-Ab-Rahman, 2022, World Journal of Microbiology and Biotechnology.

The role of nitric oxide signalling in response to salt stress in Chlamydomonas reinhardtii

Xiangyang Hu, Xiaodong Chen, Qian Chen, 2016, Planta.

RNA-Seq-based transcriptome analysis of methicillin-resistant Staphylococcus aureus biofilm inhibition by ursolic acid and resveratrol

Yinming Jiao, Lin Liu, Nan Qin, 2014, Scientific Reports.

The mPlrp2 and mClps genes are involved in the hydrolysis of retinyl esters in the mouse liver[S]

Y. Zhang, Z. Hua, Jianfa Zhang, 2011, Journal of Lipid Research.

Genome of Staphylococcus xylosus and comparison with S. aureus and S. epidermidis.

Nan Qin, A. Jia, Shili Liu, 2014, Journal of genetics and genomics = Yi chuan xue bao.

The investigation of inhibiting quorum sensing and methicillin-resistant Staphylococcus aureus biofilm formation from Liriodendron hybrid.

Wei Dong, Jinhui Chen, Jisen Shi, 2015, Pakistan journal of pharmaceutical sciences.

Piceatannol attenuates D‐GalN/LPS‐induced hepatoxicity in mice: Involvement of ER stress, inflammation and oxidative stress

Jianfa Zhang, A. Jia, Yunxia Yang, 2018, International immunopharmacology.

Transcriptome analysis of the biofilm formed by methicillin-susceptible Staphylococcus aureus

Chunyan Wu, Z. Ma, Nan Qin, 2015, Scientific Reports.

CTGGTGCTGCC AAGGCTGT ACAACCTGGTCCTCAGTGTAGCCCA GAGACATTCCCAT GCTGCCACCGTCACTGGG AACGCGCAGATCATG CCAGAGCCTCGTGGTACTTCTC GCAGGACCTCATTTTAA TCTCCAACATGCCTCTCTTCATC GCATCAAAAACTTG GCCCTGAAGCTTTTTGTCAG GAATCGAGCAGAAC AGCCTTCTCTGGACACCTGA GCCAATATGAGGAA GGGTGCTTGTTTATGGCTTC

Peng Chen, Wei Dong, A. Jia, 2011 .

Transcriptional analysis and target genes discovery of Pseudomonas aeruginosa biofilm developed ex vivo chronic wound model

A. Jia, G. Zhu, Yifan Zhang, 2021, AMB Express.

The role of nitric oxide signalling in response to salt stress in Chlamydomonas reinhardtii

Xiangyang Hu, Xiaodong Chen, Qian Chen, 2016, Planta.

Three phytoecdysteroids from Sagina japonica and potential biotransforming pathways of japonicone

A. Jia, Yan Li, Jinming Gao, 2010, Chemistry of Natural Compounds.

Ru(II)-catalyzed ring expansion of alkynylcyclopropanes in the presence of sulfonamides

A. Jia, Xingwei Li, Junsong Wang, 2013 .

Chlorophyll Degradation in the Gut of Generalist and Specialist Lepidopteran Caterpillars

W. Boland, A. Jia, Amarsanaa Badgaa, 2014, Journal of Chemical Ecology.