T. Negoro

发表

Sibling Cases with Epilepsy Associated with Pocket Monster Seizures

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2006, Clinical pediatrics.

Photosensitive partial seizure: The origin of abnormal discharges

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1988 .

Epilepsies after Pocket Monster Seizures

Akihisa Okumura, Y. Ishiguro, Hiroyuki Takada, 2005, Epilepsia.

Epileptic Seizures Induced by Animated Cartoon, “Pocket Monster”

Hiroyuki Takada, Kazuyoshi Watanabe, A. Okumura, 1999, Epilepsia.

Efficacy of a diazepam suppository at preventing febrile seizure recurrence during a single febrile illness

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2009, Brain and Development.

Treatment and outcome in patients with febrile convulsion associated with epileptiform discharges on electroencephalography

Y. Ishiguro, Kazuyoshi Watanabe, A. Okumura, 2004, Brain and Development.

Dyschromatosis symmetrica hereditaria associated with neurological disorders

T. Negoro, Tamio Suzuki, M. Kono, 2008, The Journal of dermatology.

Absence seizures in patients with localization-related epilepsy

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2003, Brain and Development.

Evolution of seizures and electroencephalographical findings in 23 cases of deletion type Angelman syndrome

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2005, Brain and Development.

[Developmental changes of topographic EEG features in the newborn].

T. Negoro, K. Watanabe, K. Inokuma, 1984, No to hattatsu = Brain and development.

Auditory brainstem response: A comparative study of ipsilateral versus contralateral recording in neurological disorders of children

Kazuyoshi Watanabe, T. Negoro, N. Yamamoto, 1985, Brain and Development.

Necrotizing toxoplasmic encephalitis in a child with the X-linked hyper-IgM syndrome

H. Matsuoka, K. Aso, T. Negoro, 1998, European Journal of Pediatrics.

Self-induced photogenic epilepsy in infants.

K. Aso, T. Negoro, N. Yamamoto, 1985, Archives of neurology.

Surgical treatment for pediatric moyamoya disease: use of the superficial temporal artery for both areas supplied by the anterior and middle cerebral arteries.

T. Negoro, J. Yoshida, M. Shibuya, 1997, Neurosurgery.

Five-year follow-up of patients with partial epilepsies in infancy.

A. Okumura, T. Negoro, K. Watanabe, 2001, Pediatric neurology.

Neuroimaging: Early Childhood Prolonged Convulsions and Mesial Temporal Sclerosis Demonstrated by Magnetic Resonance Imaging

Kazuyoshi Watanabe, T. Negoro, K. Miura, 1992 .

Magnetic Resonance Imaging in Intractable Temporal Lobe Epilepsy of Childhood Onset.

Kazuyoshi Watanabe, T. Negoro, K. Miura, 1992 .

PET in Infancy Predicts Long-Term Outcome during Adolescence in Cryptogenic West Syndrome

A. Okumura, K. Aso, T. Negoro, 2014, American Journal of Neuroradiology.

Serial positron emission tomography study in West syndrome

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1995, Psychiatry and clinical neurosciences.

Focal spasms in clusters, focal delayed myelination, and hypsarrhythmia: unusual variant of West syndrome.

K. Aso, T. Negoro, K. Watanabe, 1994, Pediatric neurology.

Clinical, EEG, and positron emission tomography features of childhood-onset epilepsy with localized cortical dysplasia detected by magnetic resonance imaging

Takashi Kato, Kengo Ito, Kazuyoshi Watanabe, 1994 .

Transient focal cortical hypometabolism in idiopathic West syndrome.

K. Ito, K. Aso, T. Negoro, 1993, Pediatric neurology.

Two siblings with cortical dysplasia: Clinico‐electroencephalographic features

A. Kakita, Mitsuhiro Kato, Kazuyoshi Watanabe, 2015, Pediatrics international : official journal of the Japan Pediatric Society.

Widespread glucose hypometabolism in patients with hippocampal atrophy: Evaluation with 18F-fluorodeoxyglucose positron emission tomography

M. Tadokoro, Kazuyoshi Watanabe, K. Aso, 1997 .

Developmental changes of pattern reversal visual evoked potentials

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1988, Brain and Development.

Pseudo-sawtooth pattern on amplitude-integrated electroencephalography in neonatal hypoxic–ischemic encephalopathy

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2019, Pediatric Research.

Infantile spasms: Etiological factors, clinical aspects, and long term prognosis in 200 cases

T. Negoro, K. Watanabe, K. Hara, 1981, European Journal of Pediatrics.

Cardio-facio-cutaneous syndrome and moyamoya syndrome

Y. Ishiguro, Kazuyoshi Watanabe, A. Okumura, 2002, Brain and Development.

A TIME-SERIES DESCRIPTIVE MODEL OF COMPETITIVE ADVANTAGE TRAJECTORY-Building Intermittent Competitive Advantage in Hyper-moving Market-2 Agenda

T. Negoro, M. Wakabayashi, 2007 .

Characteristics of epilepsy occurring in the first four months

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2014, Brain and Development.

Severe myoclonic epilepsy in infancy: evolution of seizures

K. Aso, T. Negoro, K. Watanabe, 1997, Seizure.

Factors Prognostic of Poor Seizure Outcome in Children with Complex Partial Seizures

Kazuyoshi Watanabe, T. Negoro, E. Takaesu, 1987 .

Long‐Term Prognosis of Convulsive Disorders in the First Year of Life: Mental and Physical Development and Seizure Persistence

Kazuyoshi Watanabe, T. Negoro, K. Iwase, 1983, Epilepsia.

A case of recurrent encephalopathy with SCN2A missense mutation

M. Mizuguchi, T. Negoro, S. Hirose, 2015, Brain and Development.

Magnetic Resonance Imaging in Complex Partial Seizures

T. Negoro, I. Takahashi, K. Nomura, 1989, The Japanese journal of psychiatry and neurology.

Increment of α B-crystallin mRNA in the brain of patient with infantile type Alexander's disease

Kazuto Kobayashi, Kazuyoshi Watanabe, T. Negoro, 1991 .

Moyamoya disease presenting with chorea.

T. Negoro, I. Takahashi, K. Nomura, 1990, Pediatric neurology.

A case of infantile Alexander disease with a milder phenotype and a novel GFAP mutation, L90P

S. Tsujino, A. Okumura, T. Negoro, 2004, Brain and Development.

Comparison of two low dose ACTH therapies for West syndrome: their efficacy and side effect

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2005, Brain and Development.

Do ictal, clinical, and electroencephalographic features predict outcome in West syndrome?

K. Aso, T. Negoro, K. Watanabe, 1995, Pediatric neurology.

The effects of co-medications on lamotrigine clearance in Japanese children with epilepsy

N. Kurahashi, H. Kurahashi, S. Kojima, 2016, Brain and Development.

ACTH therapy for generalized seizures other than spasms

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2006, Seizure.

Ictal electroencephalographic findings of spasms in West syndrome

Kazuyoshi Watanabe, T. Negoro, T. Ohki, 1995, Psychiatry and clinical neurosciences.

Benign myoclonic epilepsy in infants: video-EEG features and long-term follow-up.

A. Okumura, K. Aso, T. Negoro, 1998, Neuropediatrics.

Transient seizure remission in intractable localization-related epilepsy.

A. Okumura, K. Aso, T. Negoro, 2000, Pediatric neurology.

Seizure characteristics of epilepsy in childhood after acute encephalopathy with biphasic seizures and late reduced diffusion

S. Saitoh, S. Kojima, Kazuyoshi Watanabe, 2015, Epilepsia.

Decrease of N-acetylaspartate after ACTH therapy in patients with infantile spasms.

T. Negoro, K. Nomura, K. Watanabe, 1997, Neuropediatrics.

Epileptic Nystagmus Associated with Typical Absence Seizures

T. Negoro, K. Inokuma, A. Matsumoto, 1984, Epilepsia.

Transient splenial lesions in children with “benign convulsions with gastroenteritis”

T. Negoro, T. Ikuta, J. Natsume, 2007, Brain and Development.

Efficacy of antiepileptic drugs in patients with benign convulsions with mild gastroenteritis

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2004, Brain and Development.

Clinical features of benign convulsions with mild gastroenteritis

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2002, Brain and Development.

Benign Partial Epilepsy with Secondarily Generalized Seizures in Infancy

Kazuyoshi Watanabe, T. Negoro, Kousaburo Aso, 1993, Epilepsia.

Benign partial epilepsy in infancy long-term outcome and marginal syndromes

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2006, Epilepsy Research.

Long‐term Follow‐up of Patients with Benign Partial Epilepsy in Infancy

H. Kurahashi, Kazuyoshi Watanabe, A. Okumura, 2006, Epilepsia.

Benign complex partial epilepsies in infancy.

K. Aso, T. Negoro, I. Takahashi, 1987, Pediatric neurology.

A pilot study on benign partial epilepsy in children with complex partial seizures

Y. Ishiguro, Hiroyuki Takada, Kazuyoshi Watanabe, 2001, Seizure.

Seizure prognosis and eeg evolution in complex partial seizures of childhood onset

Kazuyoshi Watanabe, T. Negoro, I. Takahashi, 1990, Brain and Development.

Combination therapy with intraventricular interferon-α and ribavirin for subacute sclerosing panencephalitis and monitoring measles virus RNA by quantitative PCR assay

M. Hosoya, A. Tomoda, A. Okumura, 2003, Brain and Development.

Apneas observed in trisomy 18 neonates should be differentiated from epileptic apneas

T. Negoro, T. Kubota, T. Fukasawa, 2015, American journal of medical genetics. Part A.

Guillain-Barré syndrome associated with central nervous system lesions

Y. Ishiguro, A. Okumura, T. Negoro, 2002, Archives of disease in childhood.

Evolutional Changes and Outcome of West Syndrome: Correlation with Magnetic Resonance Imaging Findings

Kazuyoshi Watanabe, A. Okumura, K. Aso, 1998, Epilepsia.

The Choice of Antiepileptic Drugs in Japan.

K. Aso, T. Negoro, J. Natume, 1996 .

The Predictive Value of Electroencephalogram during Early Infancy for Later Development of West Syndrome in Infants with Cystic Periventricular Leukomalacia

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2003, Epilepsia.

Long‐term Prognosis after Infantile Spasms: a Statistical Study of Prognostic Factors in 200 Cases

T. Negoro, K. Watanabe, K. Hara, 1981, Developmental medicine and child neurology.

Partial Seizures Evolving to Infantile Spasms

T. Negoro, I. Takahashi, N. Yamamoto, 1988, Epilepsia.

[A study on ACTH dosage for treatment of West syndrome].

K. Aso, T. Negoro, K. Watanabe, 1993, No to hattatsu = Brain and development.

[A case of ulcerative colitis causing superior sagittal sinus thrombosis].

T. Negoro, S. Kobayashi, H. Sumie, 1986, Rinsho hoshasen. Clinical radiography.

REM sleep prevents sudden infant death syndrome

T. Negoro, K. Watanabe, K. Inokuma, 1983, European Journal of Pediatrics.

Seizures with apnea in children.

T. Negoro, K. Watanabe, S. Hakamada, 1982, Pediatrics.

MRI findings in patients with symptomatic localization-related epilepsies beginning in infancy and early childhood

Y. Ishiguro, Kazuyoshi Watanabe, A. Okumura, 2000, Seizure.

Brain Malformation of the Surviving Twin of Intrauterine Co-twin Demise

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2007, Journal of child neurology.

Clinico‐epidemiological features of infantile hydrocephalus in Japan

T. Negoro, K. Aoki, S. Nakashima, 1996, Acta paediatrica Japonica : Overseas edition.

Complex partial seizures in children

K. Aso, T. Negoro, I. Takahashi, 1987, Neurology.

Ictal EEG in benign partial epilepsy in infancy.

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2007, Pediatric neurology.

Long‐Term Prognosis of Lennox‐Gastaut Syndrome

Kazuyoshi Watanabe, T. Negoro, I. Takahashi, 1987 .

Photosensitive epilepsy in children

Takashi Ohki, Norihide Maeda, Kazuyoshi Watanabe, 1994, Seizure.

Etiologic factors and long-term prognosis of convulsive disorders in the first year of life.

T. Negoro, K. Watanabe, A. Matsumoto, 1983, Neuropediatrics.

Convulsive Disorders in the First Year of Life:Evolution of Seizure Types and the Long-term Prognosis

Kazuyoshi Watanabe, T. Negoro, A. Matsumoto, 1983 .

Predictors of long-term outcome of convulsive disorders in the first year of life: clinical usefulness of five risk factors.

T. Negoro, K. Watanabe, A. Matsumoto, 1985, European Neurology.

Prognostic factors of convulsive disorders in the first year of life

Kazuyoshi Watanabe, T. Negoro, A. Matsumoto, 1983, Brain and Development.

Early Recognition of Benign Partial Epilepsy in Infancy

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2000, Epilepsia.

The clinical characterizations of benign partial epilepsy in infancy.

A. Okumura, T. Negoro, K. Watanabe, 2006, Neuropediatrics.

Antiepileptic treatment against clustered seizures in benign partial epilepsy in infancy

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2006, Brain and Development.

Benign epilepsy of children with complex partial seizures following febrile convulsions

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1993, Seizure.

Simultaneous EEG-VTR and transverse topographical analyses of absence seizures in children Some prognostic implications

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1993, Brain and Development.

Clinical study of intractable epilepsy. First report Analysis of factors associated with intractability.

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1986 .

Clinical Study of Intractable Epilepsy in the First Year of Life

Kazuyoshi Watanabe, T. Negoro, A. Matsumoto, 1984 .

Intractable Epilepsy in Children

Kazuyoshi Watanabe, T. Negoro, I. Takahashi, 1987, The Japanese journal of psychiatry and neurology.

Clinical study of intractable epilepsy. Second report Trial of treatment.

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1986 .

A case of subacute sclerosing panencephalitis preceded by epileptic seizures: evolutional EEG changes

Y. Ishiguro, Kazuyoshi Watanabe, A. Okumura, 2003, Brain and Development.

Reappraisal of Interictal Electroencephalograms in Infantile Spasms

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1993, Epilepsia.

Acquired Expressive Dysphasia with Paroxysmal EEG Abnormalities Treated with ACTH-Z. Report of Two Cases

Kazuyoshi Watanabe, T. Negoro, K. Inokuma, 1983 .

Aicardi syndrome. Report of 6 cases and a review of Japanese literature

Kazuyoshi Watanabe, T. Negoro, N. Yamamoto, 1985, Brain and Development.

Visual seizures in children

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1987, Epilepsy Research.

Symptomatology of infantile spasms

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2001, Brain and Development.

Paroxysmal nonepileptic events in children with epilepsy

S. Maesawa, Kazuyoshi Watanabe, T. Negoro, 2017, Epilepsy Research.

Epileptic Spasms Preceded by Partial Seizures with a Close Temporal Association

Hiroyuki Takada, A. Okumura, K. Aso, 1999, Epilepsia.

Asymmetric spasms in West syndrome.

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1995 .

Evolutional changes of cortical hypometabolism in West's syndrome

K. Aso, T. Negoro, K. Watanabe, 1994, The Lancet.

Congenital cytomegalovirus infection diagnosed by polymerase chain reaction with the use of preserved umbilical cord.

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2005, The Pediatric infectious disease journal.

Long-term prognosis of tuberous sclerosis with epilepsy in children

Kazuyoshi Watanabe, T. Negoro, N. Yamamoto, 1987, Brain and Development.

Long-term Follow-up Study of West Syndrome

Kazuyoshi Watanabe, T. Negoro, K. Hara, 1983 .

Prognostic factors of infantile spasms from the etiological viewpoint

Kazuyoshi Watanabe, T. Negoro, K. Hara, 1981, Brain and Development.

Detection of platelet mitochondrial DNA deletions in Kearns-Sayre syndrome.

K. Ohno, T. Ozawa, T. Negoro, 1991, Investigative ophthalmology & visual science.

Defection of Platelet Mitochondrial DNA Deletions in Kearns-Sayre Syndrome

T. Negoro, Y. Ora, Masoshi Tanaka, 2005 .

CTCCATGCATTTGGTATTTT CTACTATACTCAATTGATCC CAAACACTTAGTTAACAGCT CTATTATTCGGCGCATGAGC TATAGTGGAGGCCGGAGCAG TGAACCTACGAGTACACCGA TTCATGCCCATCGTCCTAGA ACGAAAATCTGTTCGCTTCA CACCCAACTATCTATAAACC ACACTTATCATCTTCACAAT TCCGGCCTAGCCATGTGATT AAACATTTTCAGTGTATTGC AATACTAAGTTGAGATGATA ATAAACCCTAGGAAGCCAAT GCATGA

K. Ohno, T. Negoro, Y. Ora, 2005 .

EEG Topography in Porencephaly and Arachnoid Cyst

T. Negoro, K. Inokuma, A. Matsumoto, 1985, Clinical EEG.

Phenytoin desensitization in a child with symptomatic localization-related epilepsy

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2007, Brain and Development.

Inflammatory pathological changes in a 2-year-old boy with Charcot–Marie–Tooth disease

G. Sobue, Hiroyuki Takada, Kazuyoshi Watanabe, 2001, Brain and Development.

Case report Inflammatory pathological changes in a 2-year-old boy with Charcot-Marie-Tooth disease

G. Sobue, Hiroyuki Takada, Kazuyoshi Watanabe, 2001 .

Kobe University Repository : Kernel タイトル Tit le Relat ionship between Clinical Findings and Quant itat ive Electroencephalographic Variables in Comatose Pat ients 著者

H. Ando, T. Negoro, K. Yoshiko, 2019 .

Relationship between Clinical Findings and Quantitative Electroencephalographic Variables in Comatose Patients

H. Ando, T. Negoro, K. Yoshiko, 2008 .

Phenytoin desensitization monitored by antigen specific T cell response using carboxyfluorescein succinimidyl ester dilution assay.

H. Kurahashi, Kazuyoshi Watanabe, A. Okumura, 2007, European journal of paediatric neurology : EJPN : official journal of the European Paediatric Neurology Society.

Efficacy of Zonisamide for intractable epilepsy in childhood.

Kazuyoshi Watanabe, T. Negoro, I. Takahashi, 1987 .

Congenital Infiltrating Lipomatosis of the Face with Ipsilateral Hemimegalencephaly, Band Heterotopia, and Hypertrophy of Brainstem and Cerebellum

A. Okumura, T. Negoro, K. Maruyama, 2010, Neuropediatrics.

Autopsy findings of a patient with acute encephalitis and refractory, repetitive partial seizures

Kazuyoshi Watanabe, T. Negoro, H. Kidokoro, 2016, Seizure.

Micturition induced seizures: Ictal EEG and subtraction ictal SPECT findings

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2007, Epilepsy Research.

Prognostic value of positron emission tomography in cryptogenic West syndrome

T. Ishigaki, M. Tadokoro, Hiroyuki Takada, 2002, Developmental medicine and child neurology.

Benign Infantile Epilepsy with Complex Partial Seizures

T. Negoro, I. Takahashi, N. Yamamoto, 1990, Journal of clinical neurophysiology : official publication of the American Electroencephalographic Society.

Repetitive sleep starts: An important differential diagnosis of infantile spasms

A. Okumura, T. Negoro, H. Kidokoro, 2021, Epilepsy & Behavior.

Cortical Hypometabolism and Delayed Myelination in West Syndrome

Kazuyoshi Watanabe, K. Aso, T. Negoro, 1996, Epilepsia.

Successful polymerase chain reaction‐based diagnosis of fungal meningitis in a patient with chronic granulomatous disease

K. Aso, T. Negoro, J. Natsume, 1998, Acta paediatrica Japonica : Overseas edition.

Treatment of Epilepsy in Infancy with Special Emphasis on ACTH Therapy

T. Negoro, Kazuyoshi Watanabe, Tamiko Negoro, 1986, The Japanese journal of psychiatry and neurology.

Cerebral oxygenation state in childhood moyamoya disease: a near-infrared spectroscopy study.

T. Negoro, K. Watanabe, M. Negoro, 2000, Pediatric neurology.

Efficacy of a diazepam suppository at preventing febrile seizure recurrence during a single febrile illness

Kazuyoshi Watanabe, A. Okumura, T. Negoro, 2009, Brain and Development.