I. Tzanetakis

发表

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease.

R. Martin, I. Tzanetakis, W. Wintermantel, 2003, Plant disease.

Strawberry necrotic shock virus is a distinct virus and not a strain of Tobacco streak virus

R. Martin, I. Tzanetakis, I. C. Mackey, 2004, Archives of Virology.

Epidemiology of Strawberry pallidosis-associated virus and Occurrence of Pallidosis Disease in North America.

M. Bolda, I. Tzanetakis, W. Wintermantel, 2006, Plant disease.

Incidence and Ecology of Blackberry yellow vein associated virus.

John R. Clark, I. Tzanetakis, Robert R Martin, 2007, Plant disease.

Detection of strawberry viruses in Egypt.

I. Tzanetakis, Robert R Martin, M. Ragab, 2009 .

First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States.

R. Martin, I. Tzanetakis, T. L. Guzman-Baeny, 2009, Plant disease.

Emerging strawberry virus and virus-like diseases in the world

I. Tzanetakis, 2010 .

Viruses and Virus Diseases of Rubus.

I. Tzanetakis, Robert R Martin, S. MacFarlane, 2013, Plant disease.

High Risk Strawberry Viruses by Region in the United States and Canada: Implications for Certification, Nurseries, and Fruit Production.

I. Tzanetakis, Robert R Martin, R. Martin, 2013, Plant disease.

The population structure of Rose rosette virus in the USA.

K. Lamour, I. Tzanetakis, A. Katsiani, 2020, The Journal of general virology.

Pathogen-Tested Planting Material

I. Tzanetakis, Robert R Martin, R. Martin, 2014, Encyclopedia of Agriculture and Food Systems.

First Report of Beet pseudo yellows virus in Blackberry in the United States.

R. Martin, I. Tzanetakis, 2004, Plant disease.

Fragaria chiloensis cryptic virus: A New Strawberry Virus Found in Fragaria chiloensis Plants from Chile.

R. Martin, I. Tzanetakis, 2005, Plant disease.

Blackberry virus E: an unusual flexivirus

I. Tzanetakis, S. Sabanadzovic, N. Abou Ghanem-Sabanadzovic, 2011, Archives of Virology.

New and Emerging Viruses of Blueberry and Cranberry

I. Tzanetakis, Robert R Martin, J. Polashock, 2012, Viruses.

Epidemiology of Blackberry yellow vein associated virus.

I. Tzanetakis, W. Wintermantel, Arturo A. Cortez, 2013, Plant disease.

Epidemiology of Blackberry chlorotic ringspot virus.

I. Tzanetakis, B. Poudel, T. Hồ, 2014, Plant disease.

An integrated badnavirus is prevalent in fig germplasm.

I. Tzanetakis, Mohamed Hassan, A. Laney, 2012, Phytopathology.

The evolution of emaraviruses is becoming more complex: seven segments identified in the causal agent of Rose rosette disease.

I. Tzanetakis, T. Hồ, P. L. Di Bello, 2015, Virus research.

A discovery 70 years in the making: characterization of the Rose rosette virus.

K. Keller, I. Tzanetakis, Robert R Martin, 2011, The Journal of general virology.

Molecular characterization and detection of a novel vitivirus infecting blackberry

I. Tzanetakis, Mohamed Hassan, M. Shahid, 2018, Archives of Virology.

Next-generation sequencing of elite berry germplasm and data analysis using a bioinformatics pipeline for virus detection and discovery.

I. Tzanetakis, Robert R Martin, T. Hồ, 2015, Methods in molecular biology.

Home-made enzymatic premix and Illumina sequencing allow for one-step Gibson assembly and verification of virus infectious clones

J. García, F. Pasin, C. Simón-Mateo, 2020, Phytopathology research.

Taxonomy of the family Arenaviridae and the order Bunyavirales: update 2018

E. Koonin, Y. Wolf, J. Derisi, 2018, Archives of Virology.

Proteome expansion in the Potyviridae evolutionary radiation

J. Daròs, F. Pasin, I. Tzanetakis, 2022, FEMS microbiology reviews.

2021 Taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales.

John S. Hu, Steven B. Bradfute, E. Koonin, 2021, Archives of virology.

2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales

Steven B. Bradfute, E. Koonin, Y. Wolf, 2020, Archives of Virology.

Southern tomato virus: The link between the families Totiviridae and Partitiviridae.

Judith K. Brown, I. Tzanetakis, Robert R Martin, 2009, Virus research.

Genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus

S. Scott, R. Martin, I. Tzanetakis, 2010, Archives of Virology.

Double-stranded RNAs and their use for characterization of recalcitrant viruses

W. Jelkmann, I. Tzanetakis, Robert R Martin, 2011 .

Rubus canadensis virus 1, a novel betaflexivirus identified in blackberry

I. Tzanetakis, S. Sabanadzovic, N. Abou Ghanem-Sabanadzovic, 2012, Archives of Virology.

Characterization of the first Rubus yellow net virus genome from blackberry

I. Tzanetakis, D. Stainton, D. Delić, 2022, Virus Genes.

A Novel Ilarvirus Is Associated with Privet Necrotic Ringspot Disease in the Southern United States.

R. C. Stephenson, I. Tzanetakis, S. Sabanadzovic, 2016, Phytopathology.

Viral Interactions Lead to Decline of Blackberry Plants.

I. Tzanetakis, Robert R Martin, J. Susaimuthu, 2008, Plant disease.

Soybean vein necrosis orthotospovirus can move systemically in soybean in the presence of bean pod mottle virus

I. Tzanetakis, Jing Zhou, 2019, Virus Genes.

A novel emaravirus is associated with redbud yellow ringspot disease.

K. Keller, I. Tzanetakis, R. Gergerich, 2016, Virus research.

A new, sensitive and efficient method for taxonomic placement in the Eriophyoidea and virus detection in individual eriophyoids

I. Tzanetakis, M. Lewandowski, T. Druciarek, 2019, Experimental and Applied Acarology.

Mint Viruses: Beauty, Stealth, and Disease.

J. Postman, I. Tzanetakis, A. Samad, 2010, Plant disease.

Quarantine Regulations and the Impact of Modern Detection Methods.

I. Tzanetakis, F. Constable, R. Martin, 2016, Annual review of phytopathology.

Correction to: 2021 Taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales

John S. Hu, Steven B. Bradfute, E. Koonin, 2021, Archives of Virology.

Identification, Characterization, and Detection of a Novel Strawberry Cytorhabdovirus.

I. Tzanetakis, Ava Medberry, 2022, Plant disease.

Rubus canadensis virus 1, a novel betaflexivirus identified in blackberry

I. Tzanetakis, S. Sabanadzovic, N. Abou Ghanem-Sabanadzovic, 2013, Archives of Virology.

Characterization of endogenous Rubus yellow net virus in raspberries

J. Buhler, I. Tzanetakis, T. Hồ, 2021, bioRxiv.

Development of a virus detection and discovery pipeline using next generation sequencing.

I. Tzanetakis, T. Hồ, 2014, Virology.

Epidemiology of criniviruses: an emerging problem in world agriculture

I. Tzanetakis, W. Wintermantel, R. Martin, 2013, Front. Microbiol..

Epidemiology of soybean vein necrosis-associated virus.

I. Tzanetakis, Jing Zhou, 2013, Phytopathology.

Molecular characterization of a new tospovirus infecting soybean

M. Newman, R.-H. Wen, M. R. Hajimorad, 2011, Virus Genes.

Economic studies reinforce efforts to safeguard specialty crops in the United States.

M. Fuchs, D. Golino, I. Tzanetakis, 2020, Plant disease.

Genome sequence and detection of peach rosette mosaic virus.

I. Tzanetakis, A. Schilder, A. Katsiani, 2018, Journal of virological methods.

Truncation of a P1 leader proteinase facilitates potyvirus replication in a non-permissive host.

J. García, F. Pasin, I. Tzanetakis, 2018, Molecular plant pathology.

ICTV Virus Taxonomy Profile: Secoviridae

M. Fuchs, N. Yoshikawa, I. Tzanetakis, 2017, The Journal of general virology.

Molecular characterization and population structure of blackberry vein banding associated virus, new Ampelovirus associated with yellow vein disease.

K. Keller, I. Tzanetakis, S. Sabanadzovic, 2013, Virus research.

Further complexity of the genus Crinivirus revealed by the complete genome sequence of Lettuce chlorosis virus (LCV) and the similar temporal accumulation of LCV genomic RNAs 1 and 2.

I. Tzanetakis, J. Ng, N. Salem, 2009, Virology.

The complete nucleotide sequence and genome organization of tomato infectious chlorosis virus: a distinct crinivirus most closely related to lettuce infectious yellows virus

I. Tzanetakis, W. Wintermantel, Ruhui Li, 2009, Archives of Virology.

Emerging and reemerging virus diseases of blueberry and cranberry.

I. Tzanetakis, J. Polashock, F. Caruso, 2009 .

Characterization of Three Novel Viruses Infecting Raspberry

I. Tzanetakis, R. Martin, 2008 .

The use of reverse transcriptase for efficient first- and second-strand cDNA synthesis from single- and double-stranded RNA templates.

K. Keller, R. Martin, I. Tzanetakis, 2005, Journal of virological methods.

2022 taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales

David G. Karlin, Steven B. Bradfute, E. Koonin, 2022, Archives of virology.

A new method for extraction of double-stranded RNA from plants.

I. Tzanetakis, R. Martin, 2008, Journal of virological methods.

Nucleotide sequence of the tripartite Fragaria chiloensis cryptic virus and presence of the virus in the Americas

I. Tzanetakis, R. Martin, R. Price, 2008, Virus Genes.

Taxonomy of the family Arenaviridae and the order Bunyavirales: update 2018

E. Koonin, Y. Wolf, J. Derisi, 2018, Archives of Virology.

A new, widespread emaravirus discovered in blackberry.

K. Keller, I. Tzanetakis, S. Sabanadzovic, 2017, Virus research.

First report of Gentian Kobu-sho-associated virus infecting peony in the United States and the Netherlands.

I. Tzanetakis, M. Botermans, D. Michener, 2021, Plant disease.

Amalgaviruses (Amalgaviridae)

I. Tzanetakis, S. Sabanadzovic, R. A. Valverde, 2021, Encyclopedia of Virology.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

S. Elena, W. Cho, T. Candresse, 2022, The Journal of general virology.

Proposed revision of the family Secoviridae taxonomy to create three subgenera, “Satsumavirus”, “Stramovirus” and “Cholivirus”, in the genus Sadwavirus

M. Fuchs, N. Yoshikawa, I. Tzanetakis, 2019, Archives of Virology.

Characterization and Recent Advances in Detection of Strawberry Viruses.

I. Tzanetakis, R. Martin, 2006, Plant disease.

First Report of Strawberry as a Natural Host of Apple mosaic virus.

R. Martin, I. Tzanetakis, 2005, Plant disease.

Identification of viruses in declining strawberries along the west coast of North America

M. Bolda, I. Tzanetakis, R. Martin, 2004 .

TWO CRINIVIRUSES ARE ASSOCIATED WITH THE STRAWBERRY PALLIDOSIS DISEASE

K. Keller, I. Tzanetakis, W. Wintermantel, 2004 .

Identification and Detection of a Virus Associated with Strawberry Pallidosis Disease.

S. Hokanson, K. Keller, J. Maas, 2004, Plant disease.

The complete nucleotide sequence and genome organization of tomato chlorosis virus

G. Wisler, I. Tzanetakis, W. Wintermantel, 2005, Archives of Virology.

Evidence of sympatric speciation of elderberry carlaviruses.

K. Keller, J. Postman, I. Tzanetakis, 2016, Virus research.

A new ophiovirus is associated with blueberry mosaic disease.

K. Keller, I. Tzanetakis, T. Hồ, 2014, Virus research.

High incidence of seed transmission of Papaya ringspot virus and Watermelon mosaic virus, two viruses newly identified in Robinia pseudoacacia

I. Tzanetakis, A. Laney, M. V. Avanzato, 2012, European Journal of Plant Pathology.

Diodia vein chlorosis virus is a group-1 crinivirus

I. Tzanetakis, W. Wintermantel, B. Poudel, 2011, Archives of Virology.

Blueberry latent virus: an amalgam of the Partitiviridae and Totiviridae.

I. Tzanetakis, Jing Zhou, R. Martin, 2011, Virus research.

New viruses found in fig exhibiting mosaic symptoms

K. Keller, I. Tzanetakis, A. Laney, 2010 .

Complete nucleotide sequence of an isolate of coleus vein necrosis virus from verbena

R. Martin, I. Tzanetakis, M. Putnam, 2007, Archives of Virology.

A VIRUS ASSOCIATED WITH BLUEBERRY FRUIT DROP DISEASE

I. Tzanetakis, Mark R. Sweeney, L. A. Wegener, 2006 .

Mint virus X: a novel potexvirus associated with symptoms in ‘Variegata’ mint

J. Postman, R. Martin, I. Tzanetakis, 2005, Archives of Virology.

New features in the genus Ilarvirus revealed by the nucleotide sequence of Fragaria chiloensis latent virus.

I. Tzanetakis, R. Martin, 2005, Virus research.

A member of a new genus in the Potyviridae infects Rubus.

I. Tzanetakis, J. Susaimuthu, R. Gergerich, 2008, Virus research.

High Throughput Sequencing For Plant Virus Detection and Discovery.

R. Martin, I. Tzanetakis, D E V Villamor, 2019, Phytopathology.

Identification, detection and transmission of a new vitivirus from Mentha

J. Postman, R. Martin, I. Tzanetakis, 2007, Archives of Virology.

Characterization of a Novel Member of the Family Closteroviridae from Mentha spp.

J. Postman, I. Tzanetakis, R. Martin, 2005, Phytopathology.

CCGTCGCTCCTGGATCTGTCAA HelR GCCGCAGTGAACTGTATTAGAGGTGGGAT HelF ATCCCACCTCTAATACAGTTCACTGCGGC PolR ACGAGAAATTAGACGCCAAACAATGAATG PolF CCACGCTGAAGCGATCTGTATCGAAAC HSPR ACCACGAAAGTGCTGTTTCTAACAGAGAC HSPF AGAAACAGCACTTTCGTGGTTAAAGCGTC CPR GACATCAGTTGCGTTTTCCACCTCCG CPF AGCTCGGAGGTGGAAAACGCAACTGA

J. Postman, I. Tzanetakis, R. Martin, 2005 .

Population structure of blueberry mosaic associated virus: Evidence of reassortment in geographically distinct isolates.

K. Keller, I. Tzanetakis, A. Schilder, 2015, Virus research.

A Virus in American Blackcurrant (Ribes americanum) with Distinct Genome Features Reshapes Classification in the Tymovirales

J. Postman, I. Tzanetakis, T. Hồ, 2018, Viruses.

A New Potyvirus sp. Infects Verbena Exhibiting Leaf Mottling Symptoms.

K. Keller, I. Tzanetakis, M. Putnam, 2010, Plant disease.

Identification and characterization of Raspberry mottle virus, a novel member of the Closteroviridae.

I. Tzanetakis, A. Halgren, Nola J. Mosier, 2007, Virus research.

Strawberry chlorotic fleck: identification and characterization of a novel Closterovirus associated with the disease.

I. Tzanetakis, R. Martin, 2007, Virus research.

Nucleotide sequence of Blackberry yellow vein associated virus, a novel member of the Closteroviridae.

I. Tzanetakis, J. Susaimuthu, R. Gergerich, 2006, Virus research.

Nucleotide sequence, genome organization and phylogenetic analysis of Strawberry pallidosis associated virus, a new member of the genus Crinivirus

R. Martin, I. Tzanetakis, J. Reed, 2005, Archives of Virology.

HOW SIMILAR ARE PLANT AND INSECT VIRUSES? STRAWBERRY LATENT VIRUS: A STUDY CASE

R. Martin, I. Tzanetakis, 2008 .

Population genetics of cycas necrotic stunt virus and the development of multiplex RT-PCR diagnostics

I. Tzanetakis, D. Michener, C. Shaffer, 2021, Virus Research.

Complete Nucleotide Sequence, Genome Organization, and Comparative Genomic Analyses of Citrus Yellow-Vein Associated Virus (CYVaV)

K. Gadhave, I. Tzanetakis, A. Simon, 2021, Frontiers in Microbiology.

A tymovirus with an atypical 3'-UTR illuminates the possibilities for 3'-UTR evolution.

T. Dreher, I. Tzanetakis, Ching-Hsiu Tsai, 2009, Virology.

COMPLETE NUCLEOTIDE SEQUENCE AND PROPERTIES OF RASPBERRY MOTTLE VIRUS

I. Tzanetakis, A. Halgren, R. Martin, 2008 .

Identification, Characterization, and Detection of Black raspberry necrosis virus.

I. Tzanetakis, A. Halgren, R. Martin, 2007, Phytopathology.

A virus between families: nucleotide sequence and evolution of Strawberry latent ringspot virus.

J. Postman, I. Tzanetakis, R. Gergerich, 2006, Virus research.

A Member of the Closteroviridae from Mint with Similarities to All Three Genera of the Family.

J. Postman, I. Tzanetakis, R. Martin, 2005, Plant disease.

Complete Nucleotide Sequence of a Strawberry Isolate of Beet Pseudoyellows Virus

I. Tzanetakis, R. Martin, 2004, Virus Genes.

Blackcurrant waikavirus A, a new member of the genus Waikavirus, and its phylogenetic and molecular relationship with other known members

J. Postman, I. Tzanetakis, T. Hồ, 2020, European Journal of Plant Pathology.

Tulip virus X (TVX) associated with lemon balm (Melissa officinalis) variegation: first report of TVX in the USA

I. Tzanetakis, I. C. Mackey, R. Martin, 2005 .

Genomic Characterization and Population Structure of a Badnavirus Infecting Blackberry.

I. Tzanetakis, S. Sabanadzovic, M. Shahid, 2017, Plant disease.

Complete sequence and genetic characterization of Raspberry latent virus, a novel member of the family Reoviridae.

K. Keller, W. Jelkmann, I. Tzanetakis, 2011, Virus research.

Safeguarding Fruit Crops in the Age of Agricultural Globalization.

M. Fuchs, D. Golino, I. Tzanetakis, 2015, Plant disease.

Population structure of blackberry chlorotic ringspot virus in the United States

I. Tzanetakis, B. Poudel, 2013, Archives of Virology.

Special Issue “Plant Virus Epidemiology and Control”

I. Tzanetakis, I. Koloniuk, R. Martin, 2020, Viruses.

Characterization and detection of a novel idaeovirus infecting blackcurrant

J. Postman, I. Tzanetakis, T. Hồ, 2017, European Journal of Plant Pathology.

First Report of Strawberry polerovirus-1 in Strawberry in the United States

I. Tzanetakis, T. Thekke-Veetil, 2016 .

Expanding Field of Strawberry Viruses Which Are Important in North America

I. Tzanetakis, R. Martin, 2013 .

EVIDENCE OF MIXED VIRUS INFECTIONS CAUSING SEVERE SYMPTOMS AND DDECLINE OF BLACKBERRIES

I. Tzanetakis, J. Susaimuthu, R. Gergerich, 2008 .

Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species

S. Massart, J. Postman, J. Špak, 2018, Viruses.

First Report of Raspberry leaf mottle virus in Blackberry in the United States

I. Tzanetakis, S. Sabanadzovic, H. Burrack, 2017 .

A systems-based approach to manage strawberry virus diseases

I. Tzanetakis, R. Martin, 2017 .

Detection of Strawberry necrotic shock virus using conventional and TaqMan(®) quantitative RT-PCR.

I. Tzanetakis, V. Whitaker, C. Moyer, 2016, Journal of virological methods.

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America.

J. Postman, R. Martin, I. Tzanetakis, 2004, Plant disease.

Strawberry Necrotic Shock Virus: A New Virus Previously Thought to Be Tobacco Streak Virus

I. Tzanetakis, I. C. Mackey, R. Martin, 2004 .

Strawberry necrotic shock virus (strawberry necrotic shock virus).

I. Tzanetakis, 2022, CABI Compendium.

Tobacco streak virus (tobacco streak).

I. Tzanetakis, 2021, CABI Compendium.

Soybean vein necrosis virus: an emerging virus in North America

I. Tzanetakis, Jing Zhou, 2018, Virus Genes.

First Report of Citrus leaf blotch virus in Peony in the U.S.A.

I. Tzanetakis, Sherrie Smith, J. Gress, 2017 .

Control of virus diseases of berry crops.

I. Tzanetakis, R. Martin, 2015, Advances in virus research.

Population structure of blackberry chlorotic ringspot virus in the United States

I. Tzanetakis, B. Poudel, 2012, Archives of Virology.

Population structure of Blackberry yellow vein associated virus, an emerging crinivirus.

I. Tzanetakis, S. Sabanadzovic, B. Poudel, 2012, Virus research.

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States.

J. Postman, R. Martin, I. Tzanetakis, 2007, Plant disease.

Yellow vein‐affected blackberries and the presence of a novel Crinivirus

I. Tzanetakis, J. Susaimuthu, R. Gergerich, 2006 .

Blueberry mosaic associated virus –a putative, new member ofOphioviridae

K. Keller, R. Martin, I. Tzanetakis, 2016 .

Transmission attributes and resistance to rose rosette virus

I. Tzanetakis, T. Druciarek, P. L. Di Bello, 2018 .

Molecular phylogeny of Phyllocoptes associated with roses discloses the presence of a new species.

I. Tzanetakis, M. Lewandowski, T. Druciarek, 2021, Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases.

Resistance to Rose Rosette Virus and Transmission Attributes

I. Tzanetakis, T. Druciarek, T. Thekke-Veetil, 2016 .

Identification of the rose rosette disease agent.

I. Tzanetakis, T. Hồ, P. L. D. Bello, 2015 .

Beauty, Stealth, and Disease

Joseph D. Postman, Ioannis E. Tzanetakis, A. Samad, 2010 .

Survey for Viruses of Grapevine in Oregon and Washington.

R. Martin, I. Tzanetakis, K. Eastwell, 2002, Plant disease.

Raspberry leaf blotch emaravirus in Bosnia and Herzegovina: population structure and systemic movement

I. Tzanetakis, M. Radulović, D. Delić, 2020, Molecular Biology Reports.

Transmission blockage of an orthotospovirus using synthetic peptides.

I. Tzanetakis, Jing Zhou, 2019, The Journal of general virology.

Population structure, evolution and detection of blackberry leaf mottle‐associated virus, an emerging emaravirus

I. Tzanetakis, M. Hassan, 2019, Plant Pathology.

Development of reliable detection assays for blueberry mosaic- and blackberry vein banding- associated viruses based on their population structures.

I. Tzanetakis, T. Thekke-Veetil, 2017, Journal of virological methods.

First Report of Soybean Vein Necrosis Virus Infecting Kudzu (Pueraria montana) in the United States of America

I. Tzanetakis, S. Sabanadzovic, J. Zhou, 2018, Plant Disease.

Assessing soybean genotypes for feeding damage by Neohydatothrips variabilis (Thysanoptera: Thripidae)

I. Tzanetakis, Donn T. Johnson, Jing Zhou, 2020 .

The 5'-UTR of Turnip yellow mosaic virus does not include a critical encapsidation signal.

T. Dreher, I. Tzanetakis, T. Cho, 2009, Virology.

High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production

I. Tzanetakis, R. Martin, 2018, Viruses.

Proposed revision of the family Secoviridae taxonomy to create three subgenera, “Satsumavirus”, “Stramovirus” and “Cholivirus”, in the genus Sadwavirus

M. Fuchs, N. Yoshikawa, I. Tzanetakis, 2019, Archives of Virology.

First Report of Rosa multiflora cryptic virus in Rosa multiflora in the Eastern United States.

R. Martin, I. Tzanetakis, 2008, Plant Disease.

A new Ilarvirus found in rose

I. Tzanetakis, R. Gergerich, R. Martin, 2006 .

EPIDEMIOLOGY OF BLACKBERRY CHLOROTIC RINGSPOT VIRUS

I. Tzanetakis, B. Poudel, T. Hồ, 2015 .

Genomic analysis and development of infectious clone of a novel carlavirus infecting blueberry.

R. Martin, I. Tzanetakis, D. Villamor, 2022, Phytopathology.

Integration of Rubus yellow net virus in the raspberry genome: A story centuries in the making.

J. Buhler, I. Tzanetakis, T. Hồ, 2024, Virology.