References

发表

Small-scale Water Current Turbines for River Applications

UK., Australia., Russia., 2010 .

Automatic Indexing for Research Papers Using

References, Wei Liu, 2022 .

Routing and Job-shop Scheduling in O(congestion

F T Leighton, D P Williamson, References, 1996 .

I 34-2002 The potential impact of flat panel displays on broadcast delivery of television

Thomas Wiegand, G. Sullivan, T. Wiegand, 2002 .

[3] R. C. Berwick and S. Pilato. Learning syntax by

I. Witten, J. Storer, J. Cleary, 2022 .

3.2 Recognition of Specic Faces

R. Bellman, D. Foster, I. Gold, 1991 .

Future Opportunities and Threats in a Fragmented Sport Media World – Trends and Strategic Implications for Sport Media Enterprises

References, 2010 .

Number of Tasks P=1 P=2 P=3 P=4 P=5 P=6 P=7 Natural Ordering Cray Results 8 General Conclusions \itpack 2c: a Fortran Package for Solving Large Sparse Linear Systems by Adaptive Accelerated Iterative Methods." Acm Transactions Cray Version

L. J. Hayes, R. Grimes, D. Young, 1989 .

Ecosystem approach to fisheries

Stuart, E. Smith, Baillie, 2009 .

6 Status and Experience 5 User Interface 2 Sms Paradigm Alms -programming Tools for Coupling Application Codes in a Network Environment

References, To Be Continued, H E Bal, .

Table of Contents Cert Research Vision Executive Summary 2009 Research Report Abstracts Applying Function Extraction (fx) Techniques to Reverse Engineer Virtual Machines Function Extraction for Malicious Code Analysis Metrics for Evaluating Network Sensor Placement Rayon: a Unified Framework for Dat

Cory F. Cohen, A. Hevner, M. Pleszkoch, 2022 .

Eecient Storage Techniques for Digital Continuous Multimedia. Ieee Transactions a Disk-based Storage Architecture for Movie on Demand Servers a Le System for Continius Media. Acm Transactions on Computer

Ozden, References, P V Rangan, .

Solution of P-matrix Linear Complementarity Problems Using a Potential Reduction Algorithm. Siam an Implementation of Karmarkar's Algorithm for Linear Programming. Mathematical Programming, 44:297{335, 1989. 2] F. Alizadeh. Optimization over Positive Semi-deenite Cone: Interior-point Methods and Com

P M Pardalos, P. Pardalos, G. Veiga, 1996 .

Experimental Results :

G. Golub, J. Johnstone, References, 2013 .

Juvant Tamoxifen Therapy for Breast Cancer. Note

B. Fisher, E. Fisher, L. Rutqvist, 2022 .

Summary of ProgreSS

H. C. Ferreira, D. J. Costello, References, 2012 .

Parallel Simulation of Message Routing Networks 12 Euromicro Pdp'95

J. Carson, R. Bryant, References, 2022 .

Bioenergy – Chances and Limits

References, English, the“executiveSummary, 2012 .

Figure 3: Microprocessor Speciication Bolic Model Checking for Sequential Circuit Veriication. Ieee Transactions on 5 Conclusions and Future Work 4.2 Abstracting the Microprocessor Design 4.1 Proving the Lemmas Using Model-checking

D. E. Long, N. Shankar, M. Gordon, 2022 .

THE OVER-RELAXED A−PROXIMAL POINT ALGORITHM AND APPLICATIONS TO NONLINEAR VARIATIONAL INCLUSIONS IN BANACH SPACES

H. Lan, References, Y. Cho, 2009 .

Clustering short texts using wikipedia

Somnath Banerjee, Krishnan Ramanathan, Ajay Gupta, 2007, SIGIR.

Invaluable Feedback from a Superb Team of Requirements Engineers

Steven F Knittel, M. Yannakakis, B. Kernighan, 1996 .

We 4 Experimental Results Technology: 0:5m Cmos Ic Multi-chip Modules (mcms)

T. C. Hu, B. A. McCoy, A. Kahng, 1995 .

QIAN AND WIEDERHOLD

Vol., J. Minker, References, 2008 .

Adaptive Radi~ion Character Displacement and Replicate

D. Schluter, References, J. Mcphail, 2022 .

A Query Algebra for Object-oriented Databases. Technical Report Acknowledgements 4.4 Function Overloading 3.3 Combining Object Orientation and Functional Programming 4 Conceptual Notions of Designer 2 Theoretical Foundations 3 Requirements of a New Programming Paradigm a New Programming Paradigm for

A. H. Bond, S. R. Bradley, A. Agogino, 1994 .

Third International Conference on Performance of Distributed Systems and Integrated Communication Automated Generation and Analysis of Markov Reward Models Using Stochastic Reward Nets. 5.3.2 Non-homogeneous Ctmcs 5.2.1 Stiness Avoidance 5.2.2 Stiness Tolerance

Kishor S. Trivedi, G. S. Graham, R. Plemmons, 2022 .

4 Results and Conclusions

P. Denning, M. Mulder, D. Gries, 2022 .

Internal Accession Date Only

F. MacWilliams, N. Sloane, A. Calderbank, 2022 .

Pulmonary arterial morphology and intravascular pressure revisited

Lund, W. Maier, References, 2005 .

Threshold Phenomena in an "easy" Class of Random Lattices and Eecient Reduction Algorithms Random Assignment Problem and Asymptotic Essential Uniqueness in Optimization over Random Data the Kernel Method the Height and Width of Simple Trees

D. Aldous, M. Yor, P. Flajolet, 2022 .

7. Conclusions Acknowledgments

S. Sastry, R. Murray, D. Tilbury, 2022 .

6 Related Work

M. J. Quinn, J. Hennessy, M. Lam, 1993 .

Do Foreign Patent-Protection Rights Promote Domestic R&D Spending? Evidence from Canadian Firms

Review, Introduction, References, 2015 .

25 years of C60.

R. Curl, E. Malek, H. Kroto, 2010, Nature nanotechnology.

Occupational Exposure and Pulmonary Function in Health Care Workers in an Aerosol Pentamidine Clinic

P. Diot, E. Lemarié, R. Bone, 2007 .

Table 1: Redesign 5 Implementation and Results Figure 4: Multi-level Logic Minimization 3.2 Multi-level Logic Minimization 4 Logic Synthesis from the Results of Boolean Unication

J. N. Culliney, A. Sangiovanni-Vincentelli, G. Hachtel, 1991 .

Estimating Collateral Circulation

References, Erich I Vormiittag, Chir, 2005 .

Frameworks for commercial success.

H. Li, References, M.-F., 2016, Nature chemistry.

Internship Proposal ( M 2 ) : Sensitivity Analysis in Timed Automata

W. Levine, J. Baillieul, T. Henzinger, 2015 .

Letters to the Editor

R. Schwartzman, D. Libon, References, 2009 .

CirculIatlion OCTOBER 1967 VOL . XXXVI NO . 4 AN OFFICIAL JOURNAL of 0 te AMERICAN ] 4 EART ASSOCIATION Editorial Follow-up Care for Patients with Cardiac Pacemakers THE 1-YEAR MORTALITY

E. Sowton, References, 2005 .

Sea Level Rise and Implications for Low-Lying Islands, Coasts and Communities Supplementary Material

A. Magnan, References, Results, 2019 .

Collateral flow and restenosis : appreciating hydraulics and outcomes of percutaneous coronary intervention

P. Widimsky, References, Topol Ej, 2000 .

A NEW GROWTH MODEL IN EU-CEE

Eu, References, Sector, 2021 .

>mmu-miR-1=miR-1 TACATACTTCTTTACATTCCA >hsa-let-7a=let-7a AACTATACAACCTACTACCTCA >hsa-miR-7=miR-7 AACAAAATCACTAGTCTTCCA >mmu-miR-9=miR-9 TCATACAGCTAGATAACCAAAGA >hsa-miR-9*=miR-9* ACTTTCGGTTATCTAGCTTTA >mmu-miR-15b=miR-15 TGTAAACCATGATGTGCTGCTA >hsa-miR-16=miR-16 CGCCAATATTTACGTGCTGCTA >hsa-miR-17-5

References, L. Liang, W. Huber, 2007 .

Book Review: Tyler—s Honest Herbal: A Sensible Guide to the Use of Herbs and Related Remedies

References, Valerian, 2000 .

LIST OF PUBLICATIONS OF JOEL DAOU

Pearce, References, J. Taylor, 2013 .

UvA-DARE ( Digital Academic Repository ) Schooling , earnings and risk : a research agenda and some

References, Hartog, References, 2003 .

The Pennsylvania State University The Graduate School College of Health and Human Development FRIENDSHIP DYNAMICS AND VICTIMIZATION: TESTING THREE HYPOTHESES USING ACTOR-ORIENTED NETWORKING MODELS A Thesis in Human Development and Family Studies

Study, Scott D. Gest, S. Gest, 2010 .

A molecular jigsaw puzzle.

References, C. Heeger, Shirakawa, 2017, Nature materials.

Multiscale analysis of changes in matrix structure by culturing osteoblasts

Introduction, References, staining, 2018 .

The Strategic Orientation of Armed Forces in Times of Climate Change

Personnel, Introduction, References, 2020 .

Table 11: Result for D2 When Maximum Weights Are Estimated Gloss to Vector-space Databases and Broker Hierar- Gloss to Vector-space Databases and Broker Hier

H. Garcia-Molina, C. Buckley, W. Meng, 1999 .

CHANGES IN THE OVERCONFIDENCE EFFECT AFTER DEBIASING

References, Méthod, 2011 .

Translating the A1C Assay Into Estimated Average Glucose Values

E. Kilpatrick, G. Leslie, References, 2009, Diabetes Care.

Compression of the Prechiasmatic Optic Nerve Produces a Junctional Scotoma

J. Ruiz-Moreno, References, S. Alicante, 2022 .

The DA and the case of the plug

F. Delahaye, References, Katz, 2005 .