S. Schenk

发表

Exercise and high-fat feeding remodel transcript-metabolite interactive networks in mouse skeletal muscle

J. W. Allwood, W. Dunn, L. Edwards, 2017, Scientific Reports.

Muscle gene expression patterns in human rotator cuff pathology.

R. Lieber, S. Ward, S. Schenk, 2014, The Journal of bone and joint surgery. American volume.

Basic Science

R. Lieber, Katrina Jane Williams, M. Fahey, 2016 .

Inducible nitric oxide synthase deficiency in myeloid cells does not prevent diet-induced insulin resistance.

J. Olefsky, M. Saberi, S. Schenk, 2010, Molecular endocrinology.

Skeletal muscle Nur77 expression enhances oxidative metabolism and substrate utilization[S]

A. Hevener, R. Evans, O. Ilkayeva, 2012, Journal of Lipid Research.

Increased Adipocyte O2 Consumption Triggers HIF-1α, Causing Inflammation and Insulin Resistance in Obesity

Jung-whan Kim, S. Watkins, J. Olefsky, 2014, Cell.

High fatty acid availability after exercise alters the regulation of muscle lipid metabolism.

J. Horowitz, Minghua Li, S. Schenk, 2011, Metabolism: clinical and experimental.

Unraveling the Complexities of SIRT1-Mediated Mitochondrial Regulation in Skeletal Muscle

S. Schenk, A. Philp, 2013, Exercise and sport sciences reviews.

Ceramides Contained in LDL Are Elevated in Type 2 Diabetes and Promote Inflammation and Skeletal Muscle Insulin Resistance

P. Meikle, J. Horowitz, B. Kingwell, 2013, Diabetes.

Regulation of plasma ceramide levels with fatty acid oversupply: evidence that the liver detects and secretes de novo synthesised ceramide

J. Horowitz, M. Watt, S. Schenk, 2012, Diabetologia.

Manipulation of dietary carbohydrate and muscle glycogen affects glucose uptake during exercise when fat oxidation is impaired by beta-adrenergic blockade.

Christopher J. Davidson, E. Coyle, T. Zderic, 2004, American journal of physiology. Endocrinology and metabolism.

A new antidiabetic compound attenuates inflammation and insulin resistance in Zucker diabetic fatty rats.

S. Watkins, J. Olefsky, S. Schenk, 2010, American journal of physiology. Endocrinology and metabolism.

Effects of dietary carbohydrate restriction with high protein intake on protein metabolism and the somatotropic axis.

J. Horowitz, A. Barkan, S. Schenk, 2005, The Journal of clinical endocrinology and metabolism.

Different glycemic indexes of breakfast cereals are not due to glucose entry into blood but to glucose removal by tissue.

Christopher J. Davidson, E. Coyle, T. Zderic, 2003, The American journal of clinical nutrition.

Critical Role of Type III Interferon in Controlling SARS-CoV-2 Infection in Human Intestinal Epithelial Cells

Michael E. Miller, Lindsay C. Page, Kevin S. Smith, 2020, Cell Reports.

Novel liver-specific TORC2 siRNA corrects hyperglycemia in rodent models of type 2 diabetes.

B. Polisky, J. Olefsky, T. Imamura, 2009, American journal of physiology. Endocrinology and metabolism.

Knock-Down of IL-1Ra in Obese Mice Decreases Liver Inflammation and Improves Insulin Sensitivity

S. Schenk, M. Maris, Saswata Talukdar, 2014, PloS one.

Calorie Restriction-Induced Increase in Skeletal Muscle Insulin Sensitivity Is Not Prevented by Overexpression of the p55α Subunit of Phosphoinositide 3-Kinase

W. S. Chick, S. Schenk, C. McCurdy, 2018, Front. Physiol..

Acute glucoregulatory and vascular outcomes of three strategies for interrupting prolonged sitting time in postmenopausal women: A pilot, laboratory-based, randomized, controlled, 4-condition, 4-period crossover trial

Dorothy D. Sears, A. LaCroix, Lindsay W Dillon, 2017, PloS one.

Paraspinal Muscle Health is Related to Fibrogenic, Adipogenic, and Myogenic Gene Expression in Patients with Lumbar Spine Pathology

R. T. Allen, M. Farshad, S. Garfin, 2022, BMC Musculoskeletal Disorders.

Interaction between lipid availability,endurance exercise and insulin sensitivity.

S. Schenk, S. Newsom, 2014, Medicine and sport science.

SIRT1 regulates nuclear number and domain size in skeletal muscle fibers

S. Schenk, A. Philp, J. Ochala, 2018, Journal of cellular physiology.

Cancer-cell-secreted miR-122 suppresses O-GlcNAcylation to promote skeletal muscle proteolysis

J. Esko, D. Pizzo, Wei Yan, 2022, Nature cell biology.

Hematopoietic cell-specific deletion of toll-like receptor 4 ameliorates hepatic and adipose tissue insulin resistance in high-fat-fed mice.

I. Verma, J. Olefsky, M. Saberi, 2009, Cell metabolism.

Attenuated Pik 3 r 1 Expression Prevents Insulin Resistance and Adipose Tissue Macrophage Accumulation in Diet-Induced Obese Mice

M. Holliday, J. Friedman, P. MacLean, 2012 .

Defining the contribution of skeletal muscle pyruvate dehydrogenase α1 to exercise performance and insulin action.

S. Schenk, J. Ochala, Jessica R. Dent, 2018, American journal of physiology. Endocrinology and metabolism.

Germline or inducible knockout of p300 or CBP in skeletal muscle does not alter insulin sensitivity.

S. Schenk, Elisa H. Buckner, S. Labarge, 2019, American journal of physiology. Endocrinology and metabolism.

Application of the [ (cid:2) - 32 P] ATP kinase assay to study anabolic signaling in human skeletal muscle

B. Drust, C. Treins, I. Campbell, 2014 .

on gluconeogenesis and lipolysis in rats Effects of a high-fat diet and voluntary wheel running

Christopher J. Davidson, R. Bergman, T. Zderic, 2015 .

A Novel Pathway of Insulin Sensitivity in Chromogranin A Null Mice

D. O'Connor, S. Najjar, S. Mahata, 2009, The Journal of Biological Chemistry.

Maternal Obesity and Western-Style Diet Impair Fetal and Juvenile Offspring Skeletal Muscle Insulin-Stimulated Glucose Transport in Nonhuman Primates

K. Aagaard, J. Friedman, S. Wesolowski, 2019, Diabetes.

High-fat diet elevates resting intramuscular triglyceride concentration and whole body lipolysis during exercise.

Christopher J. Davidson, E. Coyle, T. Zderic, 2004, American journal of physiology. Endocrinology and metabolism.

Muscle-specific knockout of general control of amino acid synthesis 5 (GCN5) does not enhance basal or endurance exercise-induced mitochondrial adaptation

Mary C. Esparza, S. Schenk, A. Philp, 2017, Molecular metabolism.

p300 is not required for metabolic adaptation to endurance exercise training

S. Schenk, A. Philp, B. Barshop, 2016, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Role of the cytoskeleton in muscle transcriptional responses to altered use.

R. Lieber, S. Schenk, G. Meyer, 2013, Physiological genomics.

Increasing Muscle Hypertrophy with a Natural Product Designed to Inhibit SIRT1

K. Baar, S. Schenk, M. Wallace, 2022, bioRxiv.

Acute inhibition of protein deacetylases does not impact skeletal muscle insulin action.

S. Schenk, C. McCurdy, K. Svensson, 2019, American journal of physiology. Cell physiology.

Skeletal muscle mitochondrial function and exercise capacity is not impaired in mice with knockout of STAT3.

S. Schenk, S. Labarge, C. McCurdy, 2019, Journal of applied physiology.

Knockout of STAT3 in skeletal muscle does not prevent high-fat diet-induced insulin resistance

S. Schenk, S. Labarge, C. McCurdy, 2015, Molecular metabolism.

Dried Plum Ingestion Increases the Osteoblastogenic Capacity of Human Serum.

S. Hooshmand, M. Kern, S. Schenk, 2017, Journal of medicinal food.

Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes

Amy V. Lynch, David P. Carney, D. Gagne, 2007, Nature.

Combined overexpression of SIRT1 and knockout of GCN5 in adult skeletal muscle does not affect glucose homeostasis or exercise performance in mice.

S. Schenk, C. McCurdy, Jessica R. Dent, 2019, American journal of physiology. Endocrinology and metabolism.

K. Baar, S. Schenk, A. Philp, 2011 .

Overload-mediated skeletal muscle hypertrophy is not impaired by loss of myofiber STAT3.

Mary C. Esparza, J. Pérez-Schindler, S. Schenk, 2017, American journal of physiology. Cell physiology.

Analgesic Medication Use During Exercise-Based Rehabilitation in Individuals With Low Back Pain: A Call to Action.

S. Schenk, B. Shahidi, Kamshad Raiszadeh, 2021, Physical therapy.

Discovery of imidazo[1,2-b]thiazole derivatives as novel SIRT1 activators.

Amy V. Lynch, David P. Carney, D. Gagne, 2009, Journal of medicinal chemistry.

NAD(+)/NADH and skeletal muscle mitochondrial adaptations to exercise.

S. Schenk, Amanda T. White, 2012, American journal of physiology. Endocrinology and metabolism.

Quantifying the Effects of Aging on Morphological and Cellular Properties of Human Female Pelvic Floor Muscles

K. Christman, D. Kado, S. Schenk, 2021, Annals of Biomedical Engineering.

A Fasting Inducible Switch Modulates Gluconeogenesis Via Activator-Coactivator Exchange

J. Yates, L. Guarente, Danica Chen, 2008, Nature.

The Association of Metabolic Syndrome and Obesity With Clinical Hip Osteoarthritis in the Study of Osteoporotic Fractures and the Osteoporotic Fractures in Men Study Cohorts

M. Nevitt, J. Schousboe, N. Lane, 2023, ACR open rheumatology.

Heterogeneous muscle gene expression patterns in patients with massive rotator cuff tears

S. Ward, A. Engler, K. Fisch, 2018, PloS one.

Insulin sensitivity: modulation by nutrients and inflammation.

J. Olefsky, M. Saberi, S. Schenk, 2008, The Journal of clinical investigation.

The mitochondrial multi-omic response to exercise training across tissues

A. Raja, E. Ashley, M. Wheeler, 2023, bioRxiv.

Sirt1 enhances skeletal muscle insulin sensitivity in mice during caloric restriction.

J. Olefsky, M. Holliday, K. Baar, 2011, The Journal of clinical investigation.

Mechanisms Mediating Obesity-Induced Inflammation and Insulin Resistance

J. Olefsky, S. Schenk, O. Osborn, 2011 .

Specific Sirt1 Activator-mediated Improvement in Glucose Homeostasis Requires Sirt1-Independent Activation of AMPK

H. Ke, F. Ahmad, J. Um, 2017, EBioMedicine.

Cysteine- and glycine-rich protein 3 regulates glucose homeostasis in skeletal muscle.

S. Schenk, S. Labarge, O. Osborn, 2018, American journal of physiology. Endocrinology and metabolism.

Rapamycin does not prevent increases in myofibrillar or mitochondrial protein synthesis following endurance exercise

Stuart M Phillips, K. Baar, J. Pérez-Schindler, 2015, The Journal of physiology.

Cancer-cell-secreted miR-122 suppresses O-GlcNAcylation to promote skeletal muscle proteolysis

J. Esko, D. Pizzo, Wei Yan, 2022, Nature Cell Biology.

Sexual dimorphism and the multi-omic response to exercise training in rat subcutaneous white adipose tissue

M. Lindholm, E. Ortlund, Nicole R. Gay, 2023, bioRxiv.

Understanding the acetylome: translating targeted proteomics into meaningful physiology

J. Pérez-Schindler, S. Schenk, A. Philp, 2014, American journal of physiology. Cell physiology.

Histological Evidence of Muscle Degeneration in Advanced Human Rotator Cuff Disease

S. Ward, A. Engler, S. Schenk, 2017, The Journal of bone and joint surgery. American volume.

Histological quantification of chronic human rotator cuff muscle degeneration

S. Ward, S. Schenk, M. Gibbons, 2016 .

New opportunities and novel paradigms to support neuromuscular research.

R. Lieber, S. Ward, S. Schenk, 2012, Physical medicine and rehabilitation clinics of North America.

One-time injection of AAV8 encoding urocortin 2 provides long-term resolution of insulin resistance.

T. Ciaraldi, A. Miyanohara, M. Gao, 2016, JCI insight.

Muscle architectural changes after massive human rotator cuff tear

S. Ward, A. Engler, S. Schenk, 2016, Journal of orthopaedic research : official publication of the Orthopaedic Research Society.

Improved insulin sensitivity after weight loss and exercise training is mediated by a reduction in plasma fatty acid mobilization, not enhanced oxidative capacity

J. Horowitz, S. Schenk, C. Burant, 2009, The Journal of physiology.

mTOR regulates peripheral nerve response to tensile strain.

Sameer B. Shah, S. Bremner, R. Lovering, 2017, Journal of neurophysiology.

SIRT1 Exerts Anti-Inflammatory Effects and Improves Insulin Sensitivity in Adipocytes

J. Olefsky, T. Imamura, S. Schenk, 2008, Molecular and Cellular Biology.

Coimmunoprecipitation of FAT/CD36 and CPT I in skeletal muscle increases proportionally with fat oxidation after endurance exercise training.

J. Horowitz, S. Schenk, 2006, American journal of physiology. Endocrinology and metabolism.

oxidation after endurance exercise training skeletal muscle increases proportionally with fat Coimmunoprecipitation of FAT/CD36 and CPT I in

J. Horowitz, S. Schenk, 2006 .

Maternal obesity reduces oxidative capacity in fetal skeletal muscle of Japanese macaques.

A. Hevener, K. Aagaard, B. Bergman, 2016, JCI insight.

Relatively low endogenous fatty acid mobilization and uptake helps preserve insulin sensitivity in obese women

J. Horowitz, S. Schenk, S. Newsom, 2014, International Journal of Obesity.

G protein-coupled receptor 21 deletion improves insulin sensitivity in diet-induced obese mice.

Miriam Scadeng, Da Young Oh, T. Bártfai, 2012, The Journal of clinical investigation.

Attenuated Pik3r1 Expression Prevents Insulin Resistance and Adipose Tissue Macrophage Accumulation in Diet-Induced Obese Mice

M. Holliday, J. Friedman, P. MacLean, 2012, Diabetes.

SIRT1 inhibits inflammatory pathways in macrophages and modulates insulin sensitivity.

J. Olefsky, T. Imamura, S. Schenk, 2010, American journal of physiology. Endocrinology and metabolism.

Energy deficit after exercise augments lipid mobilization but does not contribute to the exercise-induced increase in insulin sensitivity.

J. Horowitz, N. Goldenberg, Nicolas D. Knuth, 2010, Journal of applied physiology.

Acute exercise increases triglyceride synthesis in skeletal muscle and prevents fatty acid-induced insulin resistance.

J. Horowitz, S. Schenk, 2007, The Journal of clinical investigation.

Skeletal muscle fiber‐type specific succinate dehydrogenase activity in cerebral palsy

R. Lieber, H. Chambers, S. Schenk, 2017, Muscle & nerve.

Postexercise insulin sensitivity is not impaired after an overnight lipid infusion

Jill N. Cook, J. Horowitz, S. Schenk, 2005 .

p300 and cAMP response element‐binding protein‐binding protein in skeletal muscle homeostasis, contractile function, and survival

S. Ward, S. Mahata, R. Sásik, 2020, Journal of cachexia, sarcopenia and muscle.

Diabetes reversal by inhibition of the low molecular weight tyrosine phosphatase

R. Liddington, N. Bottini, T. Mustelin, 2017, Nature chemical biology.

Temporal overexpression of SIRT1 in skeletal muscle of adult mice does not improve insulin sensitivity or markers of mitochondrial biogenesis

S. Schenk, S. Labarge, K. Svensson, 2017, Acta physiologica.

High-fat diet-induced impairment of skeletal muscle insulin sensitivity is not prevented by SIRT1 overexpression.

Heidi N. Fridolfsson, H. Patel, A. Murphy, 2014, American journal of physiology. Endocrinology and metabolism.

High-fat diet-induced impairment of skeletal muscle insulin sensitivity is not prevented by SIRT 1 overexpression

Heidi N. Fridolfsson, H. Patel, A. Murphy, 2014 .

Perm1 enhances mitochondrial biogenesis, oxidative capacity, and fatigue resistance in adult skeletal muscle

A. Russell, S. Ward, S. Schenk, 2016, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Application of the [γ-32P] ATP kinase assay to study anabolic signaling in human skeletal muscle.

B. Drust, C. Treins, I. Campbell, 2014, Journal of applied physiology.

Application of the [-32 P ] ATP kinase assay to study anabolic signaling in human skeletal muscle

B. Drust, C. Treins, I. Campbell, 2014 .

Is Acetylation a Metabolic Rheostat that Regulates Skeletal Muscle Insulin Action?

S. Schenk, C. Migdal, S. Labarge, 2015, Molecules and cells.

Skeletal muscle action of estrogen receptor α is critical for the maintenance of mitochondrial function and metabolic homeostasis in females

A. Hevener, K. Korach, E. Stefani, 2016, Science Translational Medicine.

Sirtuin 1 (SIRT1) Deacetylase Activity Is Not Required for Mitochondrial Biogenesis or Peroxisome Proliferator-activated Receptor-γ Coactivator-1α (PGC-1α) Deacetylation following Endurance Exercise*

Amy E. Knapp, D. Lan, A. Murphy, 2011, The Journal of Biological Chemistry.

K. Baar, S. Schenk, A. Philp, 2011, American journal of physiology. Regulatory, integrative and comparative physiology.

Mitochondrial Function / Dysfunction in Health and Disease The PGC-1-related coactivator promotes mitochondrial and myogenic adaptations in C 2 C 12 myotubes

K. Baar, S. Schenk, A. Philp, 2011 .

Inducible Nitric Oxide Synthase Deficiency in Myeloid Cells Does Not Prevent Diet-Induced Insulin Resistance

J. Olefsky, M. Saberi, S. Schenk, 2010 .

p300 or CBP is required for insulin-stimulated glucose uptake in skeletal muscle and adipocytes

A. Saltiel, R. Henry, T. Ciaraldi, 2021, JCI insight.

Skeletal muscle-specific overexpression of SIRT1 does not enhance whole-body energy expenditure or insulin sensitivity in young mice

S. Schenk, A. Philp, C. McCurdy, 2013, Diabetologia.

Interrupting Sitting Time in Postmenopausal Women: Protocol for the Rise for Health Randomized Controlled Trial

Dorothy D. Sears, Sheri J. Hartman, A. LaCroix, 2021, JMIR research protocols.

expression in rat skeletal muscles Muscle contractile activity regulates Sirt3 protein

Matthew J. Rardin, Alexander S. Banks, C. Kahn, 2015 .

1 ( MHCIIx ) TCTGCAGACGGAGTCAGGT TTGAGTGAATGCCTGTTTGC Myh 2 ( MHCIIa ) GTCAAAGGAGGAGGAACAGCAGC GTTGAGTGAATGCTTGCTTCCCC Myh 4 ( MHCIIb ) TGGCCGAGCAAGAGCTAC TTGATGAGGCTGGTGTTCTG Myh 7 ( MHCI ) GCCAACTATGCTGGAGCTGATGCCC GGTGCGTGGAGCGCAAGTTTGTCATAAG Gapdh TCAACGGGAAGCCCATCA CTCGTGGTTCACACCCATCA PERM 1 D

A. Russell, S. Ward, S. Schenk, 2015 .

Postexercise insulin sensitivity is not impaired after an overnight lipid infusion.

Jill N. Cook, J. Horowitz, S. Schenk, 2004, American journal of physiology. Endocrinology and metabolism.

Human-like Cmah inactivation in mice increases running endurance and decreases muscle fatigability: implications for human evolution

A. Varki, H. Patel, S. Schenk, 2018, Proceedings of the Royal Society B: Biological Sciences.

Metabolic Syndrome Is Associated With Higher Risk of Wound Complications After Total Hip Arthroplasty

S. Schenk, S. Ball, Jan M. Hughes-Austin, 2020, Arthroplasty today.

Skeletal muscle maximal mitochondrial activity in ambulatory children with cerebral palsy

R. Lieber, H. Chambers, S. Schenk, 2021, Developmental medicine and child neurology.

Paraspinal muscle gene expression across different aetiologies in individuals undergoing surgery for lumbar spine pathology

R. T. Allen, M. Farshad, S. Garfin, 2023, European Spine Journal.

Cancer‐cell‐secreted extracellular vesicles target p53 to impair mitochondrial function in muscle

Wei Yan, S. Schenk, Y. Jones, 2023, EMBO reports.

Surgical site peptidylarginine deaminase 4 (PAD4), a biomarker of NETosis, correlates with insulin resistance in total joint arthroplasty patients: A preliminary report

S. Schenk, S. Ball, J. Parekh, 2021, PloS one.

Alterations in carbohydrate metabolism in response to short-term dietary carbohydrate restriction.

J. Horowitz, A. Barkan, S. Schenk, 2005, American journal of physiology. Endocrinology and metabolism.

exercise-induced increase in insulin sensitivity mobilization but does not contribute to the Energy deficit after exercise augments lipid

Eric C. Freese, Nicholas H. Gist, K. Cureton, 2015 .

Discovery of imidazo[1,2-b]thiazole derivatives as novel SIRT1 activators.

Amy V. Lynch, David P. Carney, D. Gagne, 2009, Journal of medicinal chemistry.

Understanding the acetylome: translating targeted proteomics into meaningful physiology

S. Schenk, A. Philp, Thomas Rowland, 2014, American journal of physiology. Cell physiology.

D. Lan, K. Baar, S. Schenk, 2011, The Journal of Biological Chemistry.

Overload-mediated skeletal muscle hypertrophy is not impaired by loss of myofiber STAT3.

Mary C. Esparza, S. Schenk, A. Philp, 2017, American journal of physiology. Cell physiology.

Mutation in the Human Insulin Receptor Gene A Novel Syndrome of Autosomal-Dominant Hyperinsulinemic Hypoglycemia Linked to a

Christopher J. Davidson, O. Pedersen, T. Zderic, 2015 .