H. Okada

发表

Molecular Characterization and Heterologous Expression of the Gene Encoding a Low-Molecular-Mass Endoglucanase from Trichoderma reesei QM9414

H. Tohda, Y. Morikawa, H. Okada, 1998, Applied and Environmental Microbiology.

Control of enzyme synthesis in microorganisms

H. Halvorson, H. Okada, A. Herman, 1963 .

Construction of engineered yeast with the ability of binding to cellulose

M. Ueda, J. Nam, A. Kondo, 2002 .

Crystallization and preliminary X-ray crystallographic studies of dipeptidyl aminopeptidase BII from Pseudoxanthomonas mexicana WO24.

Yoshiyuki Suzuki, T. Nonaka, Y. Morikawa, 2014, Acta crystallographica. Section F, Structural biology communications.

Isoforms of dipeptidyl aminopeptidase IV from Pseudomonas sp. WO24: role of the signal sequence and overexpression in Escherichia coli.

Masashi Suzuki, Y. Morikawa, W. Ogasawara, 2005, Protein expression and purification.

Purification of peroxisomal malate synthase from alkane-grown Candida tropicalis and some properties of the purified enzyme

M. Ueda, A. Tanaka, H. Okada, 1986, Archives of Microbiology.

Efficient secretion of Trichoderma reesei cellobiohydrolase II in Schizosaccharomyces pombe and characterization of its products

H. Tohda, Y. Morikawa, H. Okada, 1998, Applied Microbiology and Biotechnology.

A high performance Trichoderma reesei strain that reveals the importance of xylanase III in cellulosic biomass conversion.

H. Nakazawa, J. Sumitani, T. Kawaguchi, 2016, Enzyme and microbial technology.

A comprehensive analysis of the effects of the main component enzymes of cellulase derived from Trichoderma reesei on biomass saccharification

H. Nakazawa, Y. Morikawa, W. Ogasawara, 2013, Journal of Industrial Microbiology & Biotechnology.

Analysis of the saccharification capability of high-functional cellulase JN11 for various pretreated biomasses through a comparison with commercially available counterparts

H. Nakazawa, J. Sumitani, T. Kawaguchi, 2012, Journal of Industrial Microbiology & Biotechnology.

Identification of active site carboxylic residues in Trichoderma reesei endoglucanase Cel12A by site-directed mutagenesis

K. Mori, Y. Morikawa, H. Okada, 2000 .

Identification of the Catalytic Triad of Family S46 Exopeptidases, Closely Related to Clan PA Endopeptidases

Yoshiyuki Suzuki, Y. Morikawa, W. Ogasawara, 2014, Scientific Reports.

Purification and Characterization of Exo-β-d-Glucosaminidase from a Cellulolytic Fungus,Trichoderma reesei PC-3-7

Y. Morikawa, H. Okada, K. Ohshima, 1998, Applied and Environmental Microbiology.

Construction of a recombinant Trichoderma reesei strain expressing Aspergillus aculeatus β‐glucosidase 1 for efficient biomass conversion

H. Nakazawa, J. Sumitani, T. Kawaguchi, 2012, Biotechnology and bioengineering.

Identification of specific binding sites for XYR1, a transcriptional activator of cellulolytic and xylanolytic genes in Trichoderma reesei.

Tetsuo Kobayashi, Masashi Kato, K. Mori, 2009, Fungal genetics and biology : FG & B.

Distribution and purification of aspartate racemase in lactic acid bacteria.

M. Yohda, H. Okada, H. Kumagai, 1991, Biochimica et biophysica acta.

Xylanase Induction by L-Sorbose in a Fungus, Trichoderma reesei PC-3-7.

Y. Morikawa, H. Okada, J. Xu, 1998, Bioscience, biotechnology, and biochemistry.

Isolation of several cDNAs encoding yeast peroxisomal enzymes

M. Ueda, A. Tanaka, Y. Teranishi, 1987, FEBS Letters.

Calorimetric evaluation of the activity and the mechanism of cellulases for the hydrolysis of cello-oligosaccharides accompanied by the mutarotation reaction of the hydrolyzed products

S. Kidokoro, H. Okada, N. Karim, 2005 .

Properties of aspartate racemase, a pyridoxal 5'-phosphate-independent amino acid racemase.

M. Yohda, K. Soda, S. Choi, 1992, The Journal of biological chemistry.

Crystallization and preliminary X-ray crystallographic studies of an exo-beta-D-glucosaminidase from Trichoderma reesei.

Yoshiyuki Suzuki, T. Nonaka, Masakazu Ike, 2010, Acta crystallographica. Section F, Structural biology and crystallization communications.

Dipeptidyl aminopeptidase IV from Pseudomonas sp. WO24.

Y. Morikawa, W. Ogasawara, H. Okada, 1996, Bioscience, biotechnology, and biochemistry.

Two types of novel dipeptidyl aminopeptidases from Pseudomonas sp. strain WO24

Y. Morikawa, W. Ogasawara, H. Okada, 1996, Journal of bacteriology.

A novel dipeptidyl aminopeptidase from Pseudomonas sp. strain WO24

K. Ochiai, M. Yamasaki, Y. Morikawa, 1996, Journal of bacteriology.

High–Level Expression of Human Lipocortin I in the Fission Yeast Schizosaccharomyces pombe Using a Novel Expression Vector

H. Okayama, H. Tohda, H. Okada, 1994, Bio/Technology.

A copy-number-controlled expression vector for the fission yeast Schizosaccharomyces pombe.

H. Okayama, H. Tohda, H. Okada, 1994, Gene.

Molecular Characterization and Heterologous Expression of the Gene Encoding a Low-Molecular-Mass Endoglucanase from Trichoderma reesei QM 9414

H. Tohda, Y. Morikawa, H. Okada, 1997 .

Application of Trichoderma reesei Cellulase and Xylanase Promoters through Homologous Recombination for Enhanced Production of Extracellular β-Glucosidase I

Y. Morikawa, W. Ogasawara, H. Okada, 2009, Bioscience, biotechnology, and biochemistry.

ACTGAGCATTGGCACACTT TACAAAAGCTACTACG CTGGTACTTGCGGGTGAT CTCAACAAGCTCATCAA TCTTCAACGGAGGATAAACC CCGAATCATGTCAC GACGTTGACTGTTCCCTGT GTAGTGGGCTGGACG ATAGTGTCTCCGGCCTTG AGCATCATCGTCA CGAAATGGTAGCTGTAGCC CTATCCGACTGAGAC GAGGCGCTTGATGAGAC CAACCAGGGCAAC CACGCACTGAGGATAGTTCT CCTTCAACGACTT CGCTAATGGCCTTGTTCT

Tetsuo Kobayashi, Masashi Kato, Y. Morikawa, 2009 .

Identification of the cis-acting elements involved in regulation of xylanase III gene expression in Trichoderma reesei PC-3-7.

Tetsuo Kobayashi, Masashi Kato, Y. Morikawa, 2008, Fungal genetics and biology : FG & B.

Functional analysis of the egl3 upstream region in filamentous fungus Trichoderma reesei

Tetsuo Kobayashi, Masashi Kato, Y. Morikawa, 2008, Applied Microbiology and Biotechnology.

An α-l-Arabinofuranosidase fromTrichoderma reesei Containing a Noncatalytic Xylan-Binding Domain

Y. Morikawa, H. Okada, A. Tomioka, 1999, Applied and Environmental Microbiology.

UPTAKE OF ALPHA-THIOETHYL D-GLUCOPYRANOSIDE BY SACCHAROMYCES CEREVISIAE. II. GENERAL CHARACTERISTICS OF AN ACTIVE TRANSPORT SYSTEM.

H. Halvorson, H. Okada, 1964, Biochimica et biophysica acta.

Relationship between Enoyl-CoA Hydratase and a Peroxisomal Bifunctional Enzyme, Enoyl-CoA Hydratase/3-Hydroxyacyl-CoA Dehydrogenase, from an n-Alkane-utilizing Yeast, Candida tropicalis

M. Ueda, A. Tanaka, H. Okada, 1987 .

Evaluation and characterization of Trichoderma reesei cellulase and xylanase promoters

Y. Morikawa, W. Ogasawara, H. Okada, 2009, Applied Microbiology and Biotechnology.

Cellobiohydrolase I (Cel7A) from Trichoderma reesei has chitosanase activity

Yasushi Morikawa, Takashi Kawaguchi, Hirofumi Okada, 2007 .

UPTAKE OF ALPHA-THIOETHYL D-GLUCOPYRANOSIDE BY SACCHAROMYCES CEREVISIAE. I. THE GENETIC CONTROL OF FACILITATED DIFFUSION AND ACTIVE TRANSPORT.

H. Halvorson, H. Okada, H. Okada, 1964, Biochimica et biophysica acta.

COMPARISON OF THE ACTIVE TRANSPORT SYSTEMS FOR α-THIOETHYL-d-GLUCOPYRANOSIDE AND MALTOSE IN SACCHAROMYCES CEREVISIAE

H. Halvorson, H. Okada, 1963, Journal of bacteriology.

Biosynthesis of cell wall polysaccharide from maltose by a strain of Saccharomyces cerevisiae incapable of maltose fermentation.

S. Tabata, S. Hizukuri, H. Okada, 1973, Biochimica et biophysica acta.

4,6-dimethoxy-1,3,5-triazine oligoxyloglucans: novel one-step preparable substrates for studying action of endo-beta-1,4-glucanase III from Trichoderma reesei.

Kazuhito Watanabe, Y. Morikawa, H. Okada, 2010, Bioorganic & medicinal chemistry letters.

Characterization of the catalytic domains of Trichoderma reesei endoglucanase I, II, and III, expressed in Escherichia coli

H. Nakazawa, Y. Morikawa, W. Ogasawara, 2008, Applied Microbiology and Biotechnology.

Beta-oxidation of butyrate, the short-chain-length fatty acid, occurs in peroxisomes in the yeast Candida tropicalis.

M. Ueda, N. Kamasawa, M. Osumi, 1992, Journal of biochemistry.

Peroxisomal localization of enzymes related to fatty acid β-oxidation in an n-alkane-grown yeast, Candida tropicalis

M. Ueda, A. Tanaka, T. Morikawa, 1985 .

Cloning and heterologous expression of the exo-β-d-glucosaminidase-encoding gene (gls93) from a filamentous fungus, Trichoderma reesei PC-3-7

Yasushi Morikawa, Hirofumi Okada, Masakazu Ike, 2006, Applied Microbiology and Biotechnology.

Molecular cloning and nucleotide sequencing of the aspartate racemase gene from lactic acid bacteria Streptococcus thermophilus.

M. Yohda, H. Okada, H. Kumagai, 1991, Biochimica et biophysica acta.

The essential acidic amino acid residues for catalytic activity of an exo-β-d-glucosaminidase from Trichoderma reesei

Masakazu Ike, Y. Morikawa, W. Ogasawara, 2008 .

Purification, characterization, and gene cloning of 46 kDa chitinase (Chi46) from Trichoderma reeseiPC-3-7 and its expression in Escherichia coli

Masakazu Ike, Y. Morikawa, W. Ogasawara, 2006, Applied Microbiology and Biotechnology.

Purification, characterization, and gene cloning of 46 kDa chitinase (Chi46) from Trichoderma reesei PC-3-7 and its expression in Escherichia coli.

Masakazu Ike, Y. Morikawa, W. Ogasawara, 2006, Applied microbiology and biotechnology.

Utilization of recombinant Trichoderma reesei expressing Aspergillus aculeatus β-glucosidase I (JN11) for a more economical production of ethanol from lignocellulosic biomass.

H. Nakazawa, T. Kawaguchi, Y. Morikawa, 2015, Journal of bioscience and bioengineering.

Catalase gene of the yeast Candida tropicalis. Sequence analysis and comparison with peroxisomal and cytosolic catalases from other sources.

H Atomi, M. Ueda, H. Atomi, 1987, European journal of biochemistry.

Directed evolution of endoglucanase III (Cel12A) from Trichoderma reesei

Yasushi Morikawa, Hikaru Nakazawa, Hirofumi Okada, 2009, Applied Microbiology and Biotechnology.

Construction of whole-cell biocatalyst for xylan degradation through cell-surface xylanase display in Saccharomyces cerevisiae

M. Ueda, A. Kondo, H. Fukuda, 2002 .

l-Sorbose induces cellulase gene transcription in the cellulolytic fungus Trichoderma reesei

Yasushi Morikawa, Hirofumi Okada, M. Goto, 2001, Current Genetics.

Isocitrate Lyase and Malate Synthase of Candida tropicalis Grown on Different Carbon Sources(Microbiology & Fermentation Industry)

M. Ueda, A. Tanaka, H. Okada, 1987 .

Direct and Efficient Production of Ethanol from Cellulosic Material with a Yeast Strain Displaying Cellulolytic Enzymes

M. Ueda, A. Kondo, H. Fukuda, 2002, Applied and Environmental Microbiology.

S46 Peptidases are the First Exopeptidases to be Members of Clan PA

Yoshiyuki Suzuki, T. Nonaka, K. Inaka, 2014, Scientific Reports.

Induction and subcellular localization of enzymes participating in propionate metabolism in Candida tropicalis

M. Ueda, M. Osumi, A. Tanaka, 1983, Archives of Microbiology.

Heterologously expressed Aspergillus aculeatus β-glucosidase in Saccharomyces cerevisiae is a cost-effective alternative to commercial supplementation of β-glucosidase in industrial ethanol production using Trichoderma reesei cellulases.

H. Nakazawa, T. Kawaguchi, Y. Morikawa, 2016, Journal of bioscience and bioengineering.

Isocitrate Lyase and Malate Synthase ofCandida tropicalisGrown on Different Carbon Sources

M. Ueda, A. Tanaka, H. Okada, 1987 .

The gene encoding dipeptidyl aminopeptidase BI from Pseudomonas sp. WO24: cloning, sequencing and expression in Escherichia coli.

Y. Morikawa, W. Ogasawara, H. Okada, 1998, Gene.

Cellulase induction by lactose in Trichoderma reesei PC-3-7

H. Okada, Y. Morikawa, H. Okada, 1995, Applied Microbiology and Biotechnology.

4,6-dimethoxy-1,3,5-triazine oligoxyloglucans: novel one-step preparable substrates for studying action of endo-beta-1,4-glucanase III from Trichoderma reesei.

Kazuhito Watanabe, Y. Morikawa, H. Okada, 2010, Bioorganic & medicinal chemistry letters.