T. Vukosavljevic

发表

MicroRNA expression in cytogenetically normal acute myeloid leukemia.

M. Caligiuri, C. Bloomfield, M. Radmacher, 2008, The New England journal of medicine.

Alterations of β-Catenin Pathway in Non-Melanoma Skin Tumors: Loss of α-ABC Nuclear Reactivity Correlates with the Presence of β-Catenin Gene Mutation

R. Maestro, S. Piccinin, S. Demontis, 2003 .

Phase I Study of GTI-2040, an Antisense to Ribonucleotide Reductase, in Combination with High-Dose Cytarabine in Patients with Acute Myeloid Leukemia

M. Grever, J. Byrd, G. Marcucci, 2008, Clinical Cancer Research.

Targeting AML1/ETO-Histone Deacetylase Repressor Complex: A Novel Mechanism for Valproic Acid-Mediated Gene Expression and Cellular Differentiation in AML1/ETO-Positive Acute Myeloid Leukemia Cells

P. Paschka, G. Marcucci, D. Perrotti, 2007, Journal of Pharmacology and Experimental Therapeutics.

Targeting AML 1 / ETO-Histone Deacetylase Repressor Complex : A Novel Mechanism for Valproic Acid-Mediated Gene Expression and Cellular Differentiation in AML 1 / ETO-Positive Acute Myeloid Leukemia Cells

P. Paschka, G. Marcucci, D. Perrotti, 2007 .

Three discrete regions of deletion at 3p in head and neck cancers.

R. Maestro, M. Boiocchi, L. Barzan, 1993, Cancer research.

Recurrences and second primary tumours in the head and neck region: differentiation by p53 mutation analysis.

R. Maestro, S. Piccinin, C. Doglioni, 1995, Annals of oncology : official journal of the European Society for Medical Oncology.

Alterations of beta-catenin pathway in non-melanoma skin tumors: loss of alpha-ABC nuclear reactivity correlates with the presence of beta-catenin gene mutation.

R. Maestro, S. Piccinin, S. Demontis, 2003, American Journal of Pathology.

Interplay of RUNX 1 / MTG 8 and DNA Methyltransferase 1 in Acute Myeloid Leukemia

J. Byrd, C. Plass, G. Marcucci, 2005 .

Acute Myeloid Leukemia Interplay of RUNX 1 / MTG 8 and DNA Methyltransferase 1 in Updated

J. Byrd, C. Plass, G. Marcucci, 2005 .

Interplay of RUNX1/MTG8 and DNA methyltransferase 1 in acute myeloid leukemia.

J. Byrd, C. Plass, G. Marcucci, 2005, Cancer research.

Spontaneous Mutation of Cell Oncogenes Plays a Minor Role in Neoplastic Transformation of Virus-Induced Murine T-Cell Lymphomas

R. Maestro, S. Piccinin, M. Boiocchi, 1995, Tumori.

p53 protein over‐expression and p53 gene abnormalities in HIV‐1‐related non‐Hodgkin's lymphomas

R. Maestro, A. Carbone, A. Gloghini, 1994, International journal of cancer.

MDM 2 Overexpression Does Not Account for Stabilization of Wild-Type p 53 Protein in Non-Hodgkin ’ s Lymphomas

R. Maestro, C. Doglioni, L. Laurino, 2000 .

MDM2 overexpression does not account for stabilization of wild-type p53 protein in non-Hodgkin's lymphomas.

R. Maestro, C. Doglioni, L. Laurino, 1995, Blood.

Long-term disease-free survivors with cytogenetically normal acute myeloid leukemia and MLL partial tandem duplication: a Cancer and Leukemia Group B study.

M. Caligiuri, C. Bloomfield, P. Paschka, 2007, Blood.

Chromosome 13q deletion mapping in head and neck squamous cell carcinomas: identification of two distinct regions of preferential loss.

R. Maestro, S. Piccinin, C. Doglioni, 1996, Cancer Research.

Chromosome 13q deletion mapping in head and neck squamous cell carcinomas: identification of two distinct regions of preferential loss.

R. Maestro, S. Piccinin, C. Doglioni, 1996, Cancer research.

-refractory adult T-cell leukemia α load following alemtuzumab in AZT/IFN Durable hematological complete response and suppression of HTLV-1 viral

M. Caligiuri, J. Byrd, R. Baiocchi, 2013 .

Leukemia Group B study myeloid leukemia and MLL partial tandem duplication: a Cancer and Long-term disease-free survivors with cytogenetically normal acute

M. Caligiuri, P. Paschka, R. Larson, 2013 .

Overexpression of CDC25A and CDC25B in head and neck cancers.

R. Maestro, S. Piccinin, M. Boiocchi, 1997, Cancer research.

Independent confirmation of a prognostic gene-expression signature in adult acute myeloid leukemia with a normal karyotype: a Cancer and Leukemia Group B study.

Guido Marcucci, M. Caligiuri, C. Bloomfield, 2006, Blood.

The MLL partial tandem duplication: evidence for recessive gain-of-function in acute myeloid leukemia identifies a novel patient subgroup for molecular-targeted therapy.

M. Caligiuri, C. Bloomfield, C. Plass, 2005, Blood.

Molecular aberrations of the G1-S checkpoint in myxoid and round cell liposarcoma.

A. D. Dei Tos, S. Piccinin, C. Doglioni, 1997, American Journal of Pathology.

Prognostic significance of, and gene and microRNA expression signatures associated with, CEBPA mutations in cytogenetically normal acute myeloid leukemia with high-risk molecular features: a Cancer and Leukemia Group B Study.

Christian Langer, Guido Marcucci, M. Caligiuri, 2008, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

High BAALC expression associates with other molecular prognostic markers, poor outcome, and a distinct gene-expression signature in cytogenetically normal patients younger than 60 years with acute myeloid leukemia: a Cancer and Leukemia Group B (CALGB) study.

C. Bloomfield, M. Ross, M. Radmacher, 2008, Blood.

Phase I study of decitabine alone or in combination with valproic acid in acute myeloid leukemia.

M. Grever, J. Byrd, C. Plass, 2007, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Loss of heterozygosity at 10q in tumors of the upper respiratory tract is associated with poor prognosis.

R. Maestro, S. Piccinin, M. Boiocchi, 1999, International journal of cancer.

Microsatellite instability in squamous cell carcinomas of the head and neck related to field cancerization phenomena.

R. Maestro, S. Piccinin, M. Boiocchi, 1998, British Journal of Cancer.

Loss of heterozygosity at 10q in tumors of the upper respiratory tract is associated with poor prognosis

R. Maestro, S. Piccinin, M. Boiocchi, 1999 .

Human non-Hodgkin's lymphomas overexpress a wild-type form of p53 which is a functional transcriptional activator of the cyclin-dependent kinase inhibitor p21.

R. Maestro, S. Piccinin, C. Doglioni, 1997, Blood.

Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-kappaB-dependent DNA methyltransferase activity in acute myeloid leukemia.

M. Caligiuri, J. Byrd, R. Garzon, 2008, Blood.

Adverse prognostic significance of KIT mutations in adult acute myeloid leukemia with inv(16) and t(8;21): a Cancer and Leukemia Group B Study.

C. Bloomfield, R. Kittles, P. Paschka, 2006, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

myeloid leukemia: a Cancer and Leukemia Group B (CALGB) study cytogenetically normal patients younger than 60 years with acute markers, poor outcome, and a distinct gene-expression signature in High BAALC expression associates with other molecular prognostic

M. Ross, M. Radmacher, P. Paschka, 2013 .

AACATCCAAGATGGCTGGAGTT CCCTGAAAATGCAGAGGACTCT AACGTTGGACCTCAAGCCCAT CAGGGTTCCTTCTATAAACATG AACGTTGGACCTCAAGCCCAT CAGGGTTCCTTCTATAAACATG GAAGGGTCACTTGAGTCTAGGAG ATTTGCCACCATGCCTGGCTAG TACCTCCTCACTGTTTCATATTAG CACATAGTATGTCTCGGCTAACAG TAGATCTGAGTTTGGTGCCTGGGCCACGAA GAGTCCATGGCAGCAGTTGGCAACCATGGC ATCTT

D. Gasparotto, T. Vukosavljevic, 2007 .

High expression levels of the ETS-related gene, ERG, predict adverse outcome and improve molecular risk-based classification of cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B Study.

C. Bloomfield, P. Paschka, R. Larson, 2007, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Durable hematologic complete response and suppression of HTLV-1 viral load following alemtuzumab in zidovudine/IFN-{alpha}-refractory adult T-cell leukemia.

M. Caligiuri, J. Byrd, R. Baiocchi, 2005, Blood.

Mutations of KIT tyrosine kinase (TK) gene predict relapse in adult patients (pts) with core binding factor acute myeloid leukemia (CBF AML): A Cancer and Leukemia Group B (CALGB) study.

C. Bloomfield, R. Kittles, P. Paschka, 2006, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Promotes Gene Expression by Disrupting the DNA Binding of the AML1/ETO and HDAC1 Repressor Complex.

G. Marcucci, T. Shen, D. Perrotti, 2004 .

Analysis of the p53 gene in relation to tobacco and alcohol in cancers of the upper aero‐digestive tract

S. Franceschi, R. Talamini, R. Maestro, 1995, International journal of cancer.

Rarity of microsatellite genomic instability in B‐cell non‐Hodgkin's lymphomas in hepatitis C virus‐infected patients

V. Zagonel, A. Carbone, M. Boiocchi, 1997, British journal of haematology.

Outcome prediction in adult core binding factor (CBF) acute myeloid leukemia (AML) with gene expression profiling: A Cancer and Leukemia Group B (CALGB) study

C. Bloomfield, M. Radmacher, P. Paschka, 2007 .