Michelle S. Prew

发表

Engineered CRISPR-Cas9 nucleases with altered PAM specificities

Martin J. Aryee, J. Keith Joung, Benjamin P. Kleinstiver, 2015, Nature.

731. High-Fidelity CRISPR-Cas9 Nucleases with No Detectable Genome-Wide Off-Target Effects

J. Keith Joung, Benjamin P. Kleinstiver, Vikram Pattanayak, 2016 .

High-fidelity CRISPR-Cas9 variants with undetectable genome-wide off-targets

J. Joung, V. Pattanayak, S. Tsai, 2015, Nature.

Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells

Martin J. Aryee, Martin J Aryee, Zachary R McCaw, 2016, Nature Biotechnology.

Cell-based artificial APC resistant to lentiviral transduction for efficient generation of CAR-T cells from various cell sources

Matthew J. Frigault, J. Joung, B. Kleinstiver, 2020, Journal for ImmunoTherapy of Cancer.

Genome-wide specificity profiles of CRISPR-Cas Cpf1 nucleases in human cells

Martin J. Aryee, Moira M. Welch, J. Joung, 2016, bioRxiv.

Allele-Specific CRISPR-Cas9 Genome Editing of the Single-Base P23H Mutation for Rhodopsin-Associated Dominant Retinitis Pigmentosa.

J. Joung, B. Kleinstiver, Michelle S Prew, 2018, The CRISPR journal.

Allele-specific editing of rhodopsin P23H knock-in mice broadens therapeutic potential of CRISPR/Cas for dominant genetic diseases

B. Kleinstiver, Scott H. Greenwald, E. Pierce, 2017, bioRxiv.

The conformational stability of pro-apoptotic BAX is dictated by discrete residues of the protein core

Michelle S Prew, L. Walensky, T. Wales, 2021, Nature Communications.

MCL-1 is a master regulator of cancer dependency on fatty acid oxidation

S. Gygi, J. Opferman, J. Paulo, 2022, Cell reports.

Precision Targeting of BFL-1/A1 and an ATM Co-dependency in Human Cancer.

K. Stegmaier, L. Walensky, G. Bird, 2018, Cell reports.

Structural basis for defective membrane targeting of mutant enzyme in human VLCAD deficiency

H. Seo, Michelle S Prew, C. M. Camara, 2022, Nature Communications.

GGTGTTGGGGAACACAGACCGTCATTCGATTAAAAAGAATCTTATCGGTGCCCTCCTATTCGATAGTGGCGAAACGGCAGAGGCGACTCGCCTGA AACGAACCGCTCGGAGAAGGTATACACGTCGCAAGAACCGAATATGTTACTTACAAGAAATTTTTAGCAATGAGATGGCCAAAGTTGACGATTCTTT CTTTCACCGTTTGGAAGAGTCCTTCCTTGTCGAAGAGGACAAGAAACATGAACGGCACCCCATCTTTGGAAACATAGTAGATGAGGTGGCATATCA TGAAAAGTA

J. Joung, V. Pattanayak, S. Tsai, 2015 .

Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition

J. Joung, S. Tsai, V. Topkar, 2015, Nature Biotechnology.

Targeting a Helix-in-Groove Interaction Between E1 and E2 Blocks Ubiquitin Transfer

L. Walensky, T. Wales, G. Bird, 2020, Nature Chemical Biology.

Structural basis for defective membrane targeting of mutant enzyme in human VLCAD deficiency

H. Seo, C. M. Camara, L. Walensky, 2022, Nature Communications.

High-fidelity CRISPR-Cas9 variants with undetectable genome-wide off-targets you. Your story matters

V. Pattanayak, B. Kleinstiver, Zongli Zheng, 2016 .

Broadening Staphylococcus aureus Cas 9 Targeting Range by Modifying PAM Recognition

J. Joung, S. Tsai, V. Topkar, 2015 .

Targeting MCL-1 triggers DNA damage and an anti-proliferative response independent from apoptosis induction.

S. Gygi, J. Opferman, Marina Godes, 2023, Cell reports.