Q. Ai

发表

TAT improves in vitro transportation of fortilin through midgut and into hemocytes of white shrimp Litopenaeus vannamei

Wei Xu, Wenbing Zhang, K. Mai, 2012, Journal of Ocean University of China.

The optimal feeding frequency of large yellow croaker (Pseudosciaena crocea, Richardson) larvae

Wei Xu, K. Mai, Q. Ai, 2011 .

Response of fatty acids and lipid metabolism enzymes during accumulation, depuration and esterification of diarrhetic shellfish toxins in mussels (Mytilus galloprovincialis).

Aifeng Li, Yuan Fang, Q. Ai, 2020, Ecotoxicology and environmental safety.

Effects of dietary tea polyphenols on growth, biochemical and antioxidant responses, fatty acid composition and expression of lipid metabolism related genes of large yellow croaker (Larimichthys crocea)

Yongnan Li, K. Mai, Yanjiao Zhang, 2018 .

Effects of dietary chenodeoxycholic acid on growth performance, body composition and related gene expression in large yellow croaker (Larimichthys crocea) fed diets with high replacement of fish oil with soybean oil

Songlin Li, K. Mai, Q. Ai, 2017 .

Molecular cloning and genetic ontogeny of some key lipolytic enzymes in large yellow croaker larvae (Larimichthys crocea R.)

K. Mai, Q. Ai, Fengjun Xie, 2017 .

Dietary arginine requirement of juvenile cobia ( Rachycentron canadum)

M. Ren, K. Mai, Q. Ai, 2014 .

Evaluation of iron methionine and iron sulphate as dietary iron sources for juvenile cobia (Rachycentron canadum)

Wenbing Zhang, K. Mai, B. Tan, 2013 .

Dietary manganese requirement for juvenile cobia, Rachycentron canadum L

Wenbing Zhang, K. Mai, Lu Zhang, 2013 .

Effect of dietary carbohydrate level on growth performance, body composition, apparent digestibility coefficient and digestive enzyme activities of juvenile cobia, Rachycentron canadum L

M. Ren, K. Mai, Q. Ai, 2011 .

Dietary ascorbic acid requirement of cobia, Rachycentron canadum Linneaus

Wei Xu, Wenbing Zhang, K. Mai, 2010 .

Dietary selenium requirement for juvenile cobia, Rachycentron canadum L.

Wenbing Zhang, K. Mai, Q. Ai, 2010 .

Dietary methionine requirement of large yellow croaker, Pseudosciaena crocea R

K. Mai, Wei Xu, Q. Ai, 2006 .

Dietary lysine requirement of juvenile Japanese seabass, Lateolabrax japonicus

K. Mai, Q. Ai, Z. Liufu, 2006 .

Effects of five compound attractants in high plant‐based diets on feed intake and growth performance of juvenile turbot ( Scophthalmus maximus L . )

K. Mai, Q. Ai, Dali Jiang, 2019, Aquaculture Research.

Effects of dietary protein to energy ratios on growth and body composition of juvenile Japanese seabass, Lateolabrax japonicus

Wei Xu, Wenbing Zhang, K. Mai, 2004 .

Phytase can reduce theneedfor monocalcium phosphate supplementation in soybean and rapeseed meal-based diets of black sea bream, Acanthopagrus schlegelii (Bleeker, 1854)

Tao Zhang, Q. Ai, Y-B. Lu, 2016 .

Dietary phosphorus requirement of juvenile Japanese seabass, Lateolabrax japonicus

Wei Xu, Wenbing Zhang, K. Mai, 2006 .

Lipid overload impairs hepatic VLDL secretion via oxidative stress-mediated PKCδ-HNF4α-MTP pathway in large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Xueshan Li, 2021, Free radical biology & medicine.

High Fat Activates O-GlcNAcylation and Affects AMPK/ACC Pathway to Regulate Lipid Metabolism

Yongnan Li, K. Mai, Q. Ai, 2021, Nutrients.

Characterization of Cyclooxygenase-2 and its induction pathways in response to high lipid diet-induced inflammation in Larmichthys crocea

Wei Xu, K. Mai, Q. Ai, 2016, Scientific Reports.

Tumour necrosis factor-α inhibits hepatic lipid deposition through GSK-3β/β-catenin signaling in juvenile turbot (Scophthalmus maximus L.).

Wei Xu, K. Mai, Dongwu Liu, 2016, General and comparative endocrinology.

Effects of dietary grape seed oil and linseed oil on growth, muscle fatty acid composition and expression of putative Δ5 fatty acyl desaturase in abalone Haliotis discus hannai Ino

Wei Xu, Wenbing Zhang, K. Mai, 2013 .

Characterization of two Δ5 fatty acyl desaturases in abalone (Haliotis discus hannai Ino)

Wei Xu, Wenbing Zhang, K. Mai, 2013 .

Effects of dissolved oxygen on survival and immune responses of scallop (Chlamys farreri Jones et Preston).

Wei Xu, Wenbing Zhang, K. Mai, 2007, Fish & shellfish immunology.

Effects of dietary carbohydrates sources on lipids compositions in abalone, Haliotis discus hannai Ino

Wenbing Zhang, K. Mai, Wei Xu, 2009 .

Effects of dietary β-glucan on the growth, immune responses and resistance of sea cucumber, Apostichopus japonicus against Vibrio splendidus infection

Wei Xu, Wenbing Zhang, K. Mai, 2011 .

Effects of dietary taurine supplementation to a casein-based diet on growth performance and taurine distribution in two sizes of juvenile turbot (Scophthalmus maximus L.)

Wei Xu, K. Mai, B. Yun, 2012 .

Synergistic effects of dietary cholesterol and taurine on growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed high plant protein diets

Wei Xu, K. Mai, B. Yun, 2012 .

Effects of exogenous enzymes (phytase, non-starch polysaccharide enzyme) in diets on growth, feed utilization, nitrogen and phosphorus excretion of Japanese seabass, Lateolabrax japonicus.

Wei Xu, Wenbing Zhang, K. Mai, 2007, Comparative biochemistry and physiology. Part A, Molecular & integrative physiology.

Stachyose protects intestinal mucosal barrier via promotion of tight junction and Lactobacillus casei-drived inhibition of apoptosis in juvenile turbot, Scophthalmus maximus L.

Wenbing Zhang, K. Mai, Yanjiao Zhang, 2022, Aquaculture.

Alternative protein sources in diets for Japanese flounder Paralichthys olivaceus (Temminck and Schlegel): II. Effects on nutrient digestibility and digestive enzyme activity

Wenbing Zhang, K. Mai, B. Tan, 2009 .

Online fat detection and evaluation in modelling digital physiological fish

B. Macq, Q. Ai, Xueshan Li, 2020, Aquaculture Research.

Adiponectin’s roles in lipid and glucose metabolism modulation in fish: Mechanisms and perspectives

K. Mai, G. Turchini, Q. Ai, 2021 .

Molecular cloning and the involvement of IRE1α-XBP1s signaling pathway in palmitic acid induced - Inflammation in primary hepatocytes from large yellow croaker (Larimichthys crocea).

K. Mai, Yanjiao Zhang, Q. Ai, 2020, Fish & shellfish immunology.

Effects of dietary arginine levels on growth, immune function of physical barriers and serum parameters of spotted seabass (Lateolabrax maculatus) reared at different water temperatures

K. Mai, Yunwang Cheng, Q. Ai, 2021 .

Lipid deposition patterns among different sizes of three commercial fish species

Wei Xu, B. Macq, K. Mai, 2018 .

Optimal amounts of coconut oil in diets improve the growth, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea)

K. Mai, Yongtao Liu, N. Xu, 2020, Marine Life Science & Technology.

Effect of dietary bile acid (BA) on the growth performance, body composition, antioxidant responses and expression of lipid metabolism-related genes of juvenile large yellow croaker (Larimichthys crocea) fed high-lipid diets

K. Mai, Yongtao Liu, N. Xu, 2020 .

Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level

W. Xu, K. Mai, Q. Ai, 2015, PloS one.

Effects of dietary hydroxyproline on growth performance, body composition, hydroxyproline and collagen concentrations in tissues in relation to prolyl 4-hydroxylase α(I) gene expression of juvenile turbot, Scophthalmus maximus L. fed high plant protein diets

Wei Xu, K. Mai, Yanjiao Zhang, 2013 .

Functional characterization and differential nutritional regulation of putative Elovl5 and Elovl4 elongases in large yellow croaker (Larimichthys crocea)

Ó. Monroig, D. Tocher, Songlin Li, 2017, Scientific Reports.

Regulation of Δ6Fads2 Gene Involved in LC-PUFA Biosynthesis Subjected to Fatty Acid in Large Yellow Croaker (Larimichthys crocea) and Rainbow Trout (Oncorhynchus mykiss)

Yongnan Li, K. Mai, Q. Ai, 2022, Biomolecules.

Tumor necrosis factor alpha is a potent regulator in fish adipose tissue

K. Mai, Dongwu Liu, Q. Ai, 2015 .

High‐fat diet‐induced inflammation aggravates hepatic steatosis of blunt snout bream ( Megalobrama amblycephala ) through the transcription regulation of fatty acid synthesis and oxidation

Wen‐bin Liu, Xiu‐fei Cao, G. Jiang, 2020 .

Molecular cloning, tissue distribution and nutritional regulation of a Δ6-fatty acyl desaturase-like enzyme in large yellow croaker (Larimichthys crocea)

K. Mai, Wei Xu, Q. Ai, 2016 .

Molecular cloning, tissue distribution and nutritional regulation of a fatty acyl elovl5-like elongase in large yellow croaker, Larimichthys crocea

K. Mai, W. Xu, Q. Ai, 2016 .

Sodium butyrate supplementation in high‐soybean meal diets for turbot (Scophthalmus maximus L.): Effects on inflammatory status, mucosal barriers and microbiota in the intestine

Wenbing Zhang, K. Mai, Yongan Zhang, 2019, Fish & shellfish immunology.

LPS stimulation stabilizes HIF‐1α by enhancing HIF‐1α acetylation via the PARP1‐SIRT1 and ACLY‐Tip60 pathways in macrophages

K. Mai, Yongtao Liu, Q. Ai, 2022, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Dietary chromium polynicotinate enhanced growth performance, feed utilization, and resistance to Cryptocaryon irritans in juvenile large yellow croaker (Larmichthys crocea)

K. Mai, Q. Ai, Jun Wang, 2014 .

Dietary methionine level influences growth and lipid metabolism via GCN2 pathway in cobia (Rachycentron canadum)

Wei Xu, K. Mai, Yanjiao Zhang, 2016 .

Suppressor of cytokine signaling 3 (SOCS3) is related to pro‐inflammatory cytokine production and triglyceride deposition in turbot (Scophthalmus maximus)

B. Macq, Huarong Guo, K. Mai, 2017, Fish & shellfish immunology.

The effect of dietary cecropin AD on intestinal health, immune response and disease resistance of juvenile turbot (Scophthalmus maximus L.).

Wenbing Zhang, K. Mai, J. Niu, 2020, Fish & shellfish immunology.

Citric acid mitigates soybean meal induced inflammatory response and tight junction disruption by altering TLR signal transduction in the intestine of turbot, Scophthalmus maximus L.

Wenbing Zhang, K. Mai, J. Niu, 2019, Fish & shellfish immunology.

Effects of dietary copper on survival, growth and immune response of juvenile abalone, Haliotis discus hannai Ino

Wenbing Zhang, K. Mai, Q. Ai, 2009 .

Regulation of adiponectin on lipid metabolism in large yellow croaker (Larimichthys crocea).

Yongnan Li, K. Mai, Q. Ai, 2020, Biochimica et biophysica acta. Molecular and cell biology of lipids.

Effects of fishmeal substitution by four fermented soybean meals on growth， antioxidant capacity and immune responses of turbot juveniles (Scophthalmus maximus L.)

K. Mai, Q. Ai, Jichang Zheng, 2022, Aquaculture.

INTERACTION BETWEEN VITAMINS A AND D ON GROWTH AND METABOLIC RESPONSES OF ABALONE HALIOTIS DISCUS HANNAI, INO

Wei Xu, Wenbing Zhang, K. Mai, 2007 .

Fatty acid translocase (FAT/CD36) in large yellow croaker (Larimichthys crocea): Molecular cloning, characterization and the response to dietary fatty acids

K. Mai, Yongtao Liu, Q. Ai, 2020 .

Dietary administration of soybean isoflavones enhances the immunity of white shrimp Litopenaeus vannamei and its resistance against Vibrio alginolyticus

Wei Xu, Wenbing Zhang, K. Mai, 2011 .

Octanoate Alleviates Dietary Soybean Oil-Induced Intestinal Physical Barrier Damage, Oxidative Stress, Inflammatory Response and Microbial Dysbiosis in Large Yellow Croaker (Larimichthys Crocea)

K. Mai, S. Chi, B. Tan, 2022, Frontiers in Immunology.

Long-chain fatty acids regulate SIRT3 expression by affecting intracellular NAD+ levels in large yellow croaker (Larimichthys crocea)

K. Mai, Q. Ai, Kun Cui, 2022, Aquaculture.

Regulation of Free Fatty Acid Receptor 4 on Inflammatory Gene Induced by LPS in Large Yellow Croaker (Larimichthys crocea)

K. Mai, Q. Ai, Mengjiao Wu, 2021, Frontiers in Immunology.

Vitamin D impacts on the intestinal health, immune status and metabolism in turbot (Scophthalmus maximus L.)

K. Mai, Jiayu Liu, Q. Ai, 2022, British Journal of Nutrition.

The effects of different lipid sources on the growth, intestinal health, and lipid metabolism of the pacific white shrimp (Litopenaeus vannamei)

K. Mai, B. Tan, Q. Ai, 2021, Aquaculture.

Dietary citric acid supplementation alleviates soybean meal-induced intestinal oxidative damage and micro-ecological imbalance in juvenile turbot, Scophthalmus maximus L

Wenbing Zhang, K. Mai, Yongan Zhang, 2018, Aquaculture Research.

Effects of dietary corn gluten meal on growth, digestion and protein metabolism in relation to IGF-I gene expression of Japanese seabass, Lateolabrax japonicus

Wei Xu, K. Mai, Yanjiao Zhang, 2014 .

LPS Stimulation Induces Small Heterodimer Partner Expression Through the AMPK-NRF2 Pathway in Large Yellow Croaker (Larimichthys crocea)

Wei Xu, K. Mai, Q. Ai, 2021, Frontiers in Immunology.

Effects of dietary beta-1, 3 glucan on innate immune response of large yellow croaker, Pseudosciaena crocea.

Wei Xu, Wenbing Zhang, K. Mai, 2007, Fish & shellfish immunology.

Vitamin D regulates insulin pathway and glucose metabolism in zebrafish (Danio rerio)

K. Mai, Q. Ai, Hui Zhang, 2022, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Molecular Characterization, Nutritional and Insulin Regulation of Elovl6 in Rainbow Trout (Oncorhynchus mykiss)

Yongnan Li, K. Mai, Q. Ai, 2020, Biomolecules.

Rearing in intermediate salinity enhances immunity and disease-resistance of turbot (Scophthalmus maximus L.)

Wei Xu, Wenbing Zhang, K. Mai, 2011 .

Dietary lipid concentration affects liver mitochondrial DNA copy number, gene expression and DNA methylation in large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Jing Yan, 2016, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

CTCCACTGCT TATGGCGGCTGAGGAAG TCAAACTGTGG GTGCCAACCTGGATGAGC TATGGCAACGA GGTCACTGGCATTGGTCAC GATCCACGAAGCC TGGTCTTTCCAGTGAGTATGAGCC GTTATGCCCTGCC TGAAGGAGTAACCGCGCTCTGT GGACGCACACTG GCAGACGGGCATAGCACTTG AGCCTAACAT TACCTCCAGACAGCACGG CCATAGCCCACA GTGGCTGGCACGAGTTTGA AGCCTTCATT GCGATGAATAGGGAAAGCA GGTG

K. Mai, Q. Ai, Jing Yan, 2015 .

Endoplasmic Reticulum Stress Disturbs Lipid Homeostasis and Augments Inflammation in the Intestine and Isolated Intestinal Cells of Large Yellow Croaker (Larimichthys crocea)

K. Mai, Yongtao Liu, Q. Ai, 2021, Frontiers in Immunology.

Effects of dietary soy isoflavones on feed intake, growth performance and digestibility in juvenile Japanese flounder (Paralichthys olivaceus)

Wei Xu, Wenbing Zhang, K. Mai, 2012, Journal of Ocean University of China.

Effects of dietary lipid level on growth, fatty acid composition, digestive enzymes and expression of some lipid metabolism related genes of orange‐spotted grouper larvae (Epinephelus coioides H.)

Songlin Li, K. Mai, W. Xu, 2016 .

Molecular cloning and characterization of farnesoid X receptor from large yellow croaker (Larimichthys crocea) and the effect of dietary CDCA on the expression of inflammatory genes in intestine and spleen.

Yongnan Li, K. Mai, Q. Ai, 2018, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Effects of dietary glutamine on survival, growth performance, activities of digestive enzyme, antioxidant status and hypoxia stress resistance of half-smooth tongue sole (Cynoglossus semilaevis Günther) post larvae

Wei Xu, K. Mai, Yanjiao Zhang, 2015 .

Activation of the Farnesoid X Receptor (FXR) Suppresses Linoleic Acid-Induced Inflammation in the Large Yellow Croaker (Larimichthys crocea).

Yongnan Li, K. Mai, W. Xu, 2020, The Journal of nutrition.

Molecular Cloning, Functional Characterization and Nutritional Regulation of the Putative Elongase Elovl5 in the Orange-Spotted Grouper (Epinephelus coioides)

Wei Xu, Songlin Li, K. Mai, 2016, PloS one.

Effects of Supplementation of Ferulic Acid (FA) on Growth Performance, Activities of Digestive Enzymes, Antioxidant Capacity and Lipid Metabolism of Large Yellow Croaker (Larimichthys crocea) Larvae

K. Mai, Yongtao Liu, Q. Ai, 2022 .

Docosahexaenoic Acid Alleviates Palmitic Acid-Induced Inflammation of Macrophages via TLR22-MAPK-PPARγ/Nrf2 Pathway in Large Yellow Croaker (Larimichthys crocea)

K. Mai, Q. Ai, Si Zhu, 2022, Antioxidants.

Effect of soybean meal replacement by cottonseed meal on growth, feed utilization and some blood physiological/biochemical indices of juvenile black carp, Mylopharyngodon piceus

H. Wen, Q. Ai, Yi Hu, 2015 .

Oleic and palmitic acids induce hepatic angiopoietin-like 4 expression predominantly via PPAR-γ in Larimichthys crocea

K. Mai, Q. Ai, Renlei Ji, 2021, British Journal of Nutrition.

Molecular cloning and functional characterization of arachidonate 5-lipoxygenase (Alox5), and its expression in response to the ratio of linolenic acid to linoleic acid in diets of large yellow croaker (Larmichthys crocea).

Wei Xu, K. Mai, Q. Ai, 2016, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Lysophosphatidylcholine acyltransferase 3 (LPCAT3) mediates palmitate-induced inflammation in macrophages of large yellow croaker (Larimichthys crocea).

K. Mai, Yongtao Liu, Q. Ai, 2022, Fish & shellfish immunology.

Effects of dietary size-fractionated fish hydrolysates on growth, activities of digestive enzymes and aminotransferases and expression of some protein metabolism related genes in large yellow croaker (Larimichthys crocea) larvae

K. Mai, W. Xu, Yanjiao Zhang, 2015 .

Effects of dietary amino acid patterns on growth and protein metabolism of large yellow croaker (Larimichthys crocea) larvae

Wei Xu, K. Mai, Yanjiao Zhang, 2013 .

Effects of dietary corn gluten meal on growth performance and protein metabolism in relation to IGF-I and TOR gene expression of juvenile cobia (Rachycentron canadum)

Wei Xu, Wenbing Zhang, K. Mai, 2013, Journal of Ocean University of China.

Effects of dietary rapeseed meal on growth performance, digestion and protein metabolism in relation to gene expression of juvenile cobia (Rachycentron canadum)

Wei Xu, Wenbing Zhang, K. Mai, 2012 .

Comparation of oxylipin profiles as well as their substrates and synthetic enzymes transcriptional expression between marine fish Larimichthys crocea and freshwater fish Oncorhynchus mykiss

Yongnan Li, K. Mai, Q. Ai, 2021 .

Effects of dietary phospholipid on lipase activity, antioxidant capacity and lipid metabolism-related gene expression in large yellow croaker larvae (Larimichthys crocea).

K. Mai, Q. Ai, Xiaojun Xiang, 2016, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Establishment and characterization of two head kidney macrophage cell lines from large yellow croaker (Larimichthys crocea).

K. Mai, W. Xu, Q. Ai, 2020, Developmental and comparative immunology.

Growth performance, lipid deposition and hepatic lipid metabolism related gene expression in juvenile turbot (Scophthalmus maximus L.) fed diets with various fish oil substitution levels by soybean oil

Wei Xu, K. Mai, Yanjiao Zhang, 2014 .

Dietary Allicin Improved the Survival and Growth of Large Yellow Croaker (Larimichthys crocea) Larvae via Promoting Intestinal Development, Alleviating Inflammation and Enhancing Appetite

K. Mai, Yongtao Liu, N. Xu, 2020, Frontiers in Physiology.

The protective role of glutamine on enteropathy induced by high dose of soybean meal in turbot, Scophthalmus maximus L.

Wenbing Zhang, K. Mai, Yongan Zhang, 2018, Aquaculture.

Effects of dietary soybean protein levels on metabolic response of the southern catfish, Silurus meridionalis.

Q. Ai, Xiaojun Xie, 2006, Comparative biochemistry and physiology. Part A, Molecular & integrative physiology.

Characterization of Caspase8 and its role in the regulation of apoptosis-related genes in large yellow croaker (Larimichthys crocea)

K. Mai, Q. Ai, Bo Yang, 2021 .

High percentage of dietary palm oil suppressed growth and antioxidant capacity and induced the inflammation by activation of TLR‐NF‐&kgr;B signaling pathway in large yellow croaker (Larimichthys crocea)

K. Mai, Yanjiao Zhang, Q. Ai, 2019, Fish & shellfish immunology.

Replacement of Dietary Fishmeal Protein with Degossypolized Cottonseed Protein on Growth Performance, Nonspecific Immune Response, Antioxidant Capacity, and Target of Rapamycin Pathway of Juvenile Large Yellow Croaker (Larimichthys crocea)

K. Mai, Q. Ai, Jichang Zheng, 2022, Aquaculture nutrition.

Effects of Dietary Lipid Levels on Growth, Digestive Enzyme Activities, Antioxidant Capacity, and Lipid Metabolism in Turbot (Scophthalmus maximus L.) at Three Different Stages

K. Mai, Yongtao Liu, Q. Ai, 2022, Aquaculture Nutrition.

The effect of dietary arachidonic acid (ARA) on growth performance, fatty acid composition and expression of ARA metabolism-related genes in larval half-smooth tongue sole (Cynoglossus semilaevis).

Songlin Li, K. Mai, W. Xu, 2015, The British journal of nutrition.

Role of acyl-coenzyme A oxidase 1 (ACOX1) on palmitate-induced inflammation and ROS production of macrophages in large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, R. Zhan, 2022, Developmental and comparative immunology.

Dietary selenium requirement and its toxicity in juvenile abalone Haliotis discus hannai Ino

Wenbing Zhang, K. Mai, Wei Xu, 2012 .

Calcium pyruvate attenuates fat deposition by augmenting fatty acid oxidation and inhibiting glucose oxidation in juvenile large yellow croaker (Larimichthys crocea) consuming a high-fat diet

K. Mai, Q. Ai, Xueshan Li, 2022, Aquaculture.

A comparative study: In vitro effects of EPA and DHA on immune functions of head-kidney macrophages isolated from large yellow croaker (Larmichthys crocea).

Wei Xu, K. Mai, Q. Ai, 2013, Fish & shellfish immunology.

In vitro effects of arachidonic acid on immune functions of head kidney macrophages isolated from large yellow croaker (Larmichthys crocea)

K. Mai, W. Xu, Q. Ai, 2012 .

Fucoidan Improves Growth, Digestive Tract Maturation, and Gut Microbiota in Large Yellow Croaker (Larimichthys crocea) Larvae

K. Mai, Yongtao Liu, Q. Ai, 2022, Nutrients.

Dietary leucine requirement of juvenile Japanese seabass (Lateolabrax japonicus)

K. Mai, Q. Ai, Yan Li, 2015, Journal of Ocean University of China.

Effects of dietary soybean saponins on feed intake, growth performance, digestibility and intestinal structure in juvenile Japanese flounder (Paralichthys olivaceus)

Wei Xu, Wenbing Zhang, K. Mai, 2011 .

Arginine metabolism and its functions in growth, nutrient utilization, and immunonutrition of fish

Q. Ai, Zhen Xu, Qingchao Wang, 2021, Animal nutrition.

Effects of dietary eucommia ulmoides leaf extract on growth performance, expression of feeding-related genes, activities of digestive enzymes, antioxidant capacity, immunity and cytokines expression of large yellow croaker (Larimichthys crocea) larvae

K. Mai, Yongtao Liu, N. Xu, 2021, British Journal of Nutrition.

Effects of dietary tea polyphenols on growth, immunity and lipid metabolism of juvenile black carp Mylopharyngodon piceus

Y. Hu, Yanan Tian, Jingshu Chen, 2020 .

Effects of fish meal replaced by methanotroph bacteria meal (Methylococcus capsulatus) on growth, body composition, antioxidant capacity, amino acids transporters and protein metabolism of turbot juveniles (Scophthalmus maximus L.)

K. Mai, Q. Ai, Si Zhu, 2022, Aquaculture.

Replacement of dietary fish meal with Clostridium autoethanogenum meal on growth performance, intestinal amino acids transporters, protein metabolism and hepatic lipid metabolism of juvenile turbot (Scophthalmus maximus L.)

K. Mai, Yongtao Liu, Q. Ai, 2022, Frontiers in Physiology.

Vitamin D3 deficiency induced intestinal inflammatory response of turbot through nuclear factor-κB/inflammasome pathway, accompanied by the mutually exclusive apoptosis and autophagy

M. Esteban, Wenbing Zhang, K. Mai, 2022, Frontiers in Immunology.

Effects of dietary phospholipids on growth performance and expression of key genes involved in phosphatidylcholine metabolism in larval and juvenile large yellow croaker, Larimichthys crocea

K. Mai, Q. Ai, Zuonan Cai, 2017 .

Wnt/β-catenin signaling participates in the regulation of lipogenesis in the liver of juvenile turbot (Scophthalmus maximus L.).

Wei Xu, K. Mai, Dongwu Liu, 2016, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

GSK-3β participates in the regulation of hepatic lipid deposition in large yellow croaker (Larmichthys crocea)

Wei Xu, K. Mai, Dongwu Liu, 2016, Fish Physiology and Biochemistry.

Endoplasmic reticulum stress induces hepatic steatosis by transcriptional upregulating lipid droplet protein perilipin2

K. Mai, Q. Ai, Xiaojun Xiang, 2021, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Effects of dietary arachidonic acid on growth performance, survival, immune response and tissue fatty acid composition of juvenile Japanese seabass, Lateolabrax japonicus

Wei Xu, Wenbing Zhang, K. Mai, 2010 .

Long noncoding RNA LTCONS_00091578 associated with adipose triglyceride lipase (ATGL) regulates hepatic lipolysis in rainbow trout

K. Mai, Q. Ai, Wei Fang, 2022, Aquaculture.

Long noncoding RNA lincsc5d regulates hepatic cholesterol synthesis by modulating sterol C5 desaturase in large yellow croaker.

K. Mai, Q. Ai, Jichang Zheng, 2022, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Influence of a Dietary Vegetable Oil Blend on Serum Lipid Profiles in Large Yellow Croaker ( Larimichthys crocea).

K. Mai, Q. Ai, Renlei Ji, 2018, Journal of agricultural and food chemistry.

Effects of dietary organic trace mineral mixture levels on survival, growth performance, body composition and antioxidant capacity of juvenile turbot ( Scophthalmus maximus )

K. Mai, Yongtao Liu, Wei Xu, 2020 .

Effects of dietary Astragalus polysaccharides (APS) on survival, growth performance, activities of digestive enzyme, antioxidant responses and intestinal development of large yellow croaker (Larimichthys crocea) larvae

K. Mai, Yongtao Liu, N. Xu, 2020 .

Effects of dietary glycyrrhizin on growth and nonspecific immunity of white shrimp, Litopenaeus vannamei.

Wei Xu, Wenbing Zhang, K. Mai, 2010 .

EFFECTS OF DIETARY GLYCYRRHIZIN ON GROWTH, IMMUNITY OF SEA CUCUMBER AND ITS RESISTANCE AGAINST VIBRIO SPLENDIDUS : EFFECTS OF DIETARY GLYCYRRHIZIN ON GROWTH, IMMUNITY OF SEA CUCUMBER AND ITS RESISTANCE AGAINST VIBRIO SPLENDIDUS

Wenbing Zhang, K. Mai, B. Tan, 2010 .

The Antimicrobial Peptide Cecropin AD Supplement Alleviated Soybean Meal-Induced Intestinal Inflammation, Barrier Damage, and Microbial Dysbiosis in Juvenile Turbot, Scophthalmus maximus

Wenbing Zhang, K. Mai, J. Dai, 2020, Frontiers in Marine Science.

Palmitic acid induces intestinal lipid metabolism disorder, endoplasmic reticulum stress and inflammation by affecting phosphatidylethanolamine content in large yellow croaker Larimichthys crocea

K. Mai, Yongtao Liu, Q. Ai, 2022, Frontiers in Immunology.

Effects of supplemental glycerol monolaurate on growth, hepatic lipid metabolism, antioxidant capacity and mitochondrial function of large yellow croaker (Larimichthys crocea) fed diets with high soybean oil level

N. Xu, K. Mai, Q. Ai, 2022, Aquaculture.

Effects of fishmeal substitution by α-galactosidase hydrolytic soybean meal (EhSBM) on growth, antioxidant capacity, inflammatory responses and intestinal health of turbot juveniles (Scophthalmus maximus L.)

K. Mai, Q. Ai, Jichang Zheng, 2022, Aquaculture.

Effects of supplemental ferulic acid (FA) on survival, growth performance, digestive enzyme activities, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea) larvae

K. Mai, Yongtao Liu, Q. Ai, 2022, Fish Physiology and Biochemistry.

Effects of fecal bacteria on growth, digestive capacity, antioxidant capacity, intestinal health of large yellow croaker (Larimichthys crocea) larvae

K. Mai, Yongtao Liu, Yuntao Wang, 2022, Aquaculture.

Effects of dietary supplementation of astaxanthin (Ast) on growth performance, activities of digestive enzymes, antioxidant capacity and lipid metabolism of large yellow croaker ( Larimichthys crocea ) larvae

K. Mai, Yongtao Liu, Q. Ai, 2022, Aquaculture Research.

Effects of dietary tributyrin on growth performance, body composition, serum biochemical indexes and lipid metabolism‐related genes expression of juvenile large yellow croaker ( Larimichthys crocea ) fed with high level soybean oil diets

K. Mai, Yongtao Liu, N. Xu, 2020, Aquaculture Nutrition.

Effects of supplemental phytosterol on growth performance, body composition, serum biochemical indexes and lipid metabolism of juvenile large yellow croaker (Larimichthys crocea) fed with high lipid diet

K. Mai, Yongtao Liu, N. Xu, 2022, Aquaculture.

Regulation of Tissue LC-PUFA Contents, Δ6 Fatty Acyl Desaturase (FADS2) Gene Expression and the Methylation of the Putative FADS2 Gene Promoter by Different Dietary Fatty Acid Profiles in Japanese Seabass (Lateolabrax japonicus)

Wei Xu, K. Mai, Yanjiao Zhang, 2014, PloS one.

Dietary administration of Bacillus (B. licheniformis and B. subtilis) and isomaltooligosaccharide influences the intestinal microflora, immunological parameters and resistance against Vibrio alginolyticus in shrimp, Penaeus japonicus (Decapoda: Penaeidae)

Wenbing Zhang, K. Mai, B. Tan, 2011 .

Effects of dietary ethoxyquin on growth performance and body composition of large yellow croaker Pseudosciaena crocea

Wei Xu, Wenbing Zhang, K. Mai, 2010 .

Effects of dietary docosahexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans)

Wei Xu, K. Mai, Yanjiao Zhang, 2012 .

Effects of dietary n-3 highly unsaturated fatty acids on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans).

K. Mai, W. Xu, Yanjiao Zhang, 2012, Fish & shellfish immunology.

Activation of Autophagy Relieves Linoleic Acid-Induced Inflammation in Large Yellow Croaker (Larimichthys crocea)

K. Mai, Wei Xu, Q. Ai, 2021, Frontiers in Immunology.

Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in Large Yellow Croakers.

K. Mai, Q. Ai, Jing Yan, 2015, The Journal of nutrition.

Conventional Soybean Meal as Fishmeal Alternative in Diets of Japanese Seabass (Lateolabrax japonicus): Effects of Functional Additives on Growth, Immunity, Antioxidant Capacity and Disease Resistance

K. Mai, Jie Wang, Q. Ai, 2022, Antioxidants.

FXR, a Key Regulator of Lipid Metabolism, Is Inhibited by ER Stress-Mediated Activation of JNK and p38 MAPK in Large Yellow Croakers (Larimichthys crocea) Fed High Fat Diets

K. Mai, Q. Ai, Xiaojun Xiang, 2021, Nutrients.

Influence of dietary lipid on growth performance and some lipogenesis-related gene expression of tongue sole (Cynoglossus semilaevis) larvae

Songlin Li, K. Mai, W. Xu, 2017 .

Effects of dietary arginine on growth, activity of digestive enzymes, GCN2‐ATF4 signalling pathway and nutritional metabolism‐related gene expression of large yellow croaker ( Larimichthys crocea ) larvae

N. Xu, K. Mai, Yongtao Liu, 2021, Aquaculture Nutrition.

Effects of Glycyrrhizin (GL) Supplementation on Survival, Growth Performance, Expression of Feeding-Related Genes, Activities of Digestive Enzymes, Antioxidant Capacity, and Expression of Inflammatory Factors in Large Yellow Croaker (Larimichthys crocea) Larvae

K. Mai, Yongtao Liu, Q. Ai, 2022, Aquaculture nutrition.

Effects of conjugated linoleic acid on growth, non-specific immunity, antioxidant capacity, lipid deposition and related gene expression in juvenile large yellow croaker (Larmichthys crocea) fed soyabean oil-based diets.

Wei Xu, K. Mai, Q. Ai, 2013, The British journal of nutrition.

Effect of Dietary Carbohydrate Levels on Growth Performance , Body Composition and Apparent Digestibility Coefficients in Cobia Rachycentron canadum L , at Two Different Growth Stages

K. Mai, Wei Xu, Yanjiao Zhang, 2015 .

Effects of fish meal replacement by soybean meal with supplementation of functional compound additives on intestinal morphology and microbiome of Japanese seabass (Lateolabrax japonicus)

Wei Xu, K. Mai, Yanjiao Zhang, 2017 .

Vegetable oil induced inflammatory response by altering TLR-NF-κB signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker (Larimichthys crocea).

Wei Xu, K. Mai, Q. Ai, 2016, Fish & shellfish immunology.

Dietary supplementation of stachyose and Lactobacillus casei improves the immunity and intestinal health of turbot ( Scophthalmus maximus . L)

Wenbing Zhang, K. Mai, Yanjiao Zhang, 2021, Aquaculture Nutrition.

Effects of DGAT1 inhibition on hepatic lipid deposition, antioxidant capacity and inflammatory response in Larimichthys crocea

K. Mai, Q. Ai, Xiaojun Xiang, 2021 .

Dietary arginine supplementation mitigates the soybean meal induced enteropathy in juvenile turbot, Scophthalmus maximus L.

Wei Xu, Wenbing Zhang, K. Mai, 2018 .

Effects of dietary xylan on growth performance , digestive enzyme activity and intestinal morphology of juvenile turbot ( Scophthalmus maximus L . )

Wenbing Zhang, K. Mai, Yanxian Li, 2014 .

The Open Access Israeli Journal of Aquaculture – Bamidgeh

K. Mai, Q. Ai, X. Qian, 2014 .

Effects of dietary canola meal on growth performance, digestion and metabolism of Japanese seabass, Lateolabrax japonicus

Wei Xu, K. Mai, Q. Ai, 2010 .

Citric acid as a functional supplement in diets for juvenile turbot, Scophthalmus maximus L.: Effects on phosphorus discharge, growth performance, and intestinal health

Wenbing Zhang, K. Mai, J. Dai, 2018, Aquaculture.

Effects of dietary β‐glucan and glycyrrhizin on non‐specific immunity and disease resistance of white shrimp, Litopenaeus vannamei (Boone) challenged with Vibrio alginolyticus

Wenbing Zhang, K. Mai, Wei Xu, 2011 .

Effects of dietary arginine and glutamine on growth performance, nonspecific immunity, and disease resistance in relation to arginine catabolism in juvenile turbot (Scophthalmus maximus L.)

Wei Xu, K. Mai, Jing-Huei Chen, 2017 .

Comparison of high‐protein soybean meal and commercial soybean meal partly replacing fish meal on the activities of digestive enzymes and aminotransferases in juvenile Japanese seabass, Lateolabrax japonicus (Cuvier, 1828)

Wei Xu, K. Mai, Q. Ai, 2014 .

Effects of Dietary Soy Protein Concentrate on Growth Performance, Digestion, and Protein Metabolism of Juvenile Darkbarbel Catfish Pelteobagrus vachelli

Wei Xu, Wenbing Zhang, K. Mai, 2014 .

Evaluation of Enteromorpha prolifera as a feed component in large yellow croaker (Pseudosciaena crocea, Richardson, 1846) diets

K. Mai, Q. Ai, Hiskia Asino, 2011 .

Effects of dietary supplementation of Bacillus subtilis and fructooligosaccharide on growth performance, survival, non-specific immune response and disease resistance of juvenile large yellow croaker, Larimichthys crocea

Wenbing Zhang, K. Mai, W. Xu, 2011 .

Effects of nucleotide supplementation on growth, immune responses and intestinal morphology in juvenile turbot fed diets with graded levels of soybean meal (Scophthalmus maximus L.)

Wei Xu, K. Mai, Q. Ai, 2013 .

Effects of dietary vitamin C on growth and immune response of Japanese seabass, Lateolabrax japonicus

Wei Xu, K. Mai, B. Tan, 2004 .

Effect of high dietary intakes of vitamin E and n-3 HUFA on immune responses and resistance to Edwardsiella tarda challenge in Japanese flounder (Paralichthys olivaceus, Temminck and Schlegel)

Wei Xu, Wenbing Zhang, K. Mai, 2006 .

Effects of dietary supplementation of glycyrrhizic acid on growth performance, survival, innate immune response and parasite resistance in juvenile large yellow croaker, Larimichthys crocea (Richardson)

Wei Xu, K. Mai, Q. Ai, 2015 .

Effects of dietary vitamin C on survival, growth, and immunity of large yellow croaker, Pseudosciaena crocea

Wei Xu, Wenbing Zhang, K. Mai, 2006 .

Comparative study between probiotic bacterium Arthrobacter XE-7 and chloramphenicol on protection of Penaeus chinensis post-larvae from pathogenic vibrios

Wei Xu, Wenbing Zhang, K. Mai, 2006 .

Influence of dietary biotin levels on growth and non‐specific immune response in large yellow croaker, Larimichthys crocea R

Jing Zhang, K. Mai, Q. Ai, 2017 .

Estimation of dietary biotin requirement of Japanese seabass, Lateolabrax japonicus C.

Jing Zhang, K. Mai, Q. Ai, 2009 .

Interactive effects of dietary cholesterol and protein sources on growth performance and cholesterol metabolism of Japanese flounder (Paralichthys olivaceus)

Wenbing Zhang, K. Mai, B. Tan, 2009 .

Effects of DL-methionyl-DL-methionine supplementation on growth performance, immune and antioxidative responses of white leg shrimp (Litopenaeus vannamei) fed low fishmeal diet

K. Masagounder, K. Mai, Q. Ai, 2021 .

Influence of dietary probiotic Bacillus TC22 and Prebiotic fructooligosaccharide on growth, immune responses and disease resistance against Vibrio splendidus infection in sea cucumber Apostichopus japonicus

Wei Xu, Wenbing Zhang, K. Mai, 2011 .

Immune response of sea cucumber Apostichopus japonicus coelomocytes to several immunostimulants in vitro

Wenbing Zhang, K. Mai, Q. Ai, 2010 .

Effects of replacing fish meal with soy protein concentrate on feed intake and growth of juvenile Japanese flounder, Paralichthys olivaceus

Wei Xu, Wenbing Zhang, K. Mai, 2006 .

Effects of dietary chitosan oligosaccharide complex with rare earth on growth performance and innate immune response of turbot, Scophthalmus maximus L.

Wei Xu, K. Mai, Dongfeng Wang, 2013 .

Effects of melamine on growth performance and skin color of darkbarbel catfish (Pelteobagrus vachelli)

Wei Xu, K. Mai, Q. Ai, 2011 .

Dietary lipid levels affect lipoprotein clearance, fatty acid transport, lipogenesis and lipolysis at the transcriptional level in muscle and adipose tissue of large yellow croaker (Larimichthys crocea)

K. Mai, Q. Ai, Jing Yan, 2017 .

Effect of dietary chitosan oligosaccharide complex with Ce (IV) on growth, immunity and disease resistance against Vibrio splendidus of sea cucumber, Apostichopus japonicas

K. Mai, Yanlong Wang, Dongfeng Wang, 2017 .

Effects of a yeast‐based additive on growth and immune responses of white shrimp, Litopenaeus vannamei (Boone, 1931), and aquaculture environment

K. Mai, B. Tan, D. Deng, 2013 .

Growth and body composition of juvenile white shrimp, Litopenaeus vannamei, fed different ratios of dietary protein to energy

K. Mai, B. Tan, Q. Ai, 2008 .

Effects of dietary protein sources on feed intake, growth and plasma thyroid hormones levels of Japanese flounder (Paralichthys olivaceus)

Wei Xu, Wenbing Zhang, K. Mai, 2011, Aquaculture International.

Effects of dietary administration of probiotic Halomonas sp. B12 on the intestinal microflora, immunological parameters, and midgut histological structure of shrimp, Fenneropenaeus chinensis.

Wei Xu, Wenbing Zhang, K. Mai, 2009 .

Effect of dietary cholesterol and phospholipids on feed intake, growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.)

K. Mai, W. Xu, Q. Ai, 2018, Aquaculture.

Effect of dietary lipid on the growth, fatty acid composition and Δ5 Fads expression of abalone (Haliotis discus hannai Ino) hepatopancreas

Wei Xu, Wenbing Zhang, K. Mai, 2015, Journal of Ocean University of China.

Tragacanth Gum and Linseed Gum as Adhesives Improved the Survival, Digestive Function, Antioxidant Enzyme Activities, and Immunity in Large Yellow Croaker (Larimichthys crocea) Larvae

K. Mai, Yuntao Wang, Q. Ai, 2023, Aquaculture Research.

Effects of Dietary Binders on Survival and Growth Performance of Postlarval Tongue Sole, Cynoglossus semilaevis (Günther)

Wei Xu, Wenbing Zhang, K. Mai, 2008 .

Effects of dietary silymarin (SM) supplementation on growth performance, digestive enzyme activities, antioxidant capacity and lipid metabolism gene expression in large yellow croaker ( Larimichthys crocea ) larvae

K. Mai, Yongtao Liu, N. Xu, 2020 .

Effects of dietary protein levels on the growth, survival, amylase and trypsin activities in large yellow croaker, Pseudosciaena Crocea R., larvae

K. Mai, Hairui Yu, Q. Ai, 2012 .

Ontogenic development of digestive enzyme activities in juvenile soft-shelled turtle (Pelodiscus sinensis) under cultured conditions

K. Mai, Q. Ai, Yurong Zou, 2011 .

Early Life Intervention Using Probiotic Clostridium butyricum Improves Intestinal Development, Immune Response, and Gut Microbiota in Large Yellow Croaker (Larimichthys crocea) Larvae

K. Mai, Yongtao Liu, Q. Ai, 2021, Frontiers in Immunology.

Effect of replacement of dietary fish oil with four vegetable oils on prostaglandin E2 synthetic pathway and expression of inflammatory genes in marine fish Larimichthys crocea.

K. Mai, Q. Ai, Xueshan Li, 2020, Fish & shellfish immunology.

The Effects of Sodium Propionate Supplementation in the Diet with High Soybean Meal on Growth Performance, Intestinal Health, and Immune Resistance to Bacterial Infection in Turbot (Scophthalmus maximus L.)

Wenhui Wang, K. Mai, Q. Ai, 2022, Aquaculture nutrition.

Transcription factor EB (TFEB) participates in antiviral immune responses independent of mTORC1 in macrophage of large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Si Zhu, 2023, Fish & shellfish immunology.

Replacement of fish meal by meat and bone meal in diets for large yellow croaker, Pseudosciaena crocea

Wei Xu, Qinghui Ai, Wei Xu, 2006 .

Effects of dietary levels of protein on growth, feed utilization and physiological parameters for juvenile Dabry's sturgeon, Acipenser dabryanus

K. Mai, Q. Ai, H. Liang, 2018 .

Effects of dietary squid viscera meal on growth and cadmium accumulation in tissues of Japanese seabass, Lateolabrax japonicus (Cuvier 1828)

Wei Xu, K. Mai, B. Tan, 2006 .

Effects of Protein and Lipid Levels in Practical Diets on Growth and Body Composition of Tongue Sole, Cynoglossus semilaevis Gunther

Xingwang Liu, K. Mai, Yanjiao Zhang, 2013 .

Effects of practical dietary protein to lipid levels on growth, digestive enzyme activities and body composition of juvenile rice field eel (Monopterus albus)

Y. Hu, Q. Ai, Xiao Ma, 2013, Aquaculture International.

Suppression of cideb under endoplasmic reticulum stress exacerbated hepatic inflammation by inducing hepatic steatosis and oxidative stress.

K. Mai, Ya-Ching Shen, Q. Ai, 2022, Free radical biology & medicine.

Effects of Dietary Pregelatinized Corn Starch on Growth, Apparent Digestibility, and Digestive Enzyme Activity of Large Yellow Croaker Fingerlings (Pseudosciaena crocea)

K. Mai, Q. Ai, Yan Li, 2013 .

Evaluation of Dietary Anti-nutritional Factors and Amino Acids Supplementation on Growth, Feed Efficiency Ratio, and Apparent Digestibility of Japanese Flounder (Paralichthys olivaceus) at Equal Feed Intake

Yanjiao Zhang, Q. Ai, Houguo Xu, 2016 .

Effects of Dietary Protein and Lipid Levels on Growth, Nutrient Utilization, and the Whole‐body Composition of Turbot, Scophthalmus maximus, Linnaeus 1758, at Different Growth Stages

Xingwang Liu, K. Mai, Q. Ai, 2014 .

Are fish what they eat? A fatty acid's perspective.

G. Turchini, Q. Ai, Mengqing Liang, 2020, Progress in lipid research.

Effects of Replacement of Fish Meal by Soybean Meal and Supplementation of Methionine in Fish Meal/Soybean Meal‐based Diets on Growth Performance of the Southern Catfish Silurus meridionalis

Q. Ai, Xiaojun Xie, 2005 .

Dietary stachyose altered the intestinal microbiota profile and improved the intestinal mucosal barrier function of juvenile turbot, Scophthalmus maximus L.

Wenbing Zhang, K. Mai, Yanxian Li, 2018 .

Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Xueshan Li, 2021, Journal of hazardous materials.

Molecular cloning and functional characterization of a putative Elovl4 gene and its expression in response to dietary fatty acid profiles in orange-spotted grouper Epinephelus coioides

Ó. Monroig, D. Tocher, J. Navarro, 2017 .

Regulation of FADS2 transcription by SREBP-1 and PPAR-α influences LC-PUFA biosynthesis in fish

Jianfeng Zhou, K. Mai, Q. Ai, 2017, Scientific Reports.

Dietary docosahexaenoic acid to eicosapentaenoic acid (DHA/EPA) ratio influenced growth performance, immune response, stress resistance and tissue fatty acid composition of juvenile Japanese seabass, Lateolabrax japonicus (Cuvier)

Wenbing Zhang, K. Mai, Wei Xu, 2016 .

Characterization, mRNA expression and regulation of Δ6 fatty acyl desaturase (FADS2) by dietary n − 3 long chain polyunsaturated fatty acid (LC-PUFA) levels in grouper larvae (Epinephelus coioides)

Songlin Li, K. Mai, W. Xu, 2014 .

Molecular cloning, functional characterization and nutritional regulation of two elovl4b elongases from rainbow trout (Oncorhynchus mykiss)

Nannan Zhao, Wei Xu, Ó. Monroig, 2019, Aquaculture.

Nutritional Regulation and the Different Transcriptional Regulation Mechanisms of the 3-Hydroxyacyl-Coa Dehydratases 1(Hacd1)Between Large Yellow Croaker (Larimichthys Crocea) and Rainbow Trout (Oncorhynchus Mykiss)

K. Mai, Q. Ai, Y. Pang, 2023, SSRN Electronic Journal.

Cloning and characterization of SREBP-1 and PPAR-α in Japanese seabass Lateolabrax japonicus, and their gene expressions in response to different dietary fatty acid profiles.

Wei Xu, K. Mai, Yanjiao Zhang, 2015, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Effects of different dietary lipid sources on growth performance, hepatic lipid deposition and transcriptome response in spotted sea bass (Lateolabrax maculatus)

Xiaoru Chen, K. Mai, Q. Ai, 2022, Aquaculture.

Effects of High Levels of Dietary Linseed Oil on the Growth Performance, Antioxidant Capacity, Hepatic Lipid Metabolism, and Expression of Inflammatory Genes in Large Yellow Croaker (Larimichthys crocea)

K. Mai, Yanjiao Zhang, Q. Ai, 2021, Frontiers in Physiology.

Nutritional programming of large yellow croaker (Larimichthys crocea) larvae by dietary vegetable oil: effects on growth performance, lipid metabolism and antioxidant capacity

K. Mai, Yongtao Liu, Q. Ai, 2022, British Journal of Nutrition.

Dietary leucine requirement for juvenile large yellow croaker Pseudosciaena crocea (Richardson, 1846)

Wei Xu, K. Mai, Q. Ai, 2010 .

Effects of practical dietary protein to lipid levels on growth, digestive enzyme activities and body composition of juvenile rice field eel (Monopterus albus)

Q. Ai, Yi Hu, Xiao Ma, 2014, Aquaculture International.

Effects of dietary soybean protein levels on energy budget of the southern catfish, Silurus meridionalis.

Q. Ai, Xiaojun Xie, 2005, Comparative biochemistry and physiology. Part A, Molecular & integrative physiology.

Dietary ALA, But not LNA, Increase Growth, Reduce Inflammatory Processes, and Increase Anti-Oxidant Capacity in the Marine Finfish Larimichthys crocea

Wei Xu, K. Mai, G. Turchini, 2015, Lipids.

Effect of dietary fatty acid composition on growth, fatty acids composition and hepatic lipid metabolism in juvenile turbot (Scophthalmus maximus L.) fed diets with required n3 LC-PUFAs

Wei Xu, B. Macq, K. Mai, 2017 .

Response of juvenile Japanese seabass (Lateolabrax japonicus) to different dietary fatty acid profiles: Growth performance, tissue lipid accumulation, liver histology and flesh texture

K. Mai, Q. Ai, Houguo Xu, 2016 .

Influence of 18:2n‐6/20:5n‐3 ratio in diets on growth and fatty acid composition of juvenile abalone, Haliotis discus hannai Ino

Wei Xu, Wenbing Zhang, K. Mai, 2011 .

Replacement of Fish Oil with Linseed Oil or Soybean Oil in Feeds for Japanese Seabass, Lateolabrax japonicus: Effects on Growth Performance, Immune Response, and Tissue Fatty Acid Composition

K. Mai, Yanjiao Zhang, Q. Ai, 2015 .

Effects of dietary phospholipids on survival, growth, digestive enzymes and stress resistance of large yellow croaker, Larmichthys crocea larvae

K. Mai, Q. Ai, Jinzhu Zhao, 2013 .

Dietary vegetable oil suppressed non‐specific immunity and liver antioxidant capacity but induced inflammatory response in Japanese sea bass (Lateolabrax japonicus)

K. Mai, Q. Ai, Hanlin Xu, 2017, Fish & shellfish immunology.

Effects of dietary squid viscera meal on growth and cadmium accumulation in tissues of large yellow croaker, Pseudosciaena crocea R.

K. Mai, Q. Ai, Lu Zhang, 2009 .

Effects of oxidised dietary fish oil and high-dose vitamin E supplementation on growth performance, feed utilisation and antioxidant defence enzyme activities of juvenile large yellow croaker (Larmichthys crocea)

K. Mai, W. Xu, Q. Ai, 2016, British Journal of Nutrition.

Effects of Soya Saponins on Feed Intake, Growth Performance, and Cholesterol Metabolism in Juvenile Turbot (Scophthalmus maximus L)

K. Mai, Q. Ai, X. Qian, 2015 .

High level of dietary olive oil decreased growth, increased liver lipid deposition and induced inflammation by activating the p38 MAPK and JNK pathways in large yellow croaker (Larimichthys crocea).

K. Mai, Yanjiao Zhang, Q. Ai, 2019, Fish & shellfish immunology.

Dietary l-carnitine regulates liver lipid metabolism via simultaneously activating fatty acid β-oxidation and suppressing endoplasmic reticulum stress in large yellow croaker fed with high-fat diets

K. Mai, Q. Ai, Jiamin Li, 2022, British Journal of Nutrition.

Regulation of hepatic lipid deposition by phospholipid in large yellow croaker

K. Mai, Q. Ai, Zuonan Cai, 2017, British Journal of Nutrition.

Dietary threonine requirement of juvenile large yellow croaker, Larmichthys crocea

K. Mai, Q. Ai, Yan Li, 2016 .

Effects of dietary inorganic salts supplementation on growth performance, bone mineral deposition, intestinal morphology and immune response of turbot juveniles ( Scophthalmus maximus L.) in fermented soybean meal‐based diets

K. Mai, Yongtao Liu, Q. Ai, 2021, Aquaculture Nutrition.

Lipid and fatty acid compositions of cod (Gadus morhua), haddock (Melanogrammus aeglefinus) and halibut (Hippoglossus hippoglossus)

K. Mai, Q. Ai, S. Lall, 2010 .

Evaluation of Schizochytrium meal in microdiets of Pacific white shrimp (Litopenaeus vannamei) larvae

K. Mai, Q. Ai, Yuyu Wang, 2017 .

Effects of dietary menhaden oil, soybean oil and soybean lecithin oil at different ratios on growth, body composition and blood chemistry of juvenile Litopenaeus vannamei

K. Mai, B. Tan, Shixuan Zheng, 2011, Aquaculture International.

Effects of dietary terrestrial oils supplemented with l-carnitine on growth, antioxidant capacity, lipid metabolism and inflammation in large yellow croaker (Larimichthys crocea)

K. Mai, Q. Ai, Xueshan Li, 2020, British Journal of Nutrition.

Environmental adaptation in fish induced changes in the regulatory region of fatty acid elongase gene, elovl5, involved in long-chain polyunsaturated fatty acid biosynthesis.

D. Tocher, Yongnan Li, K. Mai, 2022, International journal of biological macromolecules.

Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea)

Yongnan Li, K. Mai, Q. Ai, 2019, International journal of molecular sciences.

Effects of dietary ethoxyquin on growth, feed utilization and residue in the muscle of juvenile Japanese seabass, Lateolabrax japonicus

Wenbing Zhang, K. Mai, W. Xu, 2015 .

Effects of the partial substitution of dietary fish meal by two types of soybean meals on the growth performance of juvenile Japanese seabass, Lateolabrax japonicus (Cuvier 1828)

K. Mai, W. Xu, Q. Ai, 2012 .

Molecular cloning and functional characterization of a putative Elovl4 gene and its expression in response to dietary fatty acid profiles in orange-spotted grouper Epinephelus coioides. Aquac

W. Xu, Ó. Monroig, D. Tocher, 2017 .

Replacement of dietary fish oil with vegetable oils improves the growth and flesh quality of large yellow croaker (Larmichthys crocea)

K. Mai, Q. Ai, Lu Zhang, 2014, Journal of Ocean University of China.

Effect of dietary xylan on immune response, tight junction protein expression and bacterial community in the intestine of juvenile turbot (Scophthalmus maximus L.)

Wenbing Zhang, K. Mai, Yanxian Li, 2019, Aquaculture.

Effects of dietary curcumin on growth, antioxidant capacity, fatty acid composition and expression of lipid metabolism-related genes of large yellow croaker fed a high-fat diet

K. Mai, Q. Ai, Renlei Ji, 2020, British Journal of Nutrition.

Effects of dietary lysolecithin on growth performance, serum biochemical indexes, antioxidant capacity, lipid metabolism and inflammation-related genes expression of juvenile large yellow croaker (Larimichthys crocea).

K. Mai, Yongtao Liu, Q. Ai, 2022, Fish & shellfish immunology.

Dietary lysine requirement of large yellow croaker (Pseudosciaena crocea, Richardson 1846) larvae

K. Mai, W. Xu, Q. Ai, 2012 .

Dietary Histidine Requirement for Juvenile Large Yellow Croaker, Pseudosciaena crocea R.

K. Mai, Q. Ai, Yan Li, 2014 .

Effect of dietary olaquindox on the growth of large yellow croaker (Pseudosciaena crocea R.) and the distribution of its residues in fish tissues

K. Mai, Q. Ai, Lu Zhang, 2014, Journal of Ocean University of China.

Molecular Cloning , Characterization , and Nutritional Regulation of Elovl 6 in Large Yellow Croaker ( Larimichthys crocea )

Yongnan Li, K. Mai, Q. Ai, 2019 .

Liposome‐mediated messenger RNA: An alternative for fish cell transfection in culture

Huarong Guo, Q. Ai, Xiaojun Xiang, 2020 .

Effect of dietary taurine supplementation on growth performance, digestive enzyme activities and antioxidant status of juvenile black carp (Mylopharyngodon piceus ) fed with low fish meal diet

Q. Ai, W. Chu, Yi Hu, 2018, Aquaculture Research.

The tolerance and safety assessment of taurine as additive in a marine carnivorous fish, Scophthalmus maximus L.

Wenbing Zhang, K. Mai, J. Dai, 2018 .

Dietary soya allergen β‐conglycinin induces intestinal inflammatory reactions, serum‐specific antibody response and growth reduction in a carnivorous fish species, turbot Scophthalmus maximus L.

Wei Xu, Wenbing Zhang, K. Mai, 2017 .

Effects of dietary tributyrin supplementation on the growth performance, serum biochemistry, antioxidant capability and intestinal morphology and structure of golden pompano ( Trachinotus ovatus )

K. Mai, Shuqi Wang, Q. Ai, 2022, Aquaculture Research.

Effects of dietary stachyose on growth performance, digestive enzyme activities and intestinal morphology of juvenile turbot (Scophthalmus maximus L)

Wei Xu, Wenbing Zhang, K. Mai, 2015, Journal of Ocean University of China.

Acetyl-CoA derived from hepatic mitochondrial fatty acid β-oxidation aggravates inflammation by enhancing p65 acetylation

K. Mai, Q. Ai, Jianlong Du, 2021, iScience.

Chromium polynicotinate inclusion in the diet affects growth, feed utilization, and chromium retention in Japanese seabass Lateolabrax japonicas fed a low protein starch-based diet

K. Mai, Q. Ai, Jun Wang, 2022, Aquaculture.

Potential of Several Protein Sources as Fish Meal Substitutes in Diets for Large Yellow Croaker, Pseudosciaena crocea R

K. Mai, Shixuan Zheng, Jing Li, 2010 .

Dietary daidzein improved intestinal health of juvenile turbot in terms of intestinal mucosal barrier function and intestinal microbiota.

Wenbing Zhang, K. Mai, J. Dai, 2019, Fish & shellfish immunology.

Effects of supplemental fulvic acid on survival, growth performance, digestive ability and immunity of large yellow croaker (Larimichthys crocea) larvae

K. Mai, Yongtao Liu, Q. Ai, 2023, Frontiers in Physiology.

Effects of Chitosan-Coated Microdiet on Dietary Physical Properties, Growth Performance, Digestive Enzyme Activities, Antioxidant Capacity, and Inflammation Response of Large Yellow Croaker (Larimichthys crocea) Larvae

K. Mai, Yongtao Liu, Q. Ai, 2022, Aquaculture nutrition.

Effects of antinutritional factors on plasma lipoprotein levels in Japanese flounder Paralichthys olivaceus.

K. Mai, Q. Ai, X. Wang, 2012, Journal of fish biology.

Beneficial effects of phytase and/or protease on growth performance, digestive ability, immune response and muscle amino acid profile in low phosphorus and/or low fish meal gibel carp (Carassius auratus gibelio) diets

K. Mai, Q. Ai, Xin Zheng, 2022, Aquaculture.

Effects of soybean oligosaccharides on lipid metabolism of Japanese flounder (Paralichthys olivaceus Temminck et Schlegel) fed animal or plant protein source-based diets

Wenbing Zhang, K. Mai, Q. Ai, 2007 .

Effect of dietary methionine on growth performance, lipid metabolism and antioxidant capacity of large yellow croaker (Larimichthys crocea) fed with high lipid diets

K. Mai, Q. Ai, Y. Pang, 2021, Aquaculture.

ω-6 Polyunsaturated fatty acids (linoleic acid) activate both autophagy and antioxidation in a synergistic feedback loop via TOR-dependent and TOR-independent signaling pathways

K. Mai, Q. Ai, Xueshan Li, 2020, Cell Death & Disease.

Effects of supplemental octanoate on hepatic lipid metabolism, serum biochemical indexes, antioxidant capacity and inflammation-related genes expression of large yellow croaker (Larimichthys crocea) fed with high soybean oil diet

K. Mai, Yongtao Liu, Q. Ai, 2023, Frontiers in Immunology.

Effects of brown fish meal replacement with fermented soybean meal on growth performance, feed efficiency and enzyme activities of Chinese soft-shelled turtle, Pelodiscus sinensis

Wei Xu, Wenbing Zhang, K. Mai, 2012, Journal of Ocean University of China.

Molecular cloning, characterization and mRNA expression of selenium-dependent glutathione peroxidase from abalone Haliotis discus hannai Ino in response to dietary selenium, zinc and iron.

Wei Xu, Wenbing Zhang, K. Mai, 2010, Comparative biochemistry and physiology. Toxicology & pharmacology : CBP.

Functional analysis and regulation mechanism of interferon gamma in macrophages of large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Dandan Xu, 2021, International journal of biological macromolecules.

Evaluation of Six Selected Commercial Fermented Soybean Meal by Feeding Juvenile Turbot ( Scophthalmus maximus L.)

K. Mai, Q. Ai, Xueshan Li, 2022 .

Effects of enzymatic hydrolysis chicken by‐product in high plant‐based protein diet on growth performance, digestive capacity, antioxidant capacity and non‐specific immunity of juvenile turbot ( Scophthalmus maximus L.)

K. Mai, Q. Ai, Xueshan Li, 2021, Aquaculture Nutrition.

Vitamin D influences gut microbiota and acetate production in zebrafish (Danio rerio) to promote intestinal immunity against invading pathogens

Wenhui Wang, K. Mai, G. H. Gudmundsson, 2023, Gut microbes.

Omega‐3 polyunsaturated fatty acids alleviate hepatic steatosis‐induced inflammation through Sirt1‐mediated nuclear translocation of NF‐&kgr;B p65 subunit in hepatocytes of large yellow croaker (Larmichthys crocea)

Wei Xu, K. Mai, Q. Ai, 2017, Fish & shellfish immunology.

Effects of dietary glycinin on the growth performance, digestion, intestinal morphology and bacterial community of juvenile turbot, Scophthalmus maximus L.

Wenbing Zhang, K. Mai, Yanxian Li, 2017 .

Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in the Large

K. Mai, Q. Ai, Jing Yan, 2015 .

EFFECTS OF VITAMIN E ON ANTIOXIDANT ENZYME ACTIVITIES AND FATTY ACID COMPOSITIONS IN JUVENILE ABALONE HALIOTIS DISCUS HANNAI INO

Wei Xu, Wenbing Zhang, K. Mai, 2007 .

Vitamin D3 protects turbot (Scophthalmus maximus L.) from bacterial infection.

K. Mai, Jiayu Liu, Q. Ai, 2021, Fish & shellfish immunology.

Effects of supplemental mixed bile acids on growth performance, body composition, digestive enzyme activities, skin color, and flesh quality of juvenile large yellow croaker (Larimichthys crocea) in soybean oil based diet

K. Mai, Jianmin Wang, X. Bu, 2023, Frontiers in Marine Science.

Vitamin D3 enhances the antibacterial ability in head-kidney macrophages of turbot (Scophthalmus maximus L.) through C-type lectin receptors.

K. Mai, Jiayu Liu, Q. Ai, 2022, Fish & shellfish immunology.

Feed intake, growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed defatted fish meal diets with graded levels of cholesterol

Wei Xu, K. Mai, Q. Ai, 2014 .

Effects of Tributyrin Supplementation on Growth Performance, Intestinal Digestive Enzyme Activity, Antioxidant Capacity, and Inflammation-Related Gene Expression of Large Yellow Croaker (Larimichthys crocea) Fed with a High Level of Clostridium autoethanogenum Protein

N. Xu, K. Mai, X. Bu, 2023, Aquaculture nutrition.

Nrf2 pathway in vegetable oil-induced inflammation of large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Xueshan Li, 2022, Fish & shellfish immunology.

Molecular cloning and characterization of unfolded protein response genes from large yellow croaker (Larimichthys crocea) and their expression in response to dietary fatty acids.

Wei Xu, Songlin Li, K. Mai, 2017, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Docosahexaenoic Acid Ameliorates the Toll-Like Receptor 22-Triggered Inflammation in Fish by Disrupting Lipid Raft Formation.

K. Mai, Q. Ai, Xiaojun Xiang, 2022, The Journal of nutrition.

Effects of GRP78 on Endoplasmic Reticulum Stress and Inflammatory Response in Macrophages of Large Yellow Croaker (Larimichthys crocea)

K. Mai, Q. Ai, Jie Sun, 2023, International journal of molecular sciences.

The protective role of daidzein in intestinal health of turbot (Scophthalmus maximus L.) fed soybean meal-based diets

Wenbing Zhang, K. Mai, Yanjiao Zhang, 2021, Scientific Reports.

The protective role of daidzein in intestinal health of turbot (Scophthalmus maximus L.) fed soybean meal-based diets

Wenbing Zhang, K. Mai, J. Dai, 2021, Scientific reports.

Proline with or without hydroxyproline influences collagen concentration and regulates prolyl 4-hydroxylase α (I) gene expression in juvenile turbo (Scophthalmus maximus L.)

Wei Xu, K. Mai, Yanjiao Zhang, 2015, Journal of Ocean University of China.

Effects of Dietary Vegetable Oils Replacing Fish Oil on Fatty Acid Composition, Lipid Metabolism and Inflammatory Response in Adipose Tissue of Large Yellow Croaker (Larimichthys crocea)

K. Mai, Q. Ai, Xueshan Li, 2022, Journal of Marine Science and Engineering.

Increased LDL receptor by SREBP2 or SREBP2-induced lncRNA LDLR-AS promotes triglyceride accumulation in fish

K. Mai, Q. Ai, Xueshan Li, 2022, iScience.

Activation of farnesoid X receptor suppresses ER stress and inflammation via the YY1/NCK1/PERK pathway in large yellow croaker (Larimichthys crocea)

K. Mai, Q. Ai, Xiaojun Xiang, 2022, Frontiers in Nutrition.

Polyunsaturated Fatty Acids Influence LPS-Induced Inflammation of Fish Macrophages Through Differential Modulation of Pathogen Recognition and p38 MAPK/NF-κB Signaling

K. Mai, Q. Ai, Kun Cui, 2020, Frontiers in Immunology.

Effects of dietary arginine and lysine on growth and non-specific immune responses of juvenile darkbarbel catfish( Pelteobagrus vachelli ): Effects of dietary arginine and lysine on growth and non-specific immune responses of juvenile darkbarbel catfish( Pelteobagrus vachelli )

Wenbing Zhang, K. Mai, Q. Ai, 2012 .

Effects of vegetable oil replacement on intramuscular fat deposition and flesh quality of large yellow croaker (Larimichthys crocea) juveniles

K. Mai, Q. Ai, Zhen Wang, 2023, Aquaculture.

Dietary daidzein improves the development of intestine subjected to soybean meal in juvenile turbot ( Scophthalmus maximus L.)

Wenbing Zhang, K. Mai, J. Dai, 2021, Aquaculture Nutrition.

Sodium acetate alleviates adverse effects caused by the diet with high proportion of soybean meal in turbot (Scophthalmus maximus L.)

Wenhui Wang, K. Mai, Q. Ai, 2022, Aquaculture.

Effects of dietary guaiacol on shell biomineralization of juvenile abalone Haliotis discus hannai, Ino

Wei Xu, Wenbing Zhang, K. Mai, 2008 .

Alleviation effect of dietary cerium and its complex with chitosan oligosaccharide on cadmium accumulation in juvenile turbot, Scophthalmus maximus L., under cadmium stress

K. Mai, Dongfeng Wang, W. Xu, 2016 .

In vitro assay for evaluating the effects of three anti‐nutritional factors on the primary‐cultured intestinal epithelial cells isolated from Japanese flounder, Paralichthys olivaceus

Wei Xu, Wenbing Zhang, K. Mai, 2015 .

Butyrate-induced IL-22 expression in fish macrophages contributes to bacterial clearance.

Wenhui Wang, K. Mai, G. H. Gudmundsson, 2023, Fish & shellfish immunology.

In vitro study of sodium butyrate on soyasaponin challenged intestinal epithelial cells of turbot (Scophthalmus maximus L.) refer to inflammation, apoptosis and antioxidant enzymes

Wenbing Zhang, K. Mai, Yanjiao Zhang, 2021, Fish and shellfish Immunology reports.

Daidzein improved glucose homeostasis via PI3K/AKT and modulated the communities of gut microbiota in turbot (Scophthalmus maximus L.)

Wenbing Zhang, K. Mai, Yanjiao Zhang, 2023, Aquaculture.

Suppressor of cytokine signaling 3 (SOCS3) is related to pro-inflammatory cytokine production and triglyceride deposition in turbot (Scophthalmus maximus).

B. Macq, Huarong Guo, K. Mai, 2017, Fish & shellfish immunology.

Use of a Compound Protein Source as a Replacement for Fish Meal in Diets of Large Yellow Croaker, Pseudosciaena crocea R.

K. Mai, B. Tan, Q. Ai, 2008 .

Dietary palm oil enhances SREBP2-mediated cholesterol biosynthesis through inducing endoplasmic reticulum stress in muscle of large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Xiaojun Xiang, 2023, The British journal of nutrition.

Effects of cannabidiol on growth performance, appetite, antioxidant capacity and liver inflammatory gene expression of juvenile large yellow croaker (Larmichthys crocea) fed diets with high soybean oil level

K. Mai, Yongtao Liu, X. Bu, 2023, Aquaculture.

TIR Domain-Containing Adaptor-Inducing Interferon-β (TRIF) Participates in Antiviral Immune Responses and Hepatic Lipogenesis of Large Yellow Croaker (Larimichthys Crocea)

K. Mai, Q. Ai, Xiaojun Xiang, 2019, Front. Immunol..

Discovery, characterization, and adipocyte differentiation regulation in perirenal adipose tissue of large yellow croaker (Larimichthys crocea)

K. Mai, Yongtao Liu, Q. Ai, 2023, Fish Physiology and Biochemistry.

Effects of GRP78 on endoplasmic reticulum stress and inflammation induced by Thapsigargin in macrophages of large yellow croaker (Larimichthys crocea)

K. Mai, Zhi Zhang, Q. Ai, 2023, Aquaculture.

Adipose tissue contributes to hepatic pro-inflammatory response when dietary fish oil is replaced by vegetable oil in large yellow croaker (Larimichthys crocea): An ex vivo study.

Songlin Li, K. Mai, Q. Ai, 2019, Fish & shellfish immunology.

Vitamin D Regulates Glucose Metabolism in Zebrafish (Danio rerio) by Maintaining Intestinal Homeostasis.

K. Mai, Q. Ai, Yawen Lan, 2023, The Journal of nutritional biochemistry.

Effects of Dietary Vitamin D3 on Growth Performance, Immune Status, and Calcium and Phosphorus Metabolism in Litopenaeus vannamei Under Different Salinity Conditions

Xu Zhou, K. Mai, Q. Ai, 2023, Journal of Ocean University of China.

Dietary protein requirement of juvenile turbot (Scophthalmus maximus Linnaeus)

Xingwang Liu, K. Mai, Q. Ai, 2015, Journal of Ocean University of China.

Phosphatidylethanolamine alleviates OX-LDL-induced macrophage inflammation by upregulating autophagy and inhibiting NLRP1 inflammasome activation.

K. Mai, Q. Ai, Wei Fang, 2023, Free radical biology & medicine.

Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in Large Yellow Croakers.

K. Mai, Q. Ai, Jing Yan, 2015, The Journal of nutrition.

Palmitic acid activates NLRP3 inflammasome through NF-κB and AMPK-mitophagy-ROS pathways to induce IL-1β production in large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Xueshan Li, 2023, Biochimica et biophysica acta. Molecular and cell biology of lipids.

Regulation of low-density lipoprotein on lipid metabolism in macrophages of large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Qiuchi Chen, 2023, Biochimica et biophysica acta. Molecular and cell biology of lipids.

Vitamin D3 Regulates Energy Homeostasis under Short-Term Fasting Condition in Zebrafish (Danio Rerio)

K. Mai, Q. Ai, Rui Shao, 2024, Nutrients.

Sterol regulatory element binding protein 1: a mediator for high fat diet-induced hepatic gluconeogenesis and glucose intolerance in fish.

K. Mai, Q. Ai, Xiaojun Xiang, 2024, The Journal of nutrition.

Glycerol monolaurate improved intestinal barrier, antioxidant capacity, inflammatory response and microbiota dysbiosis in large yellow croaker (Larimichthys crocea) fed with high soybean oil diets.

K. Mai, X. Bu, Q. Ai, 2023, Fish & shellfish immunology.

GSK-3β participates in the regulation of hepatic lipid deposition in large yellow croaker (Larmichthys crocea)

Wei Xu, K. Mai, Dongwu Liu, 2016, Fish Physiology and Biochemistry.

Effects of dietary phospholipid on lipase activity, antioxidant capacity and lipid metabolism-related gene expression in large yellow croaker larvae (Larimichthys crocea).

K. Mai, Q. Ai, Xiaojun Xiang, 2016, Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology.

Involvement of mitochondrial fatty acid β-oxidation in the antiviral innate immune response in head kidney macrophages of large yellow croaker (Larimichthys crocea).

K. Mai, Q. Ai, Zengqi Zhao, 2024, Fish & shellfish immunology.

Butyrate induces STAT3/HIF-1α/IL-22 signaling via GPCR and HDAC3 inhibition to activate autophagy in head kidney macrophages from turbot (Scophthalmus maximus L.).

K. Mai, R. Rekha, P. Bergman, 2023, Fish & shellfish immunology.

Differences in diacylglycerol acyltransferases expression patterns and regulation cause distinct hepatic triglyceride deposition in fish

Yongnan Li, K. Mai, Q. Ai, 2024, Communications biology.

Innovation and development of the aquaculture nutrition research and feed industry in China

K. Mai, Q. Ai, Jianlong Du, 2023, Reviews in Aquaculture.

Dietary phosphorus requirement of large yellow croaker, Pseudosciaena crocea R☆

Wei Xu, K. Mai, B. Tan, 2006 .

Dietary Oryzanol (Ory) Improved the Survival and Growth of Large Yellow Croaker (Larimichthys crocea) Larvae via Promoting Activities of Digestive Enzymes, Antioxidant Capacity, and Lipid Metabolism

K. Mai, Q. Ai, Wenxing Huang, 2024, Aquaculture Nutrition.