J. Cai

发表

Protective Effects of Myrtol Standardized Against Radiation-Induced Lung Injury

Deyun Zhao, Hongjin Qu, Jiaming Guo, 2016, Cellular Physiology and Biochemistry.

Hydrogen protects rats from dermatitis caused by local radiation

L. Qian, J. Cai, Bailong Li, 2014, The Journal of dermatological treatment.

Inhibiting TG2 sensitizes lung cancer to radiotherapy through interfering TOPOIIα-mediated DNA repair

Yanyong Yang, Kun Cao, Xiao Lei, 2019, bioRxiv.

Expression changes of ERK1/2, STAT3 and SHP-2 in bone marrow cells from gamma-ray induced leukemia mice.

Qi Chen, Ling Han, J. Cai, 2006, Journal of radiation research.

Protective effects of carboxyfullerene C 3 against γ-ray irradiation injury in mice: Protective effects of carboxyfullerene C 3 against γ-ray irradiation injury in mice

Hao Jiang, J. Cui, J. Cai, 2011 .

MiR-21 plays an Important Role in Radiation Induced Carcinogenesis in BALB/c Mice by Directly Targeting the Tumor Suppressor Gene Big-h3

Jing Lin, Shuyu Zhang, Cong Liu, 2011, International journal of biological sciences.

Hydrogen Protects Mice from Radiation Induced Thymic Lymphoma in BALB/c Mice

Cong Liu, J. Cai, Fu Gao, 2011, International journal of biological sciences.

Gene Expression Changes in Residual Advanced Cervical Cancer after Radiotherapy: Indicators of Poor Prognosis and Radioresistance?

J. Cai, Zhi-chao Fu, Feng-mei Wang, 2015, Medical science monitor : international medical journal of experimental and clinical research.

Heat-killed Salmonella Typhimurium protects mice against carbon ion radiation

Hong Zhang, Juxiang Chen, Yanyong Yang, 2020, The Journal of international medical research.

Glibenclamide, a diabetic drug, prevents acute radiation-induced liver injury of mice via up-regulating intracellular ROS and subsequently activating Akt–NF-κB pathway

Jiaming Guo, Hainan Zhao, Yanyong Yang, 2017, Oncotarget.

Therapeutic Effects of Hydrogen-Rich Solution on Aplastic Anemia in Vivo

L. Qian, Yanyong Yang, Cong Liu, 2013, Cellular Physiology and Biochemistry.

Administration of Hydrogen-Rich Saline Protects Mice From Lethal Acute Graft-Versus-Host Disease (aGVHD)

L. Qian, Jianliang Shen, J. Cai, 2013, Transplantation.

Molecular hydrogen protects human lymphocyte AHH-1 cells against 12C6+ heavy ion radiation

Hong Zhang, Yanyong Yang, Pei Zhang, 2013, International journal of radiation biology.

Hydrogen-rich saline protects spermatogenesis and hematopoiesis in irradiated BALB/c mice

L. Qian, Jianliang Shen, J. Cui, 2012, Medical science monitor : international medical journal of experimental and clinical research.

A possible prevention strategy of radiation pneumonitis: Combine radiotherapy with aerosol inhalation of hydrogen-rich solution

L. Qian, J. Cui, J. Cai, 2011, Medical science monitor : international medical journal of experimental and clinical research.

Radioprotective effect of hydrogen in cultured cells and mice

L. Qian, J. Cui, J. Cai, 2010, Free radical research.

The potential cardioprotective effects of hydrogen in irradiated mice.

Hao Jiang, L. Qian, J. Cui, 2010, Journal of radiation research.

The hypothesis of an effective safe and novel radioprotective agent: hydrogen-rich solution.

L. Qian, J. Cai, Fu Gao, 2010, The West Indian medical journal.

Protective Effects of Hydrogen against Low-Dose Long-Term Radiation-Induced Damage to the Behavioral Performances, Hematopoietic System, Genital System, and Splenic Lymphocytes in Mice

P. Liu, Yang Xu, Deyun Zhao, 2016, Oxidative medicine and cellular longevity.

Hydrogen as a New Class of Radioprotective Agent

Y. Chuai, L. Qian, Jianliang Shen, 2013, International journal of biological sciences.

Hydrogen-rich saline protects immunocytes from radiation-induced apoptosis

Yanyong Yang, J. Cui, Cong Liu, 2012, Medical science monitor : international medical journal of experimental and clinical research.

Hydrogen-rich saline attenuates radiation-induced male germ cell loss in mice through reducing hydroxyl radicals.

L. Qian, J. Cui, J. Cai, 2012, The Biochemical journal.

Gamma-ray Irradiation Impairs Dendritic Cell Migration to CCL19 by Down-regulation of CCR7 and Induction of Cell Apoptosis

Yanyong Yang, J. Cui, Cong Liu, 2011, International journal of biological sciences.

Sirt3 Promoted DNA Damage Repair and Radioresistance Through ATM-Chk2 in Non-small Cell Lung Cancer Cells

C. Bai, Yanyong Yang, Kun Cao, 2021, Journal of Cancer.

Radioprotective effects of roxadustat (FG‐4592) in haematopoietic system

Hainan Zhao, Yanyong Yang, Pei Zhang, 2018, Journal of cellular and molecular medicine.

Grape Seed Proanthocyanidins play the roles of radioprotection on Normal Lung and radiosensitization on Lung Cancer via differential regulation of the MAPK Signaling Pathway

Yang Xu, Yanyong Yang, Kun Cao, 2021, Journal of Cancer.

Radioprotective Effect of Grape Seed Proanthocyanidins In Vitro and In Vivo

Hainan Zhao, Yanyong Yang, Kun Cao, 2016, Oxidative medicine and cellular longevity.

Protective effects of proanthocyanidin on radiation-induced injury of human-derived cells: Protective effects of proanthocyanidin on radiation-induced injury of human-derived cells

J. Cui, J. Cai, Fu Gao, 2010 .

Long non-coding RNA ANRIL promotes homologous recombination-mediated DNA repair by maintaining ATR protein stability to enhance cancer resistance

Yanyong Yang, Kun Cao, J. Cai, 2021, Molecular Cancer.

Radiation-driven lipid accumulation and dendritic cell dysfunction in cancer

Jiaming Guo, J. Cui, Cong Liu, 2015, Scientific Reports.

Radiation‐induced decrease of CD8 + dendritic cells contributes to Th1/Th2 shift

Yifeng Gu, Yanyong Yang, Pei Zhang, 2017, International immunopharmacology.

TACAGCCGGGAAGACAATAACT CCTGCATTAAGGAGTCGGTTAG Tbet CCCCTTCTCACCTCTTCTATCC TCCGCTTCATAACTGTGTTCC Gata 3 TGAAGAAAGAAGGCATCCAGA AGTGGCTGAAGGGAGAGATGT Foxp 3 CTTTCACCTATGCCACCCTTA CATCTACGGTCCACACTGCTC Ror γ t TTCAGTATGTGGAGTTTGC AAAAAGACTGTGTTGTTGG GAPDH TTCCATCCTCCAGAAACCAG CCCTCGAACTAAGGGGAAAG 179

Yifeng Gu, Yanyong Yang, Pei Zhang, 2017 .

Whole Body Irradiation Induces Cutaneous Dendritic Cells Depletion via NF-κB Activation

Yanyong Yang, Pei Zhang, J. Cui, 2013, Cellular Physiology and Biochemistry.

Effects of ionizing radiation on dendritic cells: Effects of ionizing radiation on dendritic cells

Yanyong Yang, J. Cai, 2011 .

Poly(I:C) induce bone marrow precursor cells into myeloid-derived suppressor cells

Hongjuan Lu, Cong Liu, J. Cai, 2011, Molecular and Cellular Biochemistry.

Effect of high dose γ-irradiation on phenotype and function of dendritic cells: Effect of high dose γ-irradiation on phenotype and function of dendritic cells

Yanyong Yang, J. Cui, Cong Liu, 2011 .

TLR4 Agonist Monophosphoryl Lipid A Alleviated Radiation-Induced Intestinal Injury

Jiaming Guo, Yanyong Yang, J. Cui, 2019, Journal of immunology research.

Inhibition of Rac1 Attenuates Radiation-Induced Lung Injury while Sensitizes Lung Tumor to Radiotherapy

Yajie Yang, Hainan Zhao, Yanyong Yang, 2020 .

FG-4592 protects the intestine from irradiation-induced injury by targeting the TLR4 signaling pathway

Cong Liu, J. Cai, Ying Cheng, 2022, Stem cell research & therapy.

KATP Channel Blocker Glibenclamide Prevents Radiation-Induced Lung Injury and Inhibits Radiation-Induced Apoptosis of Vascular Endothelial Cells by Increased Ca2+ Influx and Subsequent PKC Activation.

B. Liu, Yang Xu, Yanyong Yang, 2019, Radiation research.

Polymyxin B Attenuates LPS-Induced Death but Aggravates Radiation-Induced Death via TLR4-Myd88-IL-6 Pathway

Hainan Zhao, Pei Zhang, J. Cui, 2017, Cellular Physiology and Biochemistry.

CpG-oligodeoxynucleotides may be effective for preventing ionizing radiation induced pulmonary fibrosis.

Hainan Zhao, J. Cai, Bailong Li, 2018, Toxicology letters.

ENHANCEMENT OF FRACTIONATED BONE MARROW TRANSPLANTATION ON HEMATOPOIETIC CELL HOMING IN A MOUSE ALLOGENEIC MODEL1

Xuetao Cao, G. Tang, J. Cai, 2004, Transplantation.

The mechanism for the radioprotective effects of zymosan‐A in mice

Hainan Zhao, Yanyong Yang, Pei Zhang, 2018, Journal of cellular and molecular medicine.

Radioprotection of bone marrow hematopoiesis by CpG-oligodeoxynucleotides administered to mice after total-body irradiation.

Jing Lin, J. Cui, Cong Liu, 2011, Journal of radiation research.

The mechanism for the ameliorative effect of CpG-oligodeoxynucleotides on bone marrow hemopoiesis radiation injury.

J. Cai, Fu Gao, Bailong Li, 2011, Basic & clinical pharmacology & toxicology.

CpG-Oligodeoxynucleotides Improved Irradiation-Induced Injuries by G-CSF and IL-6 Up-Regulation

Jiaming Guo, Yanyong Yang, Pei Zhang, 2017, Cellular Physiology and Biochemistry.

DNA-PKcs inhibition impairs HDAC6-mediated HSP90 chaperone function on Aurora A and enhances HDACs inhibitor-induced cell killing by increasing mitotic aberrant spindle assembly

Benjamin P. C. Chen, Jiaming Guo, J. Cai, 2021, Cell cycle.

Monophosphoryl lipid a attenuates radiation injury through TLR4 activation

Yang Xu, Jiaming Guo, Yanyong Yang, 2017, Oncotarget.

Nuclear Transglutaminase 2 interacts with topoisomerase II⍺ to promote DNA damage repair in lung cancer cells

Yanyong Yang, Kun Cao, Xiao Lei, 2021, Journal of Experimental & Clinical Cancer Research.

Influence of tumor suppressor gene PTEN expression on biological behaviors of radiation-induced mouse thymoma cells: Influence of tumor suppressor gene PTEN expression on biological behaviors of radiation-induced mouse thymoma cells

J. Cui, J. Cai, Fu Gao, 2009 .

Administration of Hydrogen-Rich Saline in Mice with Allogeneic Hematopoietic Stem-Cell Transplantation

Xiao-ping Chen, L. Qian, Jianliang Shen, 2015, Medical science monitor : international medical journal of experimental and clinical research.

Protective effect of CpG-ODN against irradiation injury of bone marrow hematopoietic system in mice: Protective effect of CpG-ODN against irradiation injury of bone marrow hematopoietic system in mice

J. Cui, Cong Liu, J. Cai, 2011 .

Protective effect of hydrogen-rich saline against radiation-induced immune dysfunction

Yanyong Yang, Pei Zhang, J. Cai, 2014, Journal of cellular and molecular medicine.

Hydrogen therapy may be an effective and specific novel treatment for aplastic anemia

L. Qian, Jianliang Shen, J. Cai, 2012, Medical science monitor : international medical journal of experimental and clinical research.

Downregulation of SPINK13 Promotes Metastasis by Regulating uPA in Ovarian Cancer Cells

Shengyun Cai, Pei Zhang, J. Cai, 2018, Cellular Physiology and Biochemistry.

Zymosan-a Protects the Hematopoietic System from Radiation-Induced Damage by Targeting TLR2 Signaling Pathway

Jiaming Guo, Hainan Zhao, Pei Zhang, 2017, Cellular Physiology and Biochemistry.

MiR-34a in Age and Tissue Related Radio-Sensitivity and Serum miR-34a as a Novel Indicator of Radiation Injury

Wei Wu, Jing Lin, Shengyun Cai, 2011, International journal of biological sciences.

Radioprotective Effects of Heat-Killed Mycobacterium Tuberculosis in Cultured Cells and Radiosensitive Tissues

Yang Xu, Jiaming Guo, Yanyong Yang, 2016, Cellular Physiology and Biochemistry.

Up-Regulated Expression of miR-23a/b Targeted the Pro-Apoptotic Fas in Radiation-Induced thymic Lymphoma

Yanyong Yang, Cong Liu, J. Cai, 2013, Cellular Physiology and Biochemistry.

miR‐200c enhances radiosensitivity of human breast cancer cells

Jing Lin, Yanyong Yang, Cong Liu, 2013, Journal of cellular biochemistry.

GSK-3β Inhibition Attenuates LPS-Induced Death but Aggravates Radiation-Induced Death via Down-Regulation of IL-6

Yanyong Yang, J. Cui, Cong Liu, 2013, Cellular Physiology and Biochemistry.

Hypoxia-Induced Mesenchymal Stromal Cells Exhibit an Enhanced Therapeutic Effect on Radiation-Induced Lung Injury in Mice due to an Increased Proliferation Potential and Enhanced Antioxidant Ability

B. Liu, Yang Xu, Yanyong Yang, 2017, Cellular Physiology and Biochemistry.

Inhibition of TBK1 attenuates radiation-induced epithelial–mesenchymal transition of A549 human lung cancer cells via activation of GSK-3β and repression of ZEB1

Yanyong Yang, J. Cui, Cong Liu, 2014, Laboratory Investigation.

A critical role of toll-like receptor 2 (TLR2) and its’ in vivo ligands in radio-resistance

Xin Liu, Pei Zhang, J. Cui, 2015, Scientific Reports.

Polydatin Attenuates 14.1 MeV Neutron-Induced Injuries via Regulating the Apoptosis and Antioxidative Pathways and Improving the Hematopoiesis of Mice

Taosheng Li, Jiaming Guo, Yanyong Yang, 2020, Oxidative medicine and cellular longevity.

Blocking TBK1 alleviated radiation-induced pulmonary fibrosis and epithelial-mesenchymal transition through Akt-Erk inactivation

Hongjin Qu, Yanyong Yang, J. Cai, 2019, Experimental & Molecular Medicine.

Mangiferin aglycone attenuates radiation‐induced damage on human intestinal epithelial cells

Honggang Hu, Yanyong Yang, J. Cai, 2012, Journal of cellular biochemistry.

The role and mechanism of long non‐coding RNAs in homologous recombination repair of radiation‐induced DNA damage

Yanyong Yang, Kun Cao, J. Cai, 2022, The journal of gene medicine.

Polydatin alleviated radiation‐induced lung injury through activation of Sirt3 and inhibition of epithelial–mesenchymal transition

Yang Xu, Jiaming Guo, Hainan Zhao, 2017, Journal of cellular and molecular medicine.

Novel chimeric TLR2/NOD2 agonist CL429 exhibited significant radioprotective effects in mice

Cong Liu, J. Cai, Ying Cheng, 2021, Journal of cellular and molecular medicine.

Heat Killed Salmonella typhimurium Protects Intestine Against Radiation Injury Through Wnt Signaling Pathway

Yanyong Yang, Kun Cao, J. Cui, 2020, Journal of oncology.

NOD2 agonist murabutide alleviates radiation‐induced injury through DNA damage response pathway mediated by ATR

Hongjin Qu, Yanyong Yang, J. Cui, 2019, Journal of cellular physiology.

Molecular hydrogen and radiation protection

L. Qian, J. Cai, Xuejun Sun, 2012, Free radical research.

Protective effects of activated vitamin D receptor on radiation‐induced intestinal injury

Yajie Yang, Haishan Lin, J. Cai, 2022, Journal of cellular and molecular medicine.

Roxadustat protect mice from DSS-induced colitis vivo by up-regulation of TLR4.

Cong Liu, J. Cai, Ying Cheng, 2023, Genomics.

Down Regulation of miR200c Promotes Radiation‐Induced Thymic Lymphoma by Targeting BMI1

Pei Zhang, J. Cui, Cong Liu, 2014, Journal of cellular biochemistry.

Down regulation of miR-143 promotes radiation - Induced thymic lymphoma by targeting B7H1.

Hainan Zhao, J. Cui, J. Cai, 2017, Toxicology letters.

Role of STAT3 antisense nucleic acid in promoting radiosensitivity of A549 cells: Role of STAT3 antisense nucleic acid in promoting radiosensitivity of A549 cells

J. Cui, J. Cai, Bailong Li, 2011 .

Cytotoxic and radiosensitizing effects of nano-C60 on tumor cells in vitro

Yuguo Li, G. Tang, J. Cai, 2008 .

CpG-Oligodeoxynucleotide Treatment Protects against Ionizing Radiation-Induced Intestine Injury

J. Cai, Bailong Li, J. Ni, 2013, PloS one.

MTERFD 1 functions as an oncogene

Yanyong Yang, Cong Liu, J. Cai, 2016 .

Grape seed pro-anthocyanidins ameliorates radiation-induced lung injury

Hainan Zhao, Yanyong Yang, Pei Zhang, 2014, Journal of cellular and molecular medicine.

Hydrogen therapy may be an effective and specific novel treatment for acute radiation syndrome.

J. Cui, Cong Liu, J. Cai, 2010, Medical hypotheses.

Nuclear Transglutaminase 2 interacts with topoisomerase II⍺ to promote DNA damage repair in lung cancer cells

Yanyong Yang, Kun Cao, Xiao Lei, 2021, Journal of experimental & clinical cancer research : CR.

Protective Effect of CpG-Oligodeoxynucleotides Against Low- and High-LET Irradiation

J. Cai, Bailong Li, J. Ni, 2014, Cellular Physiology and Biochemistry.

Heat-killed salmonella typhimurium (HKST) protects mice against radiation in TLR4-dependent manner

Yang Xu, Jiaming Guo, Yanyong Yang, 2017, OncoTarget.

LncRNA ANRIL promotes HR repair through regulating PARP1 expression by sponging miR-7-5p in lung cancer

Hang Wang, J. Cai, Yuanyuan Chen, 2023, BMC Cancer.

Monophosphoryl lipid A alleviated radiation‐induced testicular injury through TLR4‐dependent exosomes

Yanyong Yang, Kun Cao, Xiao Lei, 2020, Journal of cellular and molecular medicine.

Effects of 12C6+ Heavy Ion Radiation on Dendritic Cells Function

B. Liu, Yanyong Yang, Pei Zhang, 2018, Medical science monitor : international medical journal of experimental and clinical research.

Polydatin radiosensitizes lung cancer while preventing radiation injuries by modulating tumor-infiltrating B cells

Jiaming Guo, J. Cai, Bailong Li, 2023, Journal of Cancer Research and Clinical Oncology.

FG-4592 alleviates Radiation-Induced Intestinal Injury by facilitating recovery of intestinal stem cell and reducing damage of intestinal epithelial.

Yajie Yang, Yuhan Lin, Cong Liu, 2021, Toxicology letters.

A bidirectional effect of Rac1 inhibition-Protects radiation-induced intestinal injury while inhibits tumor.

Yajie Yang, Cong Liu, J. Cai, 2019, Life sciences.

[Effects of STAT3 antisense oligodeoxynucleotides on apoptosis and proliferation of mouse melanoma cell line B16].

G. Tang, Dan Zhu, J. Cui, 2006, Ai zheng = Aizheng = Chinese journal of cancer.

Hydrogen-rich PBS protects cultured human cells from ionizing radiation-induced cellular damage

L. Qian, J. Cai, Bailong Li, 2010 .

Effects of anesthesia-induced modest hypothermia on cellular radiation sensitivity

Xuetao Cao, G. Tang, Xiongfei Xu, 2002, Science in China Series C: Life Sciences.

Significant associations between X-ray repair cross-complementing group 3 genetic polymorphisms and thyroid cancer risk

Sheng-li Yan, Yangang Wang, Xiao-long Yu, 2014, Tumor Biology.

Heat‐killed Salmonella typhimurium mitigated radiation‐induced lung injury

C. Yuanyuan, Cao Kun, Yanyong Yang, 2019, Clinical and experimental pharmacology & physiology.

Analysis of miRNA-mRNA Crosstalk in Radiation-Induced Mouse Thymic Lymphomas to Identify miR-486 as a Critical Regulator by Targeting IGF2BP3 mRNA

Yajie Yang, Cong Liu, J. Cai, 2021, Frontiers in Oncology.

Heat-killed salmonella typhimurium (HKST) protects mice against radiation in TLR4-dependent manner

Yang Xu, Jiaming Guo, Yanyong Yang, 2017, Oncotarget.

Long non-coding RNA PANDAR promoted radiation and cisplatin-induced DNA damage repair through ATR/CHK1 in NSCLC.

Hang Wang, Yanyong Yang, J. Cai, 2023, The journal of gene medicine.

Effect of irradiation-induced miR-34a expression on irradiation-sensitivity of cells: Effect of irradiation-induced miR-34a expression on irradiation-sensitivity of cells

J. Cui, Cong Liu, J. Cai, 2011 .

Gamma-ray Irradiation Impairs Dendritic Cell Migration to CCL19 by Down-regulation of CCR7 and Induction of Cell Apoptosis

Yanyong Yang, J. Cui, Cong Liu, 2011, International journal of biological sciences.

Therapeutic Effects of Hydrogen-Rich Solution on Aplastic Anemia in Vivo

L. Qian, Yanyong Yang, Cong Liu, 2013, Cellular Physiology and Biochemistry.

Down regulation of miR-143 promotes radiation - Induced thymic lymphoma by targeting B7H1.

J. Cui, J. Cai, J. Ni, 2017, Toxicology letters.

Protective Effect of CpG-Oligodeoxynucleotides Against Low- and High-LET Irradiation

J. Cai, Bailong Li, J. Ni, 2014, Cellular Physiology and Biochemistry.

[Effects of STAT3 antisense oligonucleotide on proliferation and apoptosis of non-small cell lung cancer cell line A549].

G. Tang, J. Cui, J. Cai, 2007, Ai zheng = Aizheng = Chinese journal of cancer.

Inhibitory effect of STAT3 antisense oligodeoxynucleotide against human adenocarcinoma of lung derived from A549 cell in nude mice: Inhibitory effect of STAT3 antisense oligodeoxynucleotide against human adenocarcinoma of lung derived from A549 cell in nude mice

J. Cui, J. Cai, Bailong Li, 2011 .

MiR-467a is Upregulated in Radiation-Induced Mouse Thymic Lymphomas and Regulates Apoptosis by Targeting Fas and Bax

S. Chen, Cong Liu, J. Cai, 2015, International journal of biological sciences.