B. Ibarra

发表

Screening for inborn errors of the erythrocyte metabolism in Northwestern Mexico.

A. Hernández, G. Vaca, P. Zúñiga, 1982, Acta anthropogenetica.

Types and frequencies of hemoglobin disorders in the pacific coast of four states of Mexico.

B. Ibarra, Jośe G. Cobían, J. Sánchez-López, 2009, Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion.

Molecular spectrum of β-thalassemia in the Mexican population

B. Ibarra, B. López-Guido, Jośe G. Cobían, 2004 .

Phosphoglucomutase: evidence for a new locus expressed in human milk.

J. Cantú, B. Ibarra, 1982, Science.

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

M. T. Magaña-Torres, B. Ibarra, J. Sánchez-López, 2017, International journal of laboratory hematology.

Molecular heterogeneity of β-thalassemia in Mestizo Mexicans

S. Antonarakis, H. Kazazian, B. Ibarra, 1991 .

G-6-PD Guadalajara. A new mutant associated with chronic nonspherocytic hemolytic anemia

J. Cantú, G. Vaca, B. Ibarra, 2004, Human Genetics.

Analysis of linkage disequilibrium between the 5' and 3' haplotypes of the beta-globin gene cluster in Mexican afromestizos.

B. Ibarra, M. Magaña, K. E. Luévano, 2010, Blood cells, molecules & diseases.

Molecular spectrum of beta-thalassemia in the Mexican population.

B. Ibarra, B. López-Guido, Jośe G. Cobían, 2004, Blood Cells, Molecules & Diseases.

Analysis of HLA DQA 1 and DQB 1 alleles and glycated hemoglobin in healthy Mexican mestizo individuals from families with type 1 diabetes mellitus

B. Ibarra, F. J. Perea, F. Rivas, 2003 .

3' haplotypes of the beta-globin gene in beta(S)-chromosomes of Mexican individuals.

B. Ibarra, M. Magaña, F. J. Perea, 2005, Blood cells, molecules & diseases.

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: Frequency and Analysis of the 5' β-Globin Haplotype

B. Ibarra, M. Magaña, F. J. Perea, 2010, Hemoglobin.

Analysis of the SLC4A1 gene in three Mexican patients with hereditary spherocytosis: Report of a novel mutation

B. Ibarra, J. Sánchez-López, F. J. Perea, 2009, Genetics and molecular biology.

HB Fannin-Lubbock-I with A Single GGC>GAC Mutation at β119(GH2)Gly→Asp in a Homozygous Mexican Patient

B. Ibarra, J. Sánchez-López, F. J. Perea, 2009, Hemoglobin.

Analysis of βS and βA Genes in a Mexican Population with African Roots

B. Ibarra, Jośe G. Cobían, M. Magaña, 2002 .

5′ and 3′ β‐globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups

M. T. Magaña-Torres, B. Ibarra, J. Sánchez-López, 2015, American journal of human biology : the official journal of the Human Biology Council.

Centric fission, centromere‐telomere fusion and isochromosome formation: a possible origin of a de novo 12p trisomy

J. Cantú, H. Rivera, G. Vaca, 1987, Clinical genetics.

The phenotype in partial 13q trisomies, apropos of a familial (13;15)(q22;q26) translocation

J. Cantú, H. Rivera, B. Ibarra, 2004, Human Genetics.

Red blood cell sorbitol dehydrogenase deficiency in a family with cataracts

J. Śanchez-Corona, J. Cantú, G. Vaca, 2004, Human Genetics.

Thalidomide therapy in a patient with thalassemia major.

J. L. Delgado-Lamas, B. Rubio-Jurado, B. Ibarra, 2008, Blood cells, molecules & diseases.

Haplotype analysis of the Mexican frameshift Cd 11 (−T) and −28 A→C β‐thalassemia alleles

A. Villalobos-Arámbula, J. Old, B. Ibarra, 1996, American journal of hematology.

Diversity of the 5′ β-Globin Haplotype of Four β-Thalassemia Mutations in the Mexican Population

B. Ibarra, M. Magaña, F. J. Perea, 2009, Hemoglobin.

DIVERSITY OF THE 5 ¢ b-GLOBIN HAPLOTYPE OF FOUR b-THALASSEMIA MUTATIONS IN THE MEXICAN POPULATION β-Thalassemia Haplotypes in Mexico

B. Ibarra, M. Magaña, F. J. Perea, 2009 .

Prevalence of −α3.7 and αααanti3.7 alleles in sickle cell trait and β-thalassemia patients in Mexico

B. Ibarra, M. Magaña, M. Chávez, 2006 .

Hb D-Los Angeles associated with Hb S or beta-thalassemia in four Mexican Mestizo families.

A. Villalobos-Arámbula, R. Hermosillo, B. Ibarra, 1999, Hemoglobin.

HB Chiapas α2 114 PRO+ARG β2: Identification by High Pressure Liquid Chromatography

T. Huisman, J. Cantú, B. Ibarra, 1981 .

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

M. T. Magaña-Torres, J. Torres, B. Ibarra, 2015, Genetics and molecular research : GMR.

Partial mispairing and crossing-over between β0 and δ genes as the origin of the δ β0 thalassemia gene

J. Śanchez-Corona, J. Cantú, G. Vaca, 1979, Human Genetics.

Trisomy 22q12 leads to qter: "aneusomie de recombinaison" of a pericentric inversion.

J. Cantú, H. Rivera, A. Hernández, 1981, Annales de genetique.

Los Angeles variant of galactose-1-phosphate uridyltransferase (EC 2.7.7.12) in a Mexican family

J. Śanchez-Corona, J. Cantú, A. Hernández, 1979, Human Genetics.

De novo partial trisomy of chromosome 18(pter yields q11:). Some observations on the phenotype mapping of chromosome 18 imbalances.

J. Cantú, A. Hernández, B. Ibarra, 1979, Annales de genetique.

Genetic variation of the FMR1 gene among four Mexican populations: Mestizo, Huichol, Purepecha, and Tarahumara

P. Barros-Núñez, M. A. Rosales-Reynoso, B. Ibarra, 2008, American journal of human biology : the official journal of the Human Biology Council.

G-6-PD Jalisco and G-6-PD Morelia: Two new Mexican variants

J. Cantú, G. Vaca, C. Medina, 2004, Human Genetics.

Analysis of HLA DQA1 and DQB1 alleles and glycated hemoglobin in healthy Mexican mestizo individuals from families with type 1 diabetes mellitus

B. Ibarra, F. J. Perea, F. Rivas, 2003 .

Tetrasomy 9p: clinical aspects and enzymatic gene dosage expression.

S. Peregrina, J. Śanchez-Corona, J. Cantú, 1982, Annales de genetique.

Red cell membrane protein deficiencies in Mexican patients with hereditary spherocytosis.

B. Ibarra, J. Sánchez-López, M. Magaña, 2003, Blood cells, molecules & diseases.

Molecular analysis of complex cases of alpha‐ and beta‐thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0‐thalassemia deletions ‐ ‐Mex1 and ‐ ‐Mex2

B. Ibarra, J. Sánchez-López, F. Perea-Díaz, 2016, International journal of laboratory hematology.

A Pilot Genome-Wide Association Study in Postmenopausal Mexican-Mestizo Women Implicates the RMND1/CCDC170 Locus Is Associated with Bone Mineral Density

J. Fernández-López, K. Estrada, S. Romero-Hidalgo, 2017, International journal of genomics.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family.

J. A. Tintos-Hernández, L. Figuera, B. Ibarra, 2012, The West Indian medical journal.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

J. A. Regla-Nava, L. Gonzalez-Lopez, A. Celis, 2013, Genetics and molecular research : GMR.

Genetic diversity of the IL‐4, IL‐4 receptor and IL‐13 loci in mestizos in the general population and in patients with asthma from three subpopulations in Mexico

B. Ibarra, S. F. Martínez, J. S. Corona, 2007, International journal of immunogenetics.

Hb Lepore Washington-Boston in two Mexican mestizo families.

A. Villalobos-Arámbula, G. Ruiz-Argüelles, B. Ibarra, 1997, Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion.

Genetic variation among four Mexican populations (Huichol, Purepecha, Tarahumara, and Mestizo) revealed by two VNTRs and four STRs.

H. Rangel-Villalobos, J. Cantú, L. Figuera, 2000, Human biology.

Molecular characterization of the--SEA alpha thalassemia allele in Mexican patients with HbH disease.

J. Perea, P. Barros-Núñez, B. Ibarra, 2006, Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion.

βA globin gene haplotypes in Mexican Huichols: Genetic relatedness to other populations

A. Villalobos-Arámbula, J. Cantú, B. Ibarra, 2000, American journal of human biology : the official journal of the Human Biology Council.

A Frameshift at Codons 77/78 (–C): A Novel β‐Thalassemia Mutation

B. Ibarra, M. Magaña, F. J. Perea, 2004 .

β-Thalassemia and βA globin gene haplotypes in Mexican mestizos

S. Thein, A. Villalobos-Arámbula, B. Ibarra, 1997, Human Genetics.

[Thalassemic alleles in Mexican mestizos].

A. Villalobos-Arámbula, B. Ibarra, F. J. Perea, 1995, Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion.

Heterozygosity and homozygosity for the high oxygen affinity hemoglobin Tarrant or alpha 126 (H9) Asp replaced by Asn in two Mexican families.

T. Huisman, J. Cantú, G. Vaca, 1981, Hemoglobin.

Abnormal hemoglobins in Northwestern Mexico.

J. Cantú, G. Vaca, L. P. Castro-Félix, 1982, Acta anthropogenetica.

Meiotic arrest at first spermatocyte level: A new inherited infertility disorder

J. Cantú, V. Cortes-gallegos, M. Díaz, 2004, Human Genetics.

Y-linked haplotypes in Amerindian chromosomes from Mexican populations: genetic evidence to the dual origin of the Huichol tribe.

H. Rangel-Villalobos, L. Sandoval-Ramírez, J. Muñóz-Valle, 2006, Legal medicine.