Tomonori Aoyama

发表

Role of apoptosis in acetaminophen hepatotoxicity

Y. Takei, N. Sato, K. Ikejima, 2007, Journal of gastroenterology and hepatology.

Sodium 4-phenylbutyric acid prevents murine acetaminophen hepatotoxicity by minimizing endoplasmic reticulum stress

K. Ikejima, Sumio Watanabe, S. Yamashina, 2017, Journal of Gastroenterology.

Use of hydroxy‐methyl‐glutaryl coenzyme A reductase inhibitors is associated with risk of lymphoid malignancies

K. Matsuo, Y. Kanda, M. Kami, 2006, Cancer science.

Limitations of a meta-analysis investigating the association between cancer and statin use.

M. Kami, H. Iwata, Tomonori Aoyama, 2002, The American journal of medicine.

Altered expression and function of hepatic natural killer T cells in obese and diabetic KK‐Ay mice

K. Ikejima, Sumio Watanabe, K. Takeda, 2013, Hepatology research : the official journal of the Japan Society of Hepatology.

Pioglitazone promotes survival and prevents hepatic regeneration failure after partial hepatectomy in obese and diabetic KK‐Ay mice

K. Ikejima, Sumio Watanabe, K. Okumura, 2009, Hepatology.

Effects of pravastatin in the elderly.

M. Kami, H. Iwata, Tomonori Aoyama, 2002, Annals of internal medicine.

Synthetic triglyceride containing an arachidonic acid branch (8A8) prevents lipopolysaccharide-induced liver injury.

Y. Takei, N. Sato, K. Ikejima, 2009, Life sciences.

L‐carnitine prevents metabolic steatohepatitis in obese diabetic KK‐Ay mice

K. Ikejima, Sumio Watanabe, S. Yamashina, 2017, Hepatology research : the official journal of the Japan Society of Hepatology.

The Chemical Chaperone 4‐Phenylbutyric Acid Prevents Alcohol‐Induced Liver Injury in Obese KK‐Ay Mice

K. Ikejima, Sumio Watanabe, T. Ueno, 2019, Alcoholism, clinical and experimental research.

Ursolic acid ameliorates hepatic fibrosis in the rat by specific induction of apoptosis in hepatic stellate cells.

N. Sato, K. Ikejima, Sumio Watanabe, 2011, Journal of hepatology.

Innate immune responses involving natural killer and natural killer T cells promote liver regeneration after partial hepatectomy in mice.

K. Ikejima, Sumio Watanabe, K. Takeda, 2013, American journal of physiology. Gastrointestinal and liver physiology.

Formation of p62‐positive inclusion body is associated with macrophage polarization in non‐alcoholic fatty liver disease

K. Ikejima, Sumio Watanabe, A. Arakawa, 2018, Hepatology research : the official journal of the Japan Society of Hepatology.

Abnormality of autophagic function and cathepsin expression in the liver from patients with non‐alcoholic fatty liver disease

K. Ikejima, Sumio Watanabe, A. Arakawa, 2014, Hepatology research : the official journal of the Japan Society of Hepatology.

A Customized Online Nutrition Guidance System Is Effective for Treating Patients with Nonalcoholic Fatty Liver Disease by Supporting Continuity of Diet Therapy at Home: A Pilot Study

K. Ikejima, Sumio Watanabe, S. Yamashina, 2017, Internal medicine.

CD1d-restricted natural killer T cells contribute to hepatic inflammation and fibrogenesis in mice.

K. Ikejima, Sumio Watanabe, K. Takeda, 2011, Journal of hepatology.

Interleukin-17 signaling in inflammatory, Kupffer cells, and hepatic stellate cells exacerbates liver fibrosis in mice.

K. Iwaisako, D. Brenner, K. Ley, 2012, Gastroenterology.

Recurrent severe acute hepatitis caused by hypereosinophilic syndrome associated with elevated serum immunoglobulin G4 levels

K. Ikejima, Sumio Watanabe, T. Yao, 2014, Clinical Journal of Gastroenterology.

Diabetic KK-A(y) mice are highly susceptible to oxidative hepatocellular damage induced by acetaminophen.

K. Ikejima, Sumio Watanabe, K. Okumura, 2010, American journal of physiology. Gastrointestinal and liver physiology.

Nicotinamide adenine dinucleotide phosphate oxidase in experimental liver fibrosis: GKT137831 as a novel potential therapeutic agent

D. Brenner, Y. Paik, Sumio Watanabe, 2012, Hepatology.

Disruption of TAK1 in hepatocytes causes hepatic injury, inflammation, fibrosis, and carcinogenesis

S. Akira, D. Brenner, Kouichi Miura, 2009, Proceedings of the National Academy of Sciences.

Role of NADPH oxidases in liver fibrosis.

D. Brenner, R. Bataller, Y. Paik, 2014, Antioxidants & redox signaling.

CX3CL1‐CX3CR1 interaction prevents carbon tetrachloride‐induced liver inflammation and fibrosis in mice

D. Brenner, E. Seki, Tomonori Aoyama, 2010, Hepatology.

Toll-like receptor 9 promotes steatohepatitis by induction of interleukin-1beta in mice.

D. Brenner, J. Olefsky, Kouichi Miura, 2010, Gastroenterology.

Mutation of the 5′-Untranslated Region Stem-Loop Structure Inhibits α1(I) Collagen Expression in Vivo*

Christopher J. Parsons, D. Brenner, B. Stefanovic, 2010, The Journal of Biological Chemistry.

Hemorrhagic polyps formed like fundic gland polyps during long-term proton pump inhibitor administration

Sumio Watanabe, T. Osada, A. Nagahara, 2017, Clinical Journal of Gastroenterology.

Toll-Like Receptor Signaling and Liver Fibrosis

Y. Paik, E. Seki, Tomonori Aoyama, 2010, Gastroenterology research and practice.

IL-17 signaling in inflammatory cells , Kupffer cells and Hepatic Stellate cells exacerbates liver fibrosis

K. Iwaisako, D. Brenner, K. Ley, 2013 .

Incidence and risk factors of hepatitis B virus reactivation in patients with multiple myeloma in an era with novel agents: a nationwide retrospective study in Japan

N. Komatsu, T. Odajima, H. Sugimori, 2017, Blood Cancer Journal.

Reactivation of hepatitis B virus during treatment with hydroxyurea in an elderly patient with essential thrombocythemia

A. Gotoh, N. Komatsu, Masaru Tanaka, 2015, Geriatrics & gerontology international.

Death receptor 5 mediated-apoptosis contributes to cholestatic liver disease

Y. Nakanuma, K. Harada, M. Smyth, 2008, Proceedings of the National Academy of Sciences.

Additional Effects of Polyglycerol Esters on Oil Phase Crystallization in Oil-in-Water Emulsions

Kiyotaka Sato, S. Ueno, Tomonori Aoyama, 2000 .

Liver function test by gadolinium-ethoxybenzyl-diethylenetriamine pentaacetic acid-enhanced magnetic resonance imaging with consideration of intrahepatic regional differences.

Y. Igusa, Sumio Watanabe, Y. Ozaki, 2013, Hepato-gastroenterology.

Incidence and risk factors of hepatitis B virus reactivation in patients with multiple myeloma in an era with novel agents: a nationwide retrospective study in Japan

N. Komatsu, T. Odajima, H. Sugimori, 2017, Blood Cancer Journal.

Spleen-derived lipocalin-2 in the portal vein regulates Kupffer cells activation and attenuates the development of liver fibrosis in mice.

K. Ikejima, Sumio Watanabe, A. Miyazaki, 2017, Laboratory investigation; a journal of technical methods and pathology.

Spleen-derived lipocalin-2 in the portal vein regulates Kupffer cells activation and attenuates the development of liver fibrosis in mice.

K. Ikejima, Sumio Watanabe, A. Miyazaki, 2017, Laboratory investigation; a journal of technical methods and pathology.

CTCTGCAGCTCAGCC ATGGCTGCTTCTGCTGCT TCCTCAGAGACATCC ATCTGGTCCTACACGAAGCC TTCCCAGATCACAGA TCCAGAAGGCCCTCAGACTA GCAGCCTGAGTGTCT AATTCCAGAACCGCTCCAGT AGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA AAAGGTTTGGAAGCAG TGTGAAATGCCACCTTTTGA CAGGTCCTTCCTAAA GGAGAGCCCTGGATACCAAC TCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTAC

K. Iwaisako, D. Brenner, K. Ley, 2012 .

938 ACETAMINOPHEN INDUCES SEVERE LIVER INJURY CAUSED BY INCREASED SUSCEPTIBILITY TO OXIDATIVE STRESS IN OBESE KK-AY MICE

K. Ikejima, Sumio Watanabe, S. Yamashina, 2008 .