C. Croce

H. Koprowski, J. Césarini, C. Croce, 1973, Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine.

Production of antibodies against influenza virus by somatic cell hybrids between mouse myeloma and primed spleen cells.

W. Gerhard, H. Koprowski, C. Croce, 1977, Proceedings of the National Academy of Sciences of the United States of America.

A novel surface marker (B203.13) of human haemopoietic progenitors, preferentially expressed along the B and myeloid lineages

B. Perussia, L. Zamai, C. Croce, 1998, British journal of haematology.

A human hybrid myeloma for production of human monoclonal antibodies.

J. Roder, D. Kozbor, P. Tripputi, 1984, Journal of immunology.

Somatic cell hybrids between mouse peritoneal macrophages and SV40-transformed human cells. III. Identification of surface antigens coded for by human chromosomes 7 and 17.

C. Croce, L. Cicurel, 1977, Journal of immunology.

The Murine F hit Locus: Isolation, Characterization, and Expression in Normal and Tumor Cells1

Y. Pekarsky, K. Huebner, J. Shou, 2006 .

Loss of mouse chromosomes in somatic cell hybrids between HT-1080 human fibrosarcoma cells and mouse peritioneal macrophages.

C. Croce, 1976, Proceedings of the National Academy of Sciences of the United States of America.

Molecular analysis of a t(7;14)(g35;g32) chromosome translocation in a T cell leukemia of a patient with ataxia telangiectasia

P. Nowell, M. Isobe, G. Russo, 1988, Cell.

Assignment of a gene for uridine diphosphate galactose-4-epimerase to human chromosome 1 by somatic cell hybridization, with evidence for a regional assignment to 1pter yields 1p21.

T. Shows, C. Croce, P. Benn, 1979, Cytogenetics and cell genetics.

The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene

H. Alder, T. Nakamura, E. Canaani, 1992, Cell.

Tp44 molecules involved in antigen-independent T cell activation are expressed on human plasma cells.

L. Moretta, D. Kozbor, A. Moretta, 1987, Journal of immunology.

The Use of Mouse-Human and Human-Human Hybridomas in Human Genetics and Immunology

H. Koprowski, A. Linnenbach, C. Croce, 1982 .

Induction of homokaryocyte, heterokaryocyte and hybrid formation by lysolecithin.

H. Koprowski, W. Sawicki, D. Kritchevsky, 1971, Experimental cell research.

Involvement of the ALLI gene in a solid tumor ( chromosomal translocations / self-fusion )

M. Negrini, R. Baffa, K. Huebner, 2005 .

Cloning and characterization of the human PIM‐1 gene: A putative oncogene related to the protein kinases

T. Meeker, C. Croce, A. Ar-rushdi, 1987, Journal of cellular biochemistry.

Antibody response to simian virus 40 tumor antigen in nude mice reconstituted with T cells.

C. Croce, L. Cicurel, 1977, Journal of immunology.

Assignment of the human gene for hexose-1-phosphate uridylyltransferase to chromosome 3.

R. Diamond, C. Croce, T. Tedesco, 1974, Proceedings of the National Academy of Sciences of the United States of America.

Chromosomal approaches to oncogenes and oncogenesis 1

P. Nowell, C. Croce, 1988, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Human hybridomas secreting anti-islet autoantibodies

R. Scearce, G. Eisenbarth, R. Jackson, 1982, Nature.

Selective suppression of the transcription of ribosomal genes in mouse‐human hybrid cells

K. Huebner, U. Schibler, R. Perry, 1979, Journal of cellular physiology.

Genetics of type II glycogenosis: assignment of the human gene for acid alpha-glucosidase to chromosome 17.

J. Wurm, C. Croce, G. D’Ancona, 1979, Proceedings of the National Academy of Sciences of the United States of America.

Genetics of B-cell neoplasia

C. Croce, 1985, European Journal of Epidemiology.

HUMAN IMMUNOGLOBULIN EXPRESSION IN HYBRID CELLS

C. Croce, 1982 .

Inhibition of SV40-induced cellular DNA synthesis by microinjection of monoclonal antibodies.

W. Mercer, R. Baserga, D. Nelson, 1983, Virology.

Somatic cell hybrids producing antibodies specific for the tumor antigen of simian virus 40.

C. Croce, J. Martinis, 1978, Proceedings of the National Academy of Sciences of the United States of America.

Regulation of the Expression of SV40 T Antigen in Stem Versus Differentiated Cells

K. Huebner, A. Linnenbach, C. Croce, 1980 .

The gene encoding the T4 antigen maps to human chromosome 12.

P. Nowell, D. Kozbor, J. Finan, 1986, Journal of immunology.

Introduction of macromolecules into viable mammalian cells : a Wistar symposium workshop held at Sugarloaf Center in Philadelphia, Pennsylvania, May 2-4, 1979

R. Baserga, G. Rovera, C. Croce, 1980 .

Tumorigenicity of simian virus 40-transformed human cells and mouse--human hybrids in nude mice.

H. Koprowski, C. Croce, 1977, Proceedings of the National Academy of Sciences of the United States of America.

Mechanisms of chromosome translocation in B- and T-cell neoplasia

F. Haluska, Y. Tsujimoto, C. Croce, 1987 .

More clues to gene rearrangements

F. Haluska, C. Croce, FRANK G. HALUSKA, 1987, Nature.

The Genetics of Human Cancer

H. Koprowski, C. Croce, 1978 .

Suppression of production of mouse 28S ribosomal RNA in mouse-human hybrids segregating mouse chromosomes.

O. Miller, C. Basilico, C. Croce, 1977, Proceedings of the National Academy of Sciences of the United States of America.

The role of large T antigen in simian virus 40-induced reactivation of silent rRNA genes in human-mouse hybrid cells.

R. Baserga, M. Rossini, K. Soprano, 1980, Virology.

Positive Control of Transformed Phenotype in Hybrids between SV40-Transformed and Normal Human Cells

H. Koprowski, C. Croce, Hilary Koprowski, 1974, Science.

Reversion in expression of hypoxanthine-guanine phosphoribosyl transferase following cell hybridization.

W. Nyhan, H. Koprowski, C. Croce, 1975, Journal of cell science.

Reexpression of the rat hypoxanthine phosphoribosyltransferase gene in rat-human hybrids.

W. Nyhan, H. Koprowski, C. Croce, 1973, Proceedings of the National Academy of Sciences of the United States of America.

Restoration of hypoxanthine phosphoribosyl transferase activity in mouse 1R cells after fusion with chick-embryo fibroblasts.

W. Nyhan, H. Koprowski, C. Croce, 1973, Proceedings of the National Academy of Sciences of the United States of America.

Molecular cloning of a new transforming gene from a chemically transformed human cell line

C. Cooper, K. Huebner, M. Tainsky, 1984, Nature.

SOMATIC CELL HYBRIDS BETWEEN MOUSE PERITONEAL MACROPHAGES AND SV40-TRANSFORMED HUMAN CELLS

H. Koprowski, C. Croce, 1974, The Journal of experimental medicine.

Assignment of the T-antigen gene of simian virus 40 to human chromosome C-7.

H. Koprowski, A. Girardi, C. Croce, 1973, Proceedings of the National Academy of Sciences of the United States of America.

Repertoire of antiviral antibodies expressed by somatic cell hybrids.

W. Gerhard, H. Koprowski, C. Croce, 1978, Proceedings of the National Academy of Sciences of the United States of America.

Selective induction of murine oncornavirus gene expression in somatic cell hybrids between mouse peritoneal macrophages and SV-40-transformed human cells.

J. August, M. Strand, C. Croce, 1976, Virology.

CHAPTER 2 – Genetic Approaches to Enzyme Induction in Mammalian Cells and Hybrids in Culture

G. Litwack, C. Croce, 1975 .

Regulation of the corticosteroid inducibility of tyrosine aminotransferase in interspecific hybrid cells

H. Koprowski, G. Litwack, C. Croce, 1974, Nature.

Expression of malignancy in hybrids between normal and malignant cells

H. Koprowski, A. Linnenbach, C. Croce, 1979, Journal of cellular physiology.

Expression of human and suppression of mouse nucleolus organizer activity in mouse-human somatic cell hybrids.

D. Miller, O. Miller, V. G. Dev, 1976, Proceedings of the National Academy of Sciences of the United States of America.

Human tumor and rodent-human hybrid cells with an increased number of active human NORs.

D. Miller, O. Miller, V. G. Dev, 1978, Cytogenetics and cell genetics.

Expression of mouse and human fibronectin in mouse--human somatic cell hybrids.

L. Zardi, B. Carnemolla, C. Croce, 1979, Experimental cell research.

Chromosomal location of the genes for human immunoglobulin heavy chains.

H. Koprowski, C. Croce, L. Cicurel, 1979, Proceedings of the National Academy of Sciences of the United States of America.

Viral-DNA Vectors in the Analysis of Mammalian Differentiation

A. Linnenbach, C. Croce, 1982 .

Chromosomal proteins of mouse teratocarcinoma cells

K. Huebner, C. Croce, K. Tan, 1982, Journal of cellular physiology. Supplement.

Location of rRNA genes in three inbred strains of rat and suppression of rat rRNA activity in rat-human somatic cell hybrids.

D. Miller, O. Miller, R. Tantravahi, 1979, Experimental cell research.

Assignment of the integration site for simian virus 40 to chromosome 17 in GM54VA, a human cell line transformed by simian virus 40.

C. Croce, 1977, Proceedings of the National Academy of Sciences of the United States of America.

Assignment of gene(s) for cell transformation to human chromosome 7 carrying the simian virus 40 genome.

H. Koprowski, C. Croce, 1975, Proceedings of the National Academy of Sciences of the United States of America.

Specific immunoglobulin production and enhanced tumorigenicity following ascites growth of human hybridomas.

J. Roder, S. Cole, D. Kozbor, 1985, Journal of immunological methods.

Production of human hybridomas secreting antibodies to measles virus

H. Koprowski, Z. Steplewski, A. Linnenbach, 1980, Nature.

Anti-viral and anti-tumor antibodies produced by somatic cell hybrids.

W. Gerhard, H. Koprowski, C. Croce, 1978, Current topics in microbiology and immunology.

Loss of Hmga1 gene function affects embryonic stem cell lymphohematopoietic differentiation

A. Fusco, G. Baldassarre, F. Pentimalli, 2003, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

The t(8; 14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V–D–J joining

F. Haluska, Y. Tsujimoto, S. Finver, 1986, Nature.

Assignment of the genes for human λ immunoglobulin chains to chromosome 22

J. Erikson, C. Croce, J. Martinis, 1981, Nature.

Characterization of the human TESTIN gene localized in the FRA7G region at 7q31.2.

K. Mimori, A. Linnenbach, C. Tatarelli, 2000, Genomics.

Assignment of the gene for cytoplasmic glutamic-oxaloacetic transaminase to the region q24-qter of human chromosome 10

C. Croce, W. Mellman, C. J. Chern, 1976, Somatic cell genetics.

Expression of fhit protein during mouse development

C. Croce, K. Huebner, T. Dragani, 2000, The Anatomical record.

Presence of two active X chromosomes in hybrids between normal human and SV40-transformed fibroblasts from patients with the Lesch-Nyhan syndrome.

C. Croce, B. Bakay, 1974, Experimental cell research.

Chimeric mice derived from human-mouse hybrid cells.

K. Illmensee, P. Hoppe, C. Croce, 1978, Proceedings of the National Academy of Sciences of the United States of America.

Standardized karyotype of deer mice, Peromyscus (Rodentia)

T. Shows, F. Arrighi, G. Donnell, 1977 .

A major human histone gene cluster on the long arm of chromosome 1.

G. Stein, B. Emanuel, J. Stein, 1984, Science.

Enucleation of cells made simple and rescue of SV40 by enucleated cells made even simpler.

H. Koprowski, C. Croce, 1973, Virology.

Unidirectional loss of human chromosomes in rat-human hybrids.

I. Kieba, H. Koprowski, C. Croce, 1973, Experimental cell research.

Molecular analysis of mbcl-2: Structure and expression of the murine gene homologous to the human gene involved in follicular lymphoma

M. Negrini, C. Kozak, Y. Tsujimoto, 1987, Cell.

Molecular Mechanisms of Chromosome Translocation in Human B‐ and T‐cell Neoplasia a

C. Croce, F. Haluska, C. Croce, 1987, Annals of the New York Academy of Sciences.

Germ-line chromosomal localization of humanc-erb-A oncogene

C. Croce, S. Jhanwar, C. Croce, 1985, Somatic cell and molecular genetics.

Integration of oncogenic viruses in mammalian cells.

C. Croce, Carlo M. Croce, 1981, International review of cytology.

Mapping the SV40 Integration Sites in SV40-Transformed Human Cells

C. Croce, 1977 .

Segregation of rat chromosomes in somatic cell hybrids between rat cells and HT 1080 human fibrosarcoma cells

C. Croce, G. D’Ancona, 2004, Human Genetics.

Production of Interspecies Hybridomas Between CSF or Blood Lymphocytes from Patients with Neurological Diseases and Mouse Myeloma Cells

H. Koprowski, C. Croce, M. Sandberg‐wollheim, 1980 .

Expression of late viral functions in SV40-infected rat-monkey somatic cell hybrids

C. Croce, K. Huebner, A. Linnenbach, 1979, Somatic cell genetics.

Studies on the association of the Epstein‐Barr virus genome and human chromosomes

B. Hampar, C. Croce, M. Nonoyama, 1978, Journal of cellular physiology.

The Epstein-Barr Virus-Hybridoma Technique for Production of Human Monoclonal Antibodies

J. Roder, R. Burioni, D. Kozbor, 1988 .

Oral Contraceptive-induced Expression of Prostate-specific Antigen in the Female Breast (*)

E. Diamandis, M. Monne, He Yu, 1995, The Journal of Biological Chemistry.

Human T cell hybridomas with tetanus-toxoid-specific helper activity.

E. Defreitas, H. Koprowski, A. Linnenbach, 1982, Current topics in microbiology and immunology.

Lactic dehydrogenase virus replicates in somatic cell hybrids of mouse peritoneal macrophages and SV40-transformed human fibroblasts.

S. Schlesinger, C. Stewart, C. Croce, 1976, Virology.

Expression of the teratocarcinoma phenotype in hybrids between totipotent mouse teratocarcinoma and myeloma cells

C. Croce, Alessandro Correani, 1980, Journal of cellular physiology.

Species‐specific monoclonal antibodies in the assignment of the gene for human fibronectin to chromosome 2.

L. Zardi, B. Carnemolla, E. Balza, 1982, The EMBO journal.

Human TCR-gamma+/delta+, CD8+ T lymphocytes recognize tetanus toxoid in an MHC-restricted fashion

M. Isobe, G. Russo, D. Monos, 1989, The Journal of experimental medicine.

Tumorigenicity of mouse-human diploid hybrids in nude mice

H. Koprowski, C. Croce, C. Aden, 1975, Science.

Tissue-type plasminogen activator gene is on chromosome 8.

B. Emanuel, F. Blasi, T. Ny, 1986, Cytogenetics and cell genetics.

Characterization of human bone marrow‐derived closed circular DNA clones

C. Croce, K. Huebner, J. Lasota, 1993, Genes, chromosomes & cancer.

Linkage relationship between the genes for thymidine kinase and galactokinase in different primates

C. Croce, T. Tedesco, W. Mellman, 1976, Somatic cell genetics.

Assignment of the human gene for hexosaminidase B to chromosome 5.

C. Croce, T. Tedesco, W. Mellman, 1975, Experimental cell research.

Assignment of the structural genes for the α subunit of hexosaminidase A, mannosephosphate isomerase, and pyruvate kinase to the region q22-qter of human chromosome 15

R. Kennett, C. Croce, W. Mellman, 1977, Somatic cell genetics.

Xenogeneic gene expression in chimeric mice derived from rat--mouse hybrid cells.

K. Illmensee, C. Croce, 1979, Proceedings of the National Academy of Sciences of the United States of America.

Protein synthesis in hybrid cells derived from fetal rat x mouse chimeric organs.

D. Duboule, K. Illmensee, C. Croce, 1982, Differentiation; research in biological diversity.

Antigen-specific human T-cell hybridomas with helper activity.

E. Defreitas, H. Koprowski, A. Linnenbach, 1982, Proceedings of the National Academy of Sciences of the United States of America.

Molecular cloning of a human immunoglobulin λ chain variable sequence

Y. Tsujimoto, C. Croce, 1984 .

Rescue of defective SV40 from mouse-human hybrid cells containing human chromosome 7.

K. Huebner, H. Koprowski, A. Girardi, 1974, Virology.

Localization of the human HF.10 finger gene on a chromosome region (3p21–22) frequently deleted in human cancers

K. Huebner, P. Pelicci, L. Lania, 1990, Human Genetics.

Restoration of the conversion of desmosterol to cholesterol in L-cells after hybridization with human fibroblasts.

I. Kieba, H. Koprowski, G. Rothblat, 1974, Proceedings of the National Academy of Sciences of the United States of America.

Confirmation of the synteny of the human genes for mannose phosphate isomerase and pyruvate kinase and of their assignment to chromosome 15.

C. Croce, C. J. Chern, 1975, Cytogenetics and cell genetics.

Reactivation of silent rRNA genes by simian virus 40 in human-mouse hybrid cells.

R. Baserga, K. Soprano, C. Croce, 1979, Proceedings of the National Academy of Sciences of the United States of America.

Assignment of the human gene for enolase 1 to region pter in equilibrium p36 of chromosome 1.

C. Croce, P. Benn, C. J. Chern, 1977, Cytogenetics and Cell Genetics.

Preferential retention of the human chromosome C-7 in human-(thymidine kinase deficient) mouse hybrid cells.

H. Koprowski, B. Knowles, C. Croce, 1973, Experimental cell research.

Papillomavirus sequences integrate near cellular oncogenes in some cervical carcinomas.

C. Croce, K. Huebner, L. Gissmann, 1987, Proceedings of the National Academy of Sciences of the United States of America.

Cloning of the gene encoding the delta subunit of the human T-cell receptor reveals its physical organization within the alpha-subunit locus and its involvement in chromosome translocations in T-cell malignancy.

M. Isobe, G. Russo, C. Croce, 1988, Proceedings of the National Academy of Sciences of the United States of America.

Quantitation of the viral DNA present in somatic cell hybrids between mouse and SV40-transformed human cells

G. Khoury, C. Croce, 1975, Cell.

Gene for alpha-chain of human T-cell receptor: location on chromosome 14 region involved in T-cell neoplasms.

A. Palumbo, M. Isobe, C. Croce, 1985, Science.

Species-specific suppression of histone H1 and H2B production in human/mouse hybrids.

T. Borun, C. Croce, K. Ajiro, 1978, Proceedings of the National Academy of Sciences of the United States of America.

Chromosomal localization of the human osteocalcin gene.

G. Stein, J. Lian, C. Croce, 1989, Endocrinology.

Oncogene activation by chromosome translocation in human malignancy.

F. Haluska, Y. Tsujimoto, C. Croce, 1987, Annual review of genetics.

Molecular genetics of human B-cell neoplasia.

Y. Tsujimoto, C. Croce, C. Croce, 1986, Current topics in microbiology and immunology.

Molecular basis of human B cell neoplasia.

P. Nowell, C. Croce, C. Croce, 1985, Blood.

Evolution of B-cell malignancy: pre-B-cell leukemia resulting from MYC activation in a B-cell neoplasm with a rearranged BCL2 gene.

P. Nowell, F. Haluska, Y. Tsujimoto, 1988, Proceedings of the National Academy of Sciences of the United States of America.

Clustering of breakpoints on chromosome 11 in human B-cell neoplasms with the t(11 ; 14) chromosome translocation

P. Nowell, E. Jaffe, Y. Tsujimoto, 1985, Nature.

Localization of gene for human p53 tumour antigen to band 17p13

M. Isobe, C. Croce, D. Givol, 1986, Nature.

Overexpressed full-length human BCL2 extends the survival of baculovirus-infected Sf9 insect cells.

E. Alnemri, C. Croce, N. Robertson, 1992, Proceedings of the National Academy of Sciences of the United States of America.

Cancer genes in cell hybrids.

C. Croce, C. Croce, 1980, Biochimica et biophysica acta.

Molecular cloning and characterization of an antigen associated with early stages of melanoma tumor progression.

M. Isobe, C. Croce, K. Huebner, 1988, Cancer research.

Characterization of the human PIM-1 gene: a putative proto-oncogene coding for a tissue specific member of the protein kinase family.

C. Croce, K. Huebner, G. Rovera, 1987, Oncogene research.

Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia.

M. Caligiuri, C. Bloomfield, C. Croce, 2000, Proceedings of the National Academy of Sciences of the United States of America.

Identification of the TCL1 gene involved in T-cell malignancies.

M. Isobe, G. Russo, C. Croce, 1994, Proceedings of the National Academy of Sciences of the United States of America.

A novel IL‐1 receptor, cloned from B cells by mammalian expression, is expressed in many cell types.

K. Huebner, N. Jenkins, D. Benjamin, 1991, The EMBO journal.

Role of the high mobility group A proteins in human lipomas.

C. Croce, A. Fusco, G. Manfioletti, 2001, Carcinogenesis.

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22.

J. Wang, C. Croce, J. Whang‐Peng, 1988, Proceedings of the National Academy of Sciences of the United States of America.

Cloning of three human tyrosine phosphatases reveals a multigene family of receptor-linked protein-tyrosine-phosphatases expressed in brain.

C. Croce, K. Huebner, M. Jaye, 1990, Proceedings of the National Academy of Sciences of the United States of America.

Self-fusion of the ALL1 gene. A new genetic mechanism for acute leukemia.

C. Croce, E. Canaani, S. Schichman, 1995, JAMA.

Positions of chromosome 3p14.2 fragile sites (FRA3B) within the FHIT gene.

C. Croce, K. Huebner, D. Zimonjic, 1997, Cancer research.

Heterogeneity of chromosome 22 breakpoint in Philadelphia-positive (Ph+) acute lymphocytic leukemia.

P. Nowell, J. Hoxie, C. Croce, 1986, Proceedings of the National Academy of Sciences of the United States of America.

Lineage-specific gene rearrangement/deletion: a nonconservative model.

P. Nowell, C. Croce, K. Huebner, 1989, Cancer research.

Chromosomal mapping of human keratin genes: evidence of non-linkage.

M. Isobe, C. Croce, K. Huebner, 1988, The Journal of investigative dermatology.

Variant translocation of the bcl-2 gene to immunoglobulin lambda light chain gene in chronic lymphocytic leukemia.

D. Longo, Y. Tsujimoto, J. Cossman, 1989, Proceedings of the National Academy of Sciences of the United States of America.

Translocation of an immunoglobulin kappa locus to a region 3' of an unrearranged c-myc oncogene enhances c-myc transcription.

P. Nowell, C. Croce, B. Emanuel, 1983, Proceedings of the National Academy of Sciences of the United States of America.

Characterization of the protein product of bcl-2, the gene involved in human follicular lymphoma.

Y. Tsujimoto, N. Ikegaki, C. Croce, 1987, Oncogene.

Chromosome walking on the TCL1 locus involved in T-cell neoplasia.

M. Isobe, G. Russo, C. Croce, 1993, Proceedings of the National Academy of Sciences of the United States of America.

The FHIT gene, a multiple tumor suppressor gene encompassing the carcinogen sensitive chromosome fragile site, FRA3B.

C. Croce, K. Huebner, Z. Siprashvili, 1997, Biochimica et biophysica acta.

Inactivation of Bcl-2 by phosphorylation.

C. Croce, S. Haldar, N. Jena, 1995, Proceedings of the National Academy of Sciences of the United States of America.

Assignment of the genes for human lambda immunoglobulin chains to chromosome 22.

J. Erikson, C. Croce, J. Martinis, 1981, Nature.

Alternative splicing, genomic structure, and fine chromosome localization of REV3L

M. Negrini, A. Mungall, C. Morelli, 1999, Cytogenetic and Genome Research.

Mapping of four distinct BCR-related loci to chromosome region 22q11: order of BCR loci relative to chronic myelogenous leukemia and acute lymphoblastic leukemia breakpoints.

M. Isobe, C. Croce, K. Huebner, 1987, Proceedings of the National Academy of Sciences of the United States of America.

Selective enrichment in human megakaryocyte progenitors by the B203.13 surface differentiation antigen

R. Rezzani, M. Vitale, G. Zauli, 1997, British journal of haematology.

Suppression of replication of SV40 and polyoma virus in mouse-human hybrids

K. Huebner, Kay Huebner, Monica Shander, 1977, Cell.

The AKT1 proto-oncogene maps to human chromosome 14, band q32.

C. Croce, K. Huebner, J. Testa, 1988, Genomics.

TGAAATGCAGTGGTCGTTACGC TCCACC AAGAAAGCAGGAACC TGTGGTATGAA CAAATCAA CTTATGTGT TGACC TTTAGAGAGTTGC TTACGTGGCC TGTTCAACACAGACCCACCC AGAGCCC TCC TGCCC TCC TTCCGCGGGGGC T TTC TC AGGC TGTCC TTC AGGGTC TTCCTGAAATGC AGTGG TCGTT CGC ACCAAGAAAGCAGGAAC TGGTATGAA CGAATCAACTTATGTGTTGAC TTAGAGAG TGCTTAC TGGCCTGTT

F. Haluska, Y. Tsujimoto, C. Croce, 2022 .

Cloning and expression of the human substance K receptor and analysis of its role in mitogenesis.

A. Saltzman, C. Croce, K. Huebner, 1991, Cell growth & differentiation : the molecular biology journal of the American Association for Cancer Research.

Southern Blot Analysis of All-1 Rearrangements at Chromosome Ilq23 in Acute Leukemia Materials and Methods

C. Croce, F. Mandelli, F. Lo Coco, 2022 .

Imperfect complementation in human-hamster somatic cell hybrids

C. Basilico, C. Croce, A. Talavera, 1976, Nature.

Lysolecithin-induced Fusion of Rabbit Spermatozoa with Hamster Somatic Cells

H. Koprowski, W. Sawicki, C. Croce, 1972 .

Chapter 10 Enucleation of Somatic Cells with Cytochalasin B

H. Koprowski, N. Tomassini, C. Croce, 1974 .