Kai Yuan

发表

Effects of Cotton Seed Powder as the Seed Medium Nitrogen Source on the Morphology and Pneumocandin B0 Yield of Glarea lozoyensis

Xiao-Jun Ji, He Huang, Lu-jing Ren, 2018, Front. Microbiol..

Identification and functional characterization of an endoplasmic reticulum oxidoreductin 1-α gene in Litopenaeus vannamei.

S. Weng, Jianguo He, Kai Yuan, 2016, Developmental and comparative immunology.

Litopenaeus vannamei activating transcription factor 6 alpha gene involvement in ER‐stress response and white spot symptom virus infection

S. Weng, Jianguo He, Kai Yuan, 2017, Fish & shellfish immunology.

Identification and characterization of a mitochondrial unfolded protein response transcription factor ATFS-1 in Litopenaeus vannamei.

S. Weng, Jianguo He, Yong-gui Chen, 2016, Fish & shellfish immunology.

Heat shock 70 kDa protein cognate 5 involved in WSSV toleration of Litopenaeus vannamei

S. Weng, Jianguo He, Kai Yuan, 2017, Developmental and comparative immunology.

Effect of Astragalus membranaceus (Fisch) Bunge extract on streptozocin-induced diabetic in rats

Guiqing Li, Hua Li, Kai Yuan, 2016 .

Identification and functional characterization of a novel Spätzle gene in Litopenaeus vannamei

S. Weng, Jianguo He, Kai Yuan, 2017, Developmental and comparative immunology.

TGAAGATGGTCGAGGGGTAAGCCG GGCATCAGACCCATCACCCAGAA TACC TTGAAGCCGAAACACAGAGCCA ATCT TACTGTGTTCATTGTGTCATTGG ACGAGTCCGAGTTCAT AGGTTGACGAGGAACA TTGCGCCGTACTCAT GGTCTGTCCGTTCTT ACGGAATTCCCTCCT TGCAACGCATAGACC ACTCTCCTTACGATG CAGACAGGTCTCCAA CCACCTGACTGTACC TACTGACGAGGCAAT CTGGAGGAGGAAACT AGACACTTGGACTCG

S. Weng, Jianguo He, Kai Yuan, 2016 .

Functional characterization of a reactive oxygen species modulator 1 gene in Litopenaeus vannamei

S. Weng, Jianguo He, Kai Yuan, 2017, Fish & shellfish immunology.

Effect of SDS on release of intracellular pneumocandin B0 in extractive batch fermentation of Glarea lozoyensis

Xiao-Jun Ji, He Huang, Lu-jing Ren, 2019, Applied Microbiology and Biotechnology.

Functional characterization of an ER-stress responding Crustin gene in Litopenaeus vannamei.

Jianguo He, G. Yue, Kai Yuan, 2019, Fish & shellfish immunology.

Effectively control of viral disease outbreak in shrimp culture system by selective predation

Bin Ai, S. Weng, Jianguo He, 2020 .

Humoral innate immune response and disease

S. Fleming, S. Shishido, Kai Yuan, 2012, Clinical Immunology.

Effective control of a viral disease with a high transmission rate through selective predation

Bin Ai, S. Weng, Jianguo He, 2020 .

Tissue distribution and properties of glutathione S-transferases in Apis cerana cerana Fabricius and Apis mellifera ligustica Spinola

Xiwu Gao, Q. Diao, Kai Yuan, 2006 .

Down-regulation apoptosis signal-regulating kinase 1 gene reduced the Litopenaeus vannamei hemocyte apoptosis in WSSV infection.

S. Weng, Jianguo He, Yong-gui Chen, 2016, Fish and Shellfish Immunology.

Combining metabolic flux analysis and adaptive evolution to enhance lipase production in Bacillus subtilis

He Huang, J. Wen, Shuang Li, 2019, Journal of Industrial Microbiology & Biotechnology.

Pedobacter mongoliensis sp. nov., isolated from grassland soil.

Gejiao Wang, Kai Yuan, Jingxin Li, 2018, International journal of systematic and evolutionary microbiology.

Chryseobacterium montanum sp. nov. isolated from mountain soil.

Wei Guo, Gejiao Wang, Kai Yuan, 2016, International journal of systematic and evolutionary microbiology.

A convenient polyculture system that controls a shrimp viral disease with a high transmission rate

Bin Ai, S. Weng, Jianguo He, 2021, Communications Biology.

Novel osmotic stress control strategy for improved pneumocandin B0 production in Glarea lozoyensis combined with a mechanistic analysis at the transcriptome level

Lu-jing Ren, J. Wen, He Huang, 2018, Applied Microbiology and Biotechnology.

Metabolomics profiling reveals the mechanism of increased pneumocandin B0 production by comparing mutant and parent strains

He Huang, Lu-jing Ren, Tingting Qin, 2018, Journal of Industrial Microbiology & Biotechnology.

Comparative Transcriptomics Analysis of the Responses of the Filamentous Fungus Glarea lozoyensis to Different Carbon Sources

Kecheng Zhang, Q. Ding, Yuwen Wang, 2020, Frontiers in Microbiology.

Transcriptome analysis of the unfolded protein response in hemocytes of Litopenaeus vannamei.

Jianguo He, Yong-gui Chen, Kai Yuan, 2016, Fish & shellfish immunology.

Identification and functional characterization of a glucose regulated protein 94 gene in Litopenaeus vannamei and its responsiveness in WSSV infection.

S. Weng, Jianguo He, Kai Yuan, 2016, Molecular immunology.

Protective effect of Achyranthes bidentata polysaccharides on diabetic mice induced by streptozocin

Xuezhong Liu, Z. Liu, Kai Yuan, 2010 .

Effects upon metabolic pathways and energy production by Sb(III) and As(III)/Sb(III)-oxidase gene aioA in Agrobacterium tumefaciens GW4

Wei Guo, Gejiao Wang, Kai Yuan, 2017, PloS one.

Molecular characterization of a cation-dependent mannose-6-phosphate receptor gene in Crassostrea hongkongensis and its responsiveness in Vibrio alginolyticus infection.

Runqing Huang, Qilin Yi, Jiangyong Wang, 2023, Fish & shellfish immunology.

Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

S. Weng, Jianguo He, Yong-gui Chen, 2016, Developmental and comparative immunology.

Nocardioides immobilis sp. nov., isolated from iron mine soil.

Wei Guo, Gejiao Wang, Kai Yuan, 2017, International journal of systematic and evolutionary microbiology.

Chryseobacterium montanum sp. nov. isolated from mountain soil.

Wei Guo, Gejiao Wang, Kai Yuan, 2016, International journal of systematic and evolutionary microbiology.