A. Nazarali

B. Eames, A. Nazarali, P. Iyyanar, 2019, Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology.

Brain natriuretic peptide receptors in the rat peripheral sympathetic ganglia.

J. Saavedra, A. Nazarali, T. Torda, 1989, Biochemical and biophysical research communications.

Protein-energy malnutrition increases activation of the transcription factor, nuclear factor kappaB, in the gerbil hippocampus following global ischemia.

P. Paterson, A. Nazarali, L. Ji, 2008, The Journal of nutritional biochemistry.

Application of Fluorescence Microscopy to Measure Apoptosis in Jurkat T Cells After Treatment with a New Investigational Anticancer Agent (N.C.1213)

J. Dimmock, A. Nazarali, S. Vashishtha, 1998, Cellular and Molecular Neurobiology.

GTTC 22400 TAAGTGGTTTTTACACAGAAC CCAACAAGC TTCTATGTGATTTTC CTGAAAAACAAAACAGGAGGCCTGCAAGAAAGTGACCATAAATTGTCTTGTCACTTTCTGTTTATTTTTGTACCA 2 52 0 CATTAGGATGCATTGTCATGCGTATTTTTGGTAGAATAAATTC TCCTTTGCTATAAGTAGCTTTCTTATTTTTTTCTTCCCCTCTTTCTCAAGAC TCATACTGATTTCTTATACTTCTTT 2 64 0

M. Nirenberg, A. Nazarali, V. Guo, 2022 .

Matrix metalloproteinase-25 has a functional role in mouse secondary palate development and is a downstream target of TGF-β3

A. Nazarali, Graham D Brown, 2010, BMC Developmental Biology.

Sirt2 epigenetically down-regulates PDGFRα expression and promotes CG4 cell differentiation

Chu Zhang, Na Fang, Shaoping Ji, 2019, Cell cycle.

Metabolism and disposition of N-(2-cyanoethyl)amphetamine (fenproporex) and amphetamine: study in the rat brain.

G. Baker, R. T. Coutts, A. Nazarali, 1986, Canadian journal of physiology and pharmacology.

Protocols for Cloning, Expression, and Functional Analysis of Sirtuin2 (SIRT2).

Shaoping Ji, A. Nazarali, J. R. Doucette, 2016, Methods in molecular biology.

Inhibition of ischemia-induced brain catecholamine alterations by clonidine

M. Miyazaki, G. Baker, A. Nazarali, 1989, Brain Research Bulletin.

Mutated a Subunit of the Gq Protein Induces Malignant Transformation in NIH 3T3 Cells

S. Hermouet, And, Xu, 2022 .

Angiotensin II binding sites in the superior cervical ganglia of spontaneously hypertensive and Wistar-Kyoto rats after preganglionic denervation

J. Saavedra, A. Nazarali, J. Pinto, 1988, Brain Research.

Brain levels of 5-hydroxytryptamine, tryptamine and 2-phenylethylamine in the rat after administration of N-cyanoethyltranylcypromine

R. Micetich, G. Baker, R. T. Coutts, 1984, Progress in Neuro-Psychopharmacology and Biological Psychiatry.

Effect of chronic administration of the converting enzyme inhibitor enalapril (MK 421) on brain atrial natriuretic peptide receptors in Wistar-Kyoto and spontaneously hypertensive rats

J. S. Gutkind, J. Saavedra, A. Nazarali, 1988, Brain Research.

The Optimization of Soluble PTEN Expression in Escherichia coli

Yang An, Na Fang, Shaoping Ji, 2015, The open biochemistry journal.

A. Nazarali, R. Jiao, J. Ronald Doucette, 2010, Cellular and Molecular Neurobiology.

Regulation of angiotensin II binding sites in the subfornical organ and other rat brain nuclei after water deprivation

J. S. Gutkind, J. Saavedra, A. Nazarali, 1987, Cellular and Molecular Neurobiology.

Hoxd1 is Expressed by Oligodendroglial Cells and Binds to a Region of the Human Myelin Oligodendrocyte Glycoprotein Promoter in vitro

J. Booth, A. Nazarali, J. R. Doucette, 2007, Cellular and Molecular Neurobiology.

Calibration of 125I-polymer standards with 125I-brain paste standards for use in quantitative receptor autoradiography

J. S. Gutkind, J. Saavedra, A. Nazarali, 1989, Journal of Neuroscience Methods.

Biochemical Alterations in White Matter Tracts of the Aging Mouse Brain Revealed by FTIR Spectroscopy Imaging

R. Bazinet, S. Read, S. Rosendahl, 2021, Neurochemical Research.

Autoradiographic localization of 5HT2 receptors in rat brain using [125I]-DOI, a selective psychotomimetic radioligand

J. Saavedra, D. Mckenna, A. Nazarali, 1989, Progress in Neuro-Psychopharmacology and Biological Psychiatry.

A conformational and structure-activity relationship study of cytotoxic 3,5-bis(arylidene)-4-piperidones and related N-acryloyl analogues.

E. De Clercq, J. Quail, J. Dimmock, 2001, Journal of medicinal chemistry.

Cytotoxic 2,6-bis(arylidene)cyclohexanones and related compounds.

J. Quail, J. Dimmock, J. Balzarini, 2000, European journal of medicinal chemistry.

Distribution of a putative kainic acid receptor in the frog central nervous system determined with monoclonal and polyclonal antibodies: evidence for synaptic and extrasynaptic localization

R. Wenthold, R. Wenthold, D. Hampson, 1990, The Journal of neuroscience : the official journal of the Society for Neuroscience.

Cell Biology and Pathology of Myelin

D. Schreyer, R. Devon, V. Verge, 1997, Altschul Symposia Series.

Rapid analysis of β-phenylethylamine in tissues and body fluids utilizing pentafluorobenzoylation followed by electron-capture gas chromatography

T. Rao, G. Baker, R. T. Coutts, 1987, Progress in Neuro-Psychopharmacology and Biological Psychiatry.

Conformational and quantitative structure-activity relationship study of cytotoxic 2-arylidenebenzocycloalkanones.

L. Prasad, E. De Clercq, J. Quail, 1999, Journal of medicinal chemistry.

Hyperforin promotes mitochondrial function and development of oligodendrocytes

Zhijun Zhang, Yanbo Zhang, Handi Zhang, 2011, Journal of neurochemistry.

Non-viral nucleic acid delivery: key challenges and future directions.

M. Foldvari, Mahmoud Elsabahy, A. Nazarali, 2011, Current drug delivery.

Transcriptional control of oligodendrogenesis

A. Nazarali, J. R. Doucette, Danette J. Nicolay, 2007, Glia.

Molecular signaling along the anterior–posterior axis of early palate development

S. Lozanoff, A. Nazarali, P. Iyyanar, 2013, Front. Physio..

Transcriptional Regulation of Neurogenesis in the Olfactory Epithelium

A. Nazarali, J. R. Doucette, Danette J. Nicolay, 2006, Cellular and Molecular Neurobiology.

Monoamine oxidase-A physically interacts with presenilin-1(M146V) in the mouse cortex.

D. Mousseau, Xia Cao, G. Baker, 2012, Journal of Alzheimer's disease : JAD.

Hoxb4 in Oligodendrogenesis

A. Nazarali, J. R. Doucette, Danette J. Nicolay, 2004, Cellular and Molecular Neurobiology.

Early stages of oligodendrocyte development in the embryonic murine spinal cord proceed normally in the absence of Hoxa2

A. Nazarali, J. R. Doucette, Danette J. Nicolay, 2004, Glia.

Differential expression of Hoxa‐2 protein along the dorsal‐ventral axis of the developing and adult mouse spinal cord

A. Nazarali, L. Wolf, R. Doucette, 1999, Developmental dynamics : an official publication of the American Association of Anatomists.

Advances in the treatment of relapsing–remitting multiple sclerosis: the role of pegylated interferon β-1a

A. Haddadi, Kendra L. Furber, A. Nazarali, 2017, Degenerative neurological and neuromuscular disease.

Organotypic Cultures from the Adult CNS: A Novel Model to Study Demyelination and Remyelination Ex Vivo

Kendra L. Furber, A. Nazarali, J. R. Doucette, 2017, Cellular and Molecular Neurobiology.

Current Developments in Pharmacogenomics of Multiple Sclerosis

A. Nazarali, J. R. Doucette, R. Carlson, 2014, Cellular and Molecular Neurobiology.

Mitochondrial dysfunction contributes to the cytotoxicity of some 3,5-bis(benzylidene)-4-piperidone derivatives in colon HCT-116 cells.

J. Dimmock, M. Helal, Azharul Islam, 2013, Bioorganic & medicinal chemistry letters.

Chronic effects of tranylcypromine and 4-fluorotranylcypromine on regional brain monoamine metabolism in rats: A comparison with clorgyline

A. Greenshaw, T. Rao, G. Baker, 1989, Biological Psychiatry.

Quantitative in vitro autoradiographic characterization of [125I]angiotensin III binding sites in rat adrenal gland

J. Saavedra, A. Nazarali, A. Himeno, 1988, Regulatory Peptides.

Regulation of brain atrial natriuretic peptide and angiotensin receptors: quantitative autoradiographic studies.

E. Castrén, J. Saavedra, A. Nazarali, 1989, International review of neurobiology.

Hox Genes and Their Candidate Downstream Targets in the Developing Central Nervous System

A. Nazarali, Z. Akin, A. J. Nazarali, 2005, Cellular and Molecular Neurobiology.

Caregivers’ Attitudes towards HIV Testing and Disclosure of HIV Status to At-Risk Children in Rural Uganda

C. Henry, A. Nazarali, W. Muyindike, 2016, PloS one.

Pharmacogenomics of interferon-β in multiple sclerosis: what has been accomplished and how can we ensure future progress?

Rebecca J. Carlson, Katherine B Knox, A. Nazarali, 2015, Cytokine & growth factor reviews.

Does Sirt2 Regulate Cholesterol Biosynthesis During Oligodendroglial Differentiation In Vitro and In Vivo?

Shaoping Ji, Kendra L. Furber, A. Nazarali, 2017, Cellular and Molecular Neurobiology.

Expression of PTEN‐long mediated by CRISPR/Cas9 can repress U87 cell proliferation

Yang An, Fengling Wang, Na Fang, 2017, Journal of cellular and molecular medicine.

Nano-pharmaceutical formulations for targeted drug delivery against HER2 in breast cancer.

Sams M A Sadat, S. Saeidnia, A. Haddadi, 2015, Current cancer drug targets.

Sirt2 is a novel in vivo downstream target of Nkx2.2 and enhances oligodendroglial cell differentiation.

Shaoping Ji, A. Nazarali, J. R. Doucette, 2011, Journal of molecular cell biology.

Temporal and Spatial Expression of Hoxa-2 During Murine Palatogenesis

A. Nazarali, J. Yeung, R. Puthucode, 2000, Cellular and Molecular Neurobiology.

A Novel Method of Eliminating Non-Neuronal Proliferating Cells from Cultures of Mouse Dorsal Root Ganglia

P. L. Andersen, A. Nazarali, J. R. Doucette, 2003, Cellular and Molecular Neurobiology.

Gas Chromatography of Amines and Their Metabolites in Tissues and Body Fluids

G. Baker, R. T. Coutts, A. Nazarali, 1985 .

Enalapril decreases angiotensin II receptors in subfornical organ of SHR.

J. Saavedra, A. Nazarali, F. Corrêa, 1989, The American journal of physiology.

Increased β2-adrenoceptors in the superior cervical ganglia of genetically hypertensive rats

J. Saavedra, A. Nazarali, T. Torda, 1991, Brain Research.

Autoradiographic characterization of beta-adrenoceptors in rat heart valve leaflets.

J. Saavedra, A. Nazarali, T. Torda, 1989, The American journal of physiology.

Monoamine neurotransmitters and their metabolites in brain regions in alzheimer's disease: A postmortem study

G. Reynolds, A. Nazarali, 1992, Cellular and Molecular Neurobiology.

Circular RNAs as potential biomarkers for cancer diagnosis and therapy.

Fengling Wang, Shaoping Ji, Fengling Wang, 2016, American journal of cancer research.

Murine Hox-1.11 homeobox gene structure and expression.

M Nirenberg, M. Nirenberg, C. Kozak, 1992, Proceedings of the National Academy of Sciences of the United States of America.

Chronic treatment with (+/-)DOI, a psychotomimetic 5-HT2 agonist, downregulates 5-HT2 receptors in rat brain.

J. Saavedra, D. Mckenna, A. Nazarali, 1989, Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology.

Tranylcypromine and an N-Cyanoethyl Analogue: Effects on Brain Levels of the Trace Amines β-Phenylethylamine and Tryptamine

R. Micetich, D. Hampson, G. Baker, 1985 .

Sequential cytotoxicity: a theory evaluated using novel 2-[4-(3-aryl-2-propenoyloxy)phenylmethylene]cyclohexanones and related compounds.

E. De Clercq, J. Quail, J. Dimmock, 2000, Journal of medicinal chemistry.

Toxic effects of valproic acid on mouse palatal development in vitro

X. Wang, W. Zhang, A. Nazarali, 2007 .

Para-hydroxytranylcypromine: presence in rat brain and heart following administration of tranylcypromine and an N-cyanoethyl analogue

A. Greenshaw, G. Baker, R. T. Coutts, 1987, European Journal of Drug Metabolism and Pharmacokinetics.

A rapid and sensitive electron-capture gas chromatographic method for the analysis of tranylcypromine in brain tissue using acetylation and pentafluorobenzoylation.

D. Hampson, G. Baker, R. T. Coutts, 1984, Journal of biochemical and biophysical methods.

RNA-binding Protein Quaking Stabilizes Sirt2 mRNA during Oligodendroglial Differentiation*

Shaoping Ji, Kendra L. Furber, A. Nazarali, 2017, The Journal of Biological Chemistry.

Current Developments in Pharmacogenomics of Multiple Sclerosis

A. Nazarali, J. R. Doucette, R. Carlson, 2014, Cellular and molecular neurobiology.

Organotypic Cultures from the Adult CNS: A Novel Model to Study Demyelination and Remyelination Ex Vivo

Kendra L. Furber, A. Nazarali, J. R. Doucette, 2017, Cellular and Molecular Neurobiology.

Hox-1.11 and Hox-4.9 homeobox genes.

M Nirenberg, M. Nirenberg, Y. Kim, 1992, Proceedings of the National Academy of Sciences of the United States of America.

Amphetamine in rat brain after intraperitoneal injection of N-alkylated analogues

G. Baker, R. T. Coutts, A. Nazarali, 1983, Progress in Neuro-Psychopharmacology and Biological Psychiatry.

Analysis of clonidine in biological tissues and body fluids by gas chromatography with electron-capture detection.

G. Baker, A. Nazarali, D. Boisvert, 1986, Journal of chromatography.

Chronic tranylcypromine treatment induces functional α2-adrenoceptor down-regulation in rats

A. Greenshaw, T. Rao, G. Baker, 1988 .

SIRT2 suppresses expression of inflammatory factors via Hsp90‐glucocorticoid receptor signalling

Xiaofang Zhao, Na Fang, Shaoping Ji, 2020, Journal of cellular and molecular medicine.

Characterization of Hoxd1 Protein–DNA-Binding Specificity Using Affinity Chromatography and Random DNA Oligomer Selection

A. Nazarali, Praveen Kumar, 2001, Cellular and Molecular Neurobiology.

Sirt2 is a novel in vivo downstream target of Nkx2.2 and enhances oligodendroglial cell differentiation.

Shaoping Ji, A. Nazarali, J. R. Doucette, 2011, Journal of molecular cell biology.

Biochemical Alterations in White Matter Tracts of the Aging Mouse Brain Revealed by FTIR Spectroscopy Imaging

R. Bazinet, S. Read, S. Rosendahl, 2021, Neurochemical Research.