A. Kotsakis

V. Georgoulias, F. Koinis, A. Kotsakis, 2016, Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer.

Etoposide plus cisplatin followed by concurrent chemo-radiotherapy and irinotecan plus cisplatin for patients with limited-stage small cell lung cancer: A multicenter phase II study.

V. Georgoulias, A. Kalykaki, A. Polyzos, 2010, Lung cancer.

Bcl-2 expression in circulating tumor cells (CTCs) of patients with small cell lung cancer (SCLC) receiving front-line treatment.

V. Georgoulias, M. Nikolaou, N. Georgoulia, 2018, Lung cancer.

A phase I clinical trial of weekly oral topotecan for relapsed small cell lung cancer

S. Agelaki, V. Georgoulias, E. Papadimitraki, 2013, Cancer Chemotherapy and Pharmacology.

Paclitaxel in combination with carboplatin as salvage treatment in patients with castration-resistant prostate cancer: a Hellenic oncology research group multicenter phase II study

V. Georgoulias, A. Soultati, A. Kalykaki, 2012, Cancer Chemotherapy and Pharmacology.

Phase I trial of pemetrexed in combination with cetuximab and concurrent radiotherapy in patients with head and neck cancer.

D. Heron, M. Karamouzis, J. Johnson, 2011, Annals of oncology : official journal of the European Society for Medical Oncology.

Non-Platinum-Based First-Line Followed by Platinum-Based Second-Line Chemotherapy or the Reverse Sequence in Patients with Advanced Non-Small Cell Lung Cancer: A Retrospective Analysis by the Lung Cancer Group of the Hellenic Oncology Research Group

V. Georgoulias, N. Ziras, S. Agelaki, 2010, Oncology.

A retrospective analysis of non-platinum-based first- and second-line chemotherapy in patients with advanced non-small cell lung cancer.

S. Agelaki, V. Georgoulias, A. Kalykaki, 2010, Anticancer research.

Myeloid-Derived Suppressor Cells in Prostate Cancer: Present Knowledge and Future Perspectives

F. Koinis, A. Kotsakis, Anastasia Xagara, 2021, Cells.

Arthritis and Myositis in a Patient Treated with Programmed Cell Death-1 (PD-1) Inhibitor Pembrolizumab for Lung Cancer

D. Bogdanos, E. Pagkopoulou, A. Kotsakis, 2020, Mediterranean journal of rheumatology.

Efficacy and tolerance of frontline bevacizumab-based chemotherapy for advanced non-small cell lung cancer patients: a multicenter, phase IV study of the Hellenic Oncology Research Group (HORG)

C. Emmanouilides, O. B. O. A. T. Group, A. Polyzos, 2016, Cancer Chemotherapy and Pharmacology.

Association of epithelial-to-mesenchymal transition circulating tumor cells in non-small cell lung cancer (NSCLC) molecular subgroups.

V. Georgoulias, A. Kotsakis, I. Messaritakis, 2017, Journal of thoracic disease.

Myeloid-derived suppressor cell measurements in fresh and cryopreserved blood samples.

B. Schilling, A. Argiris, T. Whiteside, 2012, Journal of immunological methods.

Epithelial-to-mesenchymal Transition Heterogeneity of Circulating Tumor Cells and Their Correlation With MDSCs and Tregs in HER2-negative Metastatic Breast Cancer Patients

V. Georgoulias, N. Xenidis, A. Kotsakis, 2021, AntiCancer Research.

Prognostic value of circulating regulatory T cell subsets in untreated non-small cell lung cancer patients

V. Georgoulias, F. Koinis, A. Kotsakis, 2016, Scientific Reports.

Randomized phase III study of docetaxel plus bavituximab in previously treated advanced non-squamous non-small-cell lung cancer

D. Gerber, I. Bondarenko, W. Su, 2018, Annals of oncology : official journal of the European Society for Medical Oncology.

Clinical Activity of an hTERT-Specific Cancer Vaccine (Vx-001) in “Immune Desert” NSCLC

V. Georgoulias, J. Kinet, M. Avgeris, 2021, Cancers.

Characterization of DLL3-positive circulating tumor cells (CTCs) in patients with small cell lung cancer (SCLC) and evaluation of their clinical relevance during front-line treatment.

V. Georgoulias, E. Politaki, A. Koutsopoulos, 2019, Lung cancer.

Evaluation of PD-L1/PD-1 on circulating tumor cells in patients with advanced non-small cell lung cancer

G. Kallergi, V. Georgoulias, C. Stournaras, 2018, Therapeutic advances in medical oncology.

Complications of Totally Implantable Central Venous Catheters (Ports) Inserted via the Internal Jugular Vein Under Ultrasound and Fluoroscopy Guidance in Adult Oncology Patients: A Single-Center Experience

I. Fezoulidis, A. Kotsakis, H. Moschouris, 2022, Cureus.

Avelumab, an anti-PD-L1 monoclonal antibody, shows activity in various tumour types.

V. Georgoulias, A. Kotsakis, 2017, The Lancet. Oncology.

New prophylaxis strategies to reduce the risk of thromboembolism in cancer

A. Kokkalis, V. Papadopoulos, A. Kotsakis, 2021, Expert review of anticancer therapy.

Sequential gemcitabine and cisplatin followed by docetaxel as first-line treatment of advanced urothelial carcinoma: a multicenter phase II study of the Hellenic Oncology Research Group.

V. Georgoulias, I. Boukovinas, N. Ziras, 2006, Annals of oncology : official journal of the European Society for Medical Oncology.

Sequential Administration of the Native TERT572 Cryptic Peptide Enhances the Immune Response Initiated by its Optimized Variant TERT572Y in Cancer Patients

D. Mavroudis, V. Georgoulias, E. Papadimitraki, 2011, Journal of immunotherapy.

Immunological responses in cancer patients after vaccination with the therapeutic telomerase-specific vaccine Vx-001

D. Mavroudis, V. Georgoulias, E. Papadimitraki, 2012, Cancer Immunology, Immunotherapy.

Emerging agents for the prevention of treatment induced neutropenia in adult cancer patients

V. Georgoulias, A. Matikas, A. Kotsakis, 2016, Expert opinion on emerging drugs.

Emerging Role of YAP and the Hippo Pathway in Prostate Cancer

F. Koinis, A. Kotsakis, Anastasia Xagara, 2022, Biomedicines.

An individual patient-data meta-analysis of metronomic oral vinorelbine in metastatic non-small cell lung cancer

M. Mencoboni, G. Banna, J. Daurès, 2019, PloS one.

PD-L1/pS6 in Circulating Tumor Cells (CTCs) during Osimertinib Treatment in Patients with Non-Small Cell Lung Cancer (NSCLC)

G. Kallergi, V. Georgoulias, E. Lianidou, 2022, Biomedicines.

Epidemiological characteristics, clinical outcomes and management patterns of metastatic breast cancer patients in routine clinical care settings of Greece: Results from the EMERGE multicenter retrospective chart review study

C. Papadimitriou, A. Ardavanis, G. Koumakis, 2019, BMC Cancer.

Multicenter phase II study of cetuximab (C) with concomitant radiotherapy (RT) followed by consolidation chemotherapy (CT) in locally advanced non-small cell lung cancer (NSCLC).

D. Heron, J. Luketich, S. Dacic, 2011, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Small cell carcinoma of the stomach: A report of two cases and a review of the literature

V. Georgoulias, D. Kalkanis, A. Kotsakis, 2018, Molecular and clinical oncology.

Myeloid-Derived Suppressor Cells: Major Figures that Shape the Immunosuppressive and Angiogenic Network in Cancer

A. Kotsakis, E. Vetsika, A. Koukos, 2019, Cells.

Targeting Angiogenesis in Non-Small Cell Lung Cancer (NSCLC)

T. Owonikoko, A. Kotsakis, 2010 .

Targeting epidermal growth factor receptor in the treatment of non-small-cell lung cancer

V. Georgoulias, A. Kotsakis, 2010, Expert opinion on pharmacotherapy.

Phenotypic Characterization of Circulating Tumor Cells Isolated from Non-Small and Small Cell Lung Cancer Patients

G. Kallergi, S. H. Alkahtani, A. Koutras, 2022, Cancers.

Circulating tumor cells as prognostic biomarkers in breast cancer: current status and future prospects

G. Kallergi, V. Georgoulias, N. Xenidis, 2021, Expert review of molecular diagnostics.

Dynamic changes of CTCs in patients with metastatic HR(+)/HER2(−) breast cancer receiving salvage treatment with everolimus/exemestane

M. Spiliotaki, G. Kallergi, V. Georgoulias, 2021, Cancer Chemotherapy and Pharmacology.

Evaluation of the Role of p95 HER2 Isoform in Trastuzumab Efficacy in Metastatic Breast Cancer

G. Fountzilas, D. Pectasides, A. Batistatou, 2021, AntiCancer Research.

The role of immune checkpoint inhibitors in advanced non-small cell lung cancer

V. Georgoulias, A. Kotsakis, N. Pistamaltzian, 2019, Expert review of respiratory medicine.

Small cell lung cancer (SCLC): no treatment advances in recent years.

F. Koinis, A. Kotsakis, V. Georgoulias, 2016, Translational lung cancer research.

Targeting KRAS mutated non-small cell lung cancer: A history of failures and a future of hope for a diverse entity.

V. Georgoulias, A. Matikas, A. Kotsakis, 2017, Critical reviews in oncology/hematology.

Management of Resistance to Crizotinib in Anaplastic Lymphoma Kinase-Positive Non-Small-cell Lung Cancer.

V. Georgoulias, A. Matikas, A. Kotsakis, 2016, Clinical lung cancer.

The role of docetaxel in the treatment of non-small cell lung cancer lung cancer: an update

V. Georgoulias, A. Matikas, A. Kotsakis, 2016, Expert review of respiratory medicine.

A phase II trial evaluating the clinical and immunologic response of HLA-A2(+) non-small cell lung cancer patients vaccinated with an hTERT cryptic peptide.

D. Mavroudis, V. Georgoulias, E. Papadimitraki, 2014, Lung cancer.

A multicenter phase III trial comparing irinotecan-gemcitabine (IG) with gemcitabine (G) monotherapy as first-line treatment in patients with locally advanced or metastatic pancreatic cancer

K. Syrigos, K. Syrigos, G. Fountzilas, 2006, British Journal of Cancer.

Combination of weekly topotecan and gemcitabine as a salvage treatment in patients with recurrent ovarian cancer: a phase I study.

V. Georgoulias, J. Syrios, A. Polyzos, 2019, Minerva ginecologica.

Small Extracellular Vesicles in Pre-Therapy Plasma Predict Clinical Outcome in Non-Small-Cell Lung Cancer Patients

V. Georgoulias, T. Whiteside, Priyanka Sharma, 2021, Cancers.

CD8+ PD-1+ T-cells and PD-L1+ circulating tumor cells in chemotherapy-naïve non-small cell lung cancer: towards their clinical relevance?

G. Kallergi, V. Georgoulias, A. Koutsopoulos, 2019, Therapeutic advances in medical oncology.

Pegylated liposomal doxorubicin in combination with vinorelbine as salvage treatment in pretreated patients with advanced breast cancer: a multicentre phase II study

S. Agelaki, D. Mavroudis, V. Georgoulias, 2006, Cancer Chemotherapy and Pharmacology.

Phase III study comparing sequential versus alternate administration of cisplatin-etoposide and topotecan as first-line treatment in small cell lung cancer.

S. Agelaki, D. Mavroudis, V. Georgoulias, 2010, Anticancer research.

Current and Future Approaches in the Management of Non-Small-Cell Lung Cancer Patients With Resistance to EGFR TKIs.

V. Georgoulias, A. Matikas, A. Kotsakis, 2015, Clinical lung cancer.

Phase II Study of Everolimus (RAD001) in Previously Treated Small Cell Lung Cancer

S. Dacic, A. Argiris, C. Belani, 2010, Clinical Cancer Research.

Cancer Therapy : Clinical Phase II Study of Everolimus ( RAD 001 ) in Previously Treated Small Cell Lung Cancer

S. Dacic, A. Argiris, C. Belani, 2010 .

Assessment of the Efficacy and Clinical Utility of Different Circulating Tumor Cell (CTC) Detection Assays in Patients with Chemotherapy-Naïve Advanced or Metastatic Non-Small Cell Lung Cancer (NSCLC)

V. Georgoulias, S. Agelaki, D. Mavroudis, 2021, International journal of molecular sciences.

Multiplexed deep sequencing analysis of ALK kinase domain identifies resistance mutations in relapsed patients following crizotinib treatment.

Shibing Deng, J. Christensen, J. Ahn, 2013, Genomics.

Pemetrexed versus erlotinib in pretreated patients with advanced non–small cell lung cancer: A Hellenic Oncology Research Group (HORG) randomized phase 3 study

D. Mavroudis, V. Georgoulias, G. Samonis, 2013, Cancer.

TCCAAATGAGCTGGCAAGTG TCAGAGCCTGTGTTTCTACCAA TCCCAAACACTCAGTGAAACAAA TGGTCTCACAGGACCACTGATT Exon 19 EGFR AAATAATCAGTGTGATTCGTGGAG GAGGCCAGTGCTGTCTCTAAGG GAGGCCAGTGCTGTCTCTAAGG TGTGGAGATGAGCAGGGTCT Exon 21 EGFR GCAGCGGGTTACATCTTCTTTC GCTCAGAGCCTGGCATGAA CAGCTCTGGCTCACACTACCAG CATCCTCCCCTGCATGTGT Exon

D. Mavroudis, V. Georgoulias, G. Samonis, 2013 .

Front-line treatment of advanced non-small-cell lung cancer with docetaxel and gemcitabine: a multicenter phase II trial.

M. Dimopoulos, V. Georgoulias, C. Papadimitriou, 1999, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Front-Line T reatment o f A dvanced N on-Small-Cell Lung C ancer W ith D ocetaxel a nd G emcitabine: A M ulticenter P hase I I T rial

M. Dimopoulos, V. Georgoulias, C. Papadimitriou, 1999 .

Front-Line Bevacizumab plus Chemotherapy with or without Maintenance Therapy for Metastatic Breast Cancer: An Observational Study by the Hellenic Oncology Research Group

V. Georgoulias, I. Boukovinas, N. Ziras, 2022, Current oncology.

Phase 2 study of cabazitaxel as second-line treatment in patients with HER2-negative metastatic breast cancer previously treated with taxanes—a Hellenic Cooperative Oncology Group (HeCOG) Trial

M. Dimopoulos, G. Lazaridis, A. Psyrri, 2020, British Journal of Cancer.

Panitumumab in combination with modified docetaxel/cisplatin/5-fluorouracil as first-line treatment in gastric and gastroesophageal junction adenocarcinomas: a multicenter phase II study by the Hellenic Oncology Research Group

V. Georgoulias, I. Boukovinas, P. Economopoulou, 2018, Annals of gastroenterology.

Detection of EGFR Mutations in Plasma cfDNA and Paired CTCs of NSCLC Patients before and after Osimertinib Therapy Using Crystal Digital PCR

V. Georgoulias, E. Lianidou, A. Kotsakis, 2021, Cancers.

Is Histologic Subtype Significant in the Management of NSCLC

S. Yousem, S. Gadgeel, A. Kotsakis, 2010 .

DNA Methylation Analysis in Plasma Cell-Free DNA and Paired CTCs of NSCLC Patients before and after Osimertinib Treatment

V. Georgoulias, E. Lianidou, T. Rampias, 2021, Cancers.

Effect of Osimertinib on CTCs and ctDNA in EGFR Mutant Non-Small Cell Lung Cancer Patients: The Prognostic Relevance of Liquid Biopsy

G. Kallergi, V. Georgoulias, R. Rosell, 2022, Cancers.

Recurrence-free Survival and Safety of Imatinib in Patients With Gastrointestinal Stromal Tumour (GIST) in Greece

I. Boukovinas, G. Aravantinos, P. Kosmidis, 2020, AntiCancer Research.

Frontline treatment with gemcitabine, oxaliplatin and erlotinib for the treatment of advanced or metastatic pancreatic cancer: a multicenter phase II study of the Hellenic Oncology Research Group (HORG)

V. Georgoulias, E. Stathopoulos, J. Souglakos, 2014, Cancer Chemotherapy and Pharmacology.

Gemcitabine plus oxaliplatin (GEMOX) in pretreated patients with advanced ovarian cancer: a multicenter phase II study of the Hellenic Oncology Research Group (HORG).

D. Mavroudis, V. Georgoulias, I. Boukovinas, 2008, Anticancer research.

Dynamic changes of phenotypically different circulating tumor cells sub-populations in patients with recurrent/refractory small cell lung cancer treated with pazopanib

V. Georgoulias, M. Plataki, S. Apostolaki, 2018, Scientific Reports.

A Phase I Study of the Optimized Cryptic Peptide TERT572Y in Patients with Advanced Malignancies

I. Miconnet, P. Kanellou, M. Spyropoulou, 2006, Oncology.

Salvage treatment with paclitaxel and gemcitabine for patients with non-small-cell lung cancer after cisplatin- or docetaxel-based chemotherapy: a multicenter phase II study.

V. Georgoulias, I. Dimopoulou, C. Papadimitriou, 1998, Annals of oncology : official journal of the European Society for Medical Oncology.

31st Annual Meeting and Associated Programs of the Society for Immunotherapy of Cancer (SITC 2016): part one

Charles J. Vaske, Rohan N. Borkar, Brian D. Kelly, 2016, Journal of Immunotherapy for Cancer.

Prognostic Impact of Src, CDKN1B, and JAK2 Expression in Metastatic Breast Cancer Patients Treated with Trastuzumab

G. Lazaridis, G. Aravantinos, T. Economopoulos, 2019, Translational oncology.

Second-line pazopanib in patients with relapsed and refractory small-cell lung cancer: a multicentre phase II study of the Hellenic Oncology Research Group

V. Georgoulias, G. Fountzilas, S. Agelaki, 2017, British Journal of Cancer.

ERCC1 SNPs as Potential Predictive Biomarkers in Non-Small Cell Lung Cancer Patients Treated With Platinum-Based Chemotherapy

V. Georgoulias, A. Voutsina, S. Agelaki, 2015, Cancer investigation.

A Circulating Subpopulation of Monocytic Myeloid-Derived Suppressor Cells as an Independent Prognostic/Predictive Factor in Untreated Non-Small Lung Cancer Patients

D. Mavroudis, V. Georgoulias, F. Koinis, 2014, Journal of immunology research.

Cetuximab and bevacizumab: preclinical data and phase II trial in recurrent or metastatic squamous cell carcinoma of the head and neck.

J. Grandis, P. Harari, A. Argiris, 2013, Annals of oncology : official journal of the European Society for Medical Oncology.

Clinical activity of a htert (vx-001) cancer vaccine as post-chemotherapy maintenance immunotherapy in patients with stage IV non-small cell lung cancer: final results of a randomised phase 2 clinical trial

A. Chella, C. Gridelli, V. Georgoulias, 2020, British Journal of Cancer.

Cisplatin in combination with metronomic vinorelbine as front-line treatment in advanced non-small cell lung cancer: a multicenter phase II study of the Hellenic Oncology Research Group (HORG)

S. Agelaki, V. Georgoulias, N. Karachaliou, 2015, Cancer Chemotherapy and Pharmacology.

Metronomic Chemotherapy in Non-Small-Cell Lung Cancer

V. Georgoulias, A. Kotsakis, N. Kentepozidis, 2014 .

Phase II trial of everolimus in patients with previously treated recurrent or metastatic head and neck squamous cell carcinoma

J. Grandis, A. Argiris, J. Bauman, 2016, Head & neck.

Plasmablastic lymphoma of the breast in an immunocompetent patient: long-lasting complete response induced by chemotherapy and autologous stem cell trasplantation.

M. Dimopoulos, V. Georgoulias, C. Papadimitriou, 2014, Anticancer research.

Prognostic significance of CEACAM5mRNA-positive circulating tumor cells in patients with metastatic colorectal cancer

V. Georgoulias, J. Souglakos, M. Sfakianaki, 2018, Cancer Chemotherapy and Pharmacology.

Detection of circulating tumour cells before and following adjuvant chemotherapy and long-term prognosis of early breast cancer

V. Georgoulias, M. Perraki, P. Economopoulou, 2022, British Journal of Cancer.

Classifying circulating tumor cells to monitor cancer progression

V. Georgoulias, P. Economopoulou, A. Kotsakis, 2017, Expert review of molecular diagnostics.

Sequential administration of vinorelbine plus cisplatin and bevacizumab followed by docetaxel plus gemcitabine and bevacizumab compared to docetaxel plus cisplatin and bevacizumab regimen as first-line therapy for advanced or metastatic non-squamous non-small cell lung cancer: A multicenter randomiz

S. Agelaki, V. Georgoulias, D. Mavroudis, 2015, Lung cancer.

Therapeutic strategies for chemotherapy-induced neutropenia in patients with solid tumors

V. Georgoulias, F. Koinis, A. Kotsakis, 2015, Expert opinion on pharmacotherapy.

Sequential administration of docetaxel followed by maintenance gefitinib, as salvage treatment in patients with advanced NSCLC: a multicenter phase II trial.

S. Agelaki, V. Georgoulias, A. Kalykaki, 2007, Lung cancer.

A multicenter phase II study of sequential vinorelbine and cisplatin followed by docetaxel and gemcitabine in patients with advanced non-small cell lung cancer.

V. Georgoulias, A. Pallis, A. Kotsakis, 2006, Lung cancer.

Salvage treatment with irinotecan/cisplatin versus pemetrexed/cisplatin in patients with non-small cell lung cancer pre-treated with a non-platinum-based regimen in the first-line setting: a randomized phase II study of the Hellenic Oncology Research Group (HORG)

V. Georgoulias, P. Economopoulou, A. Polyzos, 2017, Clinical and Translational Oncology.

Phase I study of irinotecan (CPT-11) and cisplatin (CDDP) combination in metastatic non-small cell lung cancer (NSCLC)

S. Agelaki, V. Georgoulias, G. Samonis, 1998 .

TTF-1- and/or CD56-positive Circulating Tumor Cells in patients with small cell lung cancer (SCLC)

V. Georgoulias, J. Souglakos, S. Apostolaki, 2017, Scientific Reports.

Docetaxel plus gemcitabine versus gemcitabine in elderly patients with advanced non-small cell lung cancer and use of a geriatric assessment: Lessons from a prematurely closed Hellenic Oncology Research Group randomized phase III study.

V. Georgoulias, A. Polyzos, A. Kotsakis, 2017, Journal of geriatric oncology.

Docetaxel, gemcitabine and bevacizumab as salvage chemotherapy for HER-2-negative metastatic breast cancer

S. Agelaki, V. Georgoulias, I. Boukovinas, 2014, Cancer Chemotherapy and Pharmacology.

Cancer therapy and cardiovascular risk: focus on bevacizumab

P. Economopoulou, A. Kotsakis, N. Kentepozidis, 2015, Cancer management and research.

A randomized phase III study of the docetaxel/carboplatin combination versus docetaxel single-agent as second line treatment for patients with advanced/metastatic Non-Small Cell Lung Cancer

S. Agelaki, V. Georgoulias, K. Syrigos, 2010, BMC Cancer.

Biweekly Carboplatin Plus Gemcitabine as First-Line Treatment of Elderly Patients With Advanced Squamous Non-Small-cell Lung Cancer: A Multicenter Phase I-II Trial by the Hellenic Oncology Research Group.

V. Georgoulias, G. Rigas, A. Polyzos, 2016, Clinical lung cancer.

Docetaxel versus docetaxel plus gemcitabine as front-line treatment of patients with advanced non-small cell lung cancer: a randomized, multicenter phase III trial.

D. Mavroudis, V. Georgoulias, I. Boukovinas, 2008, Lung cancer.

Evaluation of Monocarboxylate Transporter 4 (MCT4) Expression and Its Prognostic Significance in Circulating Tumor Cells From Patients With Early Stage Non-Small-Cell Lung Cancer

G. Kallergi, E. Lianidou, A. Markou, 2021, Frontiers in Cell and Developmental Biology.

Docetaxel‐induced lymphopenia in patients with solid tumors

V. Georgoulias, J. Souglakos, S. Apostolaki, 2000, Cancer.

Post-chemotherapy lymphopoiesis in patients with solid tumors is characterized by CD4+ cell proliferation.

V. Georgoulias, S. Kakolyris, A. Kotsakis, 1999, Anticancer research.

Weekly docetaxel and concomitant boost radiotherapy for non-small cell lung cancer. A phase I/II dose escalation trial.

V. Georgoulias, A. Giatromanolaki, M. Koukourakis, 1998, European journal of cancer.

Effect of front-line chemotherapy on circulating CK-19 mRNA-positive cells in patients with metastatic breast cancer

S. Agelaki, V. Georgoulias, M. Perraki, 2014, Cancer Chemotherapy and Pharmacology.

Docetaxel plus cisplatin and bevacizumab for untreated patients with advanced/metastatic non-squamous non-small-cell lung cancer: a multicenter phase II study of the Hellenic Oncology Research Group

S. Agelaki, V. Georgoulias, A. Soultati, 2013, Cancer Chemotherapy and Pharmacology.

A multicenter phase II study of cetuximab in combination with chest radiotherapy and consolidation chemotherapy in patients with stage III non-small cell lung cancer.

D. Heron, J. Luketich, S. Dacic, 2013, Lung cancer.

A multicenter phase II study of docetaxel, gemcitabine and trastuzumab administration as first-line treatment in patients with advanced breast cancer (ABC) overexpressing HER.

V. Georgoulias, N. Malamos, D. Mavroudis, 2004, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Nab-paclitaxel as second-line treatment in advanced gastric cancer: a multicenter phase II study of the Hellenic Oncology Research Group

V. Georgoulias, I. Boukovinas, J. Souglakos, 2017, Annals of gastroenterology.

Efficacy of panitumumab in older patients with metastatic colorectal cancer: a retrospective analysis using the database of the Hellenic Oncology Research Group (HORG).

V. Georgoulias, N. Ziras, J. Souglakos, 2019, Journal of geriatric oncology.

Long-term clinical benefit from salvage EGFR tyrosine kinase inhibitors in advanced non-small-cell lung cancer patients with EGFR wild-type tumors

V. Georgoulias, A. Voutsina, E Lagoudaki, 2018, Clinical and Translational Oncology.

A Multicenter Phase II Study of Docetaxel in Combination with Gefitinib in Gemcitabine-Pretreated Patients with Advanced/Metastatic Pancreatic Cancer

V. Georgoulias, M. Ignatiadis, A. Polyzos, 2007, Oncology.

A phase II, open-label trial of bortezomib (VELCADE®) in combination with gemcitabine and cisplatin in patients with locally advanced or metastatic non-small cell lung cancer

K. Syrigos, S. Agelaki, V. Georgoulias, 2016, Cancer Chemotherapy and Pharmacology.

Efficacy and treatment tolerance in older patients with NSCLC: a meta-analysis of five phase III randomized trials conducted by the Hellenic Oncology Research Group.

V. Georgoulias, A. Kalykaki, D. Mavroudis, 2011, Annals of oncology : official journal of the European Society for Medical Oncology.

Chemotherapy-induced neutropenia as a prognostic factor in patients with advanced non-small cell lung cancer treated with front-line docetaxel-gemcitabine chemotherapy.

S. Agelaki, V. Georgoulias, A. Kalykaki, 2008, Lung cancer.

C. Papadimitriou, A. Ardavanis, G. Koumakis, 2019, BMC Cancer.

Immune Checkpoint and EMT-Related Molecules in Circulating Tumor Cells (CTCs) from Triple Negative Breast Cancer Patients and Their Clinical Impact

G. Kallergi, V. Georgoulias, F. Koinis, 2023, Cancers.

Docetaxel plus gemcitabine as front-line chemotherapy in elderly patients with lung adenocarcinomas: a multicenter phase II study.

S. Agelaki, V. Georgoulias, I. Boukovinas, 2009, Lung cancer.

Continuous Administration of Daily Low-Dose Temozolomide in Pretreated Patients with Advanced Non-Small Cell Lung Cancer: A Phase II Study

V. Georgoulias, A. Kalykaki, N. Vardakis, 2009, Oncology.

Endobronchial Radiofrequency Ablation for pulmonary nodules with Radial-Ebus and Navigation: Pros and Cons

P. Zarogoulidis, K. Sapalidis, W. Hohenforst-Schmidt, 2023, Journal of Cancer.

Comment on “Disease exacerbation is common in inflammatory bowel disease patients treated with immune checkpoint inhibitors for malignancy”

A. Kotsakis, K. Argyriou, 2022, World journal of clinical cases.

Combination of irinotecan (CPT-11) plus oxaliplatin (L-OHP) as first-line treatment in locally advanced or metastatic gastric cancer: a multicentre phase II trial.

K. Syrigos, V. Georgoulias, I. Boukovinas, 2004, Annals of oncology : official journal of the European Society for Medical Oncology.

A phase II trial of postoperative radiotherapy (RT), cisplatin, and panitumumab in patients with high-risk, resected locally advanced squamous cell carcinoma of the head and neck (SCCHN).

D. Heron, J. Grandis, R. Ferris, 2010 .

Generation of Non-Small Cell Lung Cancer Patient-Derived Xenografts to Study Intratumor Heterogeneity

V. Georgoulias, P. Makrythanasis, M. Avgeris, 2021, Cancers.

Phase II trial of capecitabine and oxaliplatin (CAPOX) plus cetuximab in patients with metastatic colorectal cancer who progressed after oxaliplatin-based chemotherapy.

M. Tzardi, S. Agelaki, V. Georgoulias, 2006, Annals of oncology : official journal of the European Society for Medical Oncology.

A dose-escalation study of pemetrexed and docetaxel in non-small-cell lung cancer

S. Agelaki, D. Mavroudis, V. Georgoulias, 2011, Cancer Chemotherapy and Pharmacology.

A phase I study of oral metronomic vinorelbine plus capecitabine in patients with metastatic breast cancer.

V. Georgoulias, S. Agelaki, A. Kalykaki, 2009, Journal of Clinical Oncology.

Cancer Management and Research Dovepress Cancer Therapy and Cardiovascular Risk: Focus on Bevacizumab

P. Economopoulou, A. Kotsakis, N. Kentepozidis, 2022 .

The optimum duration of front-line chemotherapy.

V. Georgoulias, A. Kotsakis, 2014, The Lancet. Oncology.

Prognostic Role of Circulating Tumor Cells in Patients with Metastatic Castration-Resistant Prostate Cancer Receiving Cabazitaxel: A Prospective Biomarker Study

G. Kallergi, V. Georgoulias, Z. Zafeiriou, 2023, Cancers.

Dynamic changes of phenotypically different circulating tumor cells sub-populations in patients with recurrent/refractory small cell lung cancer treated with pazopanib

V. Georgoulias, M. Plataki, S. Apostolaki, 2018, Scientific Reports.

CD8+ PD-1+ T-cells and PD-L1+ circulating tumor cells in chemotherapy-naïve non-small cell lung cancer: towards their clinical relevance?

G. Kallergi, V. Georgoulias, A. Koutsopoulos, 2019, Therapeutic advances in medical oncology.

Investigation of Clinically Significant Molecular Aberrations in Patients with Prostate Cancer: Implications for Personalized Treatment, Prognosis and Genetic Testing

D. Giannakis, I. Boukovinas, A. Psyrri, 2023, International journal of molecular sciences.

A phase II trial evaluating the clinical and immunologic response of HLA-A2(+) non-small cell lung cancer patients vaccinated with an hTERT cryptic peptide.

D. Mavroudis, V. Georgoulias, E. Papadimitraki, 2014, Lung cancer.

The optimum duration of front-line chemotherapy.

V. Georgoulias, A. Kotsakis, 2014, The Lancet. Oncology.

Cancer therapy and cardiovascular risk: focus on bevacizumab

P. Economopoulou, A. Kotsakis, N. Kentepozidis, 2015, Cancer management and research.

Phase II randomized trial of radiotherapy (RT), cetuximab (E), and pemetrexed (Pem) with or without bevacizumab (B) in locally advanced squamous cell carcinoma of the head and neck (SCCHN).

D. Heron, J. Grandis, R. Ferris, 2010 .

31st Annual Meeting and Associated Programs of the Society for Immunotherapy of Cancer (SITC 2016): part one

Charles J. Vaske, Rohan N. Borkar, David M. Schauder, 2016, Journal for ImmunoTherapy of Cancer.

Phase II trial of everolimus in patients with previously treated recurrent or metastatic head and neck squamous cell carcinoma

J. Grandis, A. Argiris, J. Bauman, 2016, Head & neck.

Phase II Study of Everolimus (RAD001) in Previously Treated Small Cell Lung Cancer

S. Dacic, A. Argiris, C. Belani, 2010, Clinical Cancer Research.

MINOAS: A Single-arm Translational Phase II Trial of FOLFIRI Plus Aflibercept as First-line Therapy in Unresectable, Metastatic Colorectal Cancer

V. Georgoulias, J. Souglakos, A. Matikas, 2019, Targeted Oncology.

Abstract 5158: Detection of EGFR mutations in plasma cfDNA and paired CTCs of NSCLC patients before and after osimertinib therapy using crystal digital PCR

V. Georgoulias, E. Lianidou, A. Kotsakis, 2022, Cancer Research.

Management of Resistance to Crizotinib in Anaplastic Lymphoma Kinase-Positive Non-Small-cell Lung Cancer.

V. Georgoulias, A. Matikas, A. Kotsakis, 2016, Clinical lung cancer.

Cetuximab (C) and bevacizumab (B) in patients with recurrent or metastatic head and neck squamous cell carcinoma: An updated report.

J. Grandis, A. Argiris, F. Worden, 2009, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Chemotherapy with gemcitabine, cisplatin, and docetaxel in the treatment for patients with muscle-invasive bladder cancer: a multicenter phase II study of the Hellenic Oncology Research Group (HORG)

D. Mavroudis, V. Georgoulias, I. Boukovinas, 2012, Cancer Chemotherapy and Pharmacology.

Functional Analysis of Viable Circulating Tumor Cells from Triple-Negative Breast Cancer Patients Using TetherChip Technology

G. Kallergi, V. Georgoulias, C. Alix-Panabières, 2023, Cells.