A. Rapti

发表

Effectiveness of amiodarone therapy in patients with severe congestive heart failure and intolerance to metoprolol.

M. Anastasiou-Nana, J. Terrovitis, J. Nanas, 2002, The American journal of cardiology.

Docetaxel in combination with gemcitabine plus rhG-CSF support as second-line treatment in non-small cell lung cancer. A multicenter phase II study.

S. Agelaki, V. Georgoulias, N. Vardakis, 2001, Lung cancer.

Effects of amiodarone on refractory myocardial infarction: Experimental study

M. Anastasiou-Nana, J. Nanas, S. Nanas, 1994 .

Hormonal profile in patients with congestive heart failure.

M. Anastasiou-Nana, J. Nanas, E. Tsagalou, 2003, International journal of cardiology.

Docetaxel plus cisplatin versus docetaxel plus gemcitabine chemotherapy in advanced non-small cell lung cancer: A preliminary analysis of a multicenter randomized phase II trial

V. Georgoulias, G. Samonis, A. Rapti, 1999 .

Effects of amiodarone on refractory ventricular fibrillation in acute myocardial infarction: experimental study.

M. Anastasiou-Nana, J. Nanas, S. Nanas, 1994, Journal of the American College of Cardiology.

Lowering of furosemide dosage after clinical stabilization in patients with congestive heart failure

M. Anastasiou-Nana, J. Terrovitis, J. Nanas, 2003, Acta cardiologica.

A phase II study of docetaxel (D) and gemcitabine (G) as second-line treatment in patients (pts) with advanced non-small cell lung cancer (NSCLC)

S. Agelaki, V. Georgoulias, K. Kalbakis, 1999 .

Comparison of docetaxel/cisplatin to docetaxel/gemcitabine as first-line treatment of advanced non-small cell lung cancer: early results of a randomized trial.

V. Georgoulias, G. Samonis, D. Mavroudis, 2001, Lung cancer.

The efficacy of the high volume counterpulsation technique at very low levels of aortic pressure.

C. Charitos, J. Nanas, S. Nanas, 1998, The Journal of cardiovascular surgery.

A multicenter randomized phase II study of the irinotecan/gemcitabine doublet versus irinotecan monotherapy in previously treated patients with extensive stage small-cell lung cancer.

V. Georgoulias, S. Agelaki, I. Varthalitis, 2009, Lung cancer.

Vinorelbine-Based Regimens as Salvage Treatment in Patients with Advanced Non-Small Cell Lung Cancer: Two Parallel Multicenter Phase II Trials

S. Agelaki, V. Georgoulias, J. Souglakos, 2001, Oncology.

Pemetrexed versus erlotinib in pretreated patients with advanced non–small cell lung cancer: A Hellenic Oncology Research Group (HORG) randomized phase 3 study

D. Mavroudis, V. Georgoulias, G. Samonis, 2013, Cancer.

TCCAAATGAGCTGGCAAGTG TCAGAGCCTGTGTTTCTACCAA TCCCAAACACTCAGTGAAACAAA TGGTCTCACAGGACCACTGATT Exon 19 EGFR AAATAATCAGTGTGATTCGTGGAG GAGGCCAGTGCTGTCTCTAAGG GAGGCCAGTGCTGTCTCTAAGG TGTGGAGATGAGCAGGGTCT Exon 21 EGFR GCAGCGGGTTACATCTTCTTTC GCTCAGAGCCTGGCATGAA CAGCTCTGGCTCACACTACCAG CATCCTCCCCTGCATGTGT Exon

D. Mavroudis, V. Georgoulias, G. Samonis, 2013 .

Combination of vinorelbine plus gemcitabine in previously treated patients with small cell lung cancer: a multicentre phase II study.

V. Georgoulias, N. Tzanakis, A. Kalykaki, 2005, Lung cancer.

Six minute walking test and carbon monoxide diffusing capacity for non-small cell lung cancer: easy performed tests in every day practice.

Konstantinos Zarogoulidis, Theodora Kerenidi, P. Zarogoulidis, 2012, Journal of thoracic disease.

Clinical differences between influenza A (H1N1) virus and respiratory infection between the two waves in 2009 and 2010

P. Zarogoulidis, A. Kallianos, G. Trakada, 2012, International journal of general medicine.

Clinical differences between influenza A ( H 1 N 1 ) virus and respiratory infection between the two waves in 2009 and 2010

P. Zarogoulidis, A. Kallianos, G. Trakada, 2012 .

Platinum-based and non-platinum-based chemotherapy in advanced non-small-cell lung cancer: a randomised multicentre trial

I. Vlachonikolis, V. Georgoulias, A. Rapti, 2001, The Lancet.

Second-line treatment with irinotecan plus cisplatin vs cisplatin of patients with advanced non-small-cell lung cancer pretreated with taxanes and gemcitabine: a multicenter randomised phase II study

K. Syrigos, K. Syrigos, G. Samonis, 2005, British Journal of Cancer.

Second-line treatment with vinorelbine and carboplatin in patients with advanced non-small cell lung cancer. A multicenter phase II study.

S. Agelaki, V. Georgoulias, J. Souglakos, 2001, Lung cancer.

Management and survival of patients with lung cancer in Scotland diagnosed in 1995 : results of a national population based study

A. Gregor, D. Brewster, R. Milroy, 2002 .

THE LUNG CANCER PARADOX: TIME FOR ACTION in Scotland Platinum-based and non-platinum-based chemotherapy in advanced non-small-cell lung cancer: a randomised multicentre trial

A. Gregor, D. Brewster, R. Milroy, 2002 .