Dong-Mee Lim

发表

Omega-3 Polyunsaturated Fatty Acids May Attenuate Streptozotocin-Induced Pancreatic β-Cell Death via Autophagy Activation in Fat1 Transgenic Mice

W. Hwang, Seung-Yun Han, Jaeku Kang, 2015, Endocrinology and metabolism.

Circulating ApoJ is closely associated with insulin resistance in human subjects.

C. Mantzoros, K. Park, R. Henry, 2018, Metabolism: clinical and experimental.

Effects of 6 Months of Dapagliflozin Treatment on Metabolic Profile and Endothelial Cell Dysfunction for Obese Type 2 Diabetes Mellitus Patients without Atherosclerotic Cardiovascular Disease

W. Hwang, J. Hong, Keun-Young Park, 2020, Journal of obesity & metabolic syndrome.

Exendin-4 Protects Oxidative Stress-Induced β-Cell Apoptosis through Reduced JNK and GSK3β Activity

Ju-Young Kim, H. Baik, S. Lee, 2010, Journal of Korean medical science.

A Multicenter, Randomized, Controlled Trial for Assessing the Usefulness of Suppressing Thyroid Stimulating Hormone Target Levels after Thyroid Lobectomy in Low to Intermediate Risk Thyroid Cancer Patients (MASTER): A Study Protocol

Bo Hyun Kim, Yong Joon Suh, Ha Kyoung Park, 2021, Endocrinology and metabolism.

A comparison study on efficacy, insulin sensitivity and safety of Glimepiride/Metformin fixed dose combination versus glimepiride single therapy on type 2 diabetes mellitus patients with basal insulin therapy

S. Chun, Sang Jin Kim, K. Park, 2019 .

Serum Vitamin D Status and Its Relationship to Metabolic Parameters in Patients with Type 2 Diabetes Mellitus

G. Koh, Jae-Geun Lee, Sang Ah Lee, 2012, Chonnam medical journal.

Response: Basal C-peptide Level as a Surrogate Marker of Subclinical Atherosclerosis in Type 2 Diabetic Patients (Diabetes Metab J 2011;35:41-9)

Gwangpyo Koh, Keun-Young Park, Dong-Mee Lim, 2011, Diabetes & metabolism journal.

TGGCCGTGAGCATCCTCTGCC CGTGGCCCTGTGGCAGCCGA CCCTTGCTGAGCAGATCCCGTC GCAAGGTCAGGGGAATGGAC GGCTCATGGGTGGCTATTTCTGC TGCTGAGGCAGGACACTGCTTC CCCGGACACAGCTTGGCTTCC CAGGCCTGGCCTCCACGCAG GGCCCAGTACACCCACACGGG GGCCCAGTACACCCACACGGG GCCTTGTTTGCCTCTGCAGTG GCGTGGGTTGCGTTTGCCTGC GGGCTCGTTAGGAGCTGAGGG GGGATGGTGAAGC

Nam Huh, K. Park, Dong-Mee Lim, 2008 .

Hepatocyte nuclear factor 1-alpha mutation in normal glucose-tolerant subjects and early-onset type 2 diabetic patients

Nam Huh, K. Park, Dong-Mee Lim, 2008, The Korean journal of internal medicine.

Effects of lacidipine on vascular responses in patients with coronary artery disease.

J. Bae, E. Bassenge, Y. Synn, 2005, International journal of cardiology.

Exendin-4 increases bone mineral density in type 2 diabetic OLETF rats potentially through the down-regulation of SOST/sclerostin in osteocytes.

L. Bonewald, Ju-Young Kim, S. Lee, 2013, Life sciences.

Correlations between Glucagon Stimulated C-peptide Levels and Microvascular Complications in Type 2 Diabetes Patients

Ji-young Kim, Gwangpyo Koh, Hye-jin Yoon, 2012, Diabetes & metabolism journal.

Serum Transferrin Predicts New-Onset Type 2 Diabetes in Koreans: A 4-Year Retrospective Longitudinal Study

S. E. Park, Won-Young Lee, E. Rhee, 2020, Endocrinology and metabolism.

Exendin-4 Protects Oxidative Stress-Induced β-Cell Apoptosis through Reduced JNK and GSK3β Activity

Ju-Young Kim, H. Baik, S. Lee, 2010, Journal of Korean medical science.

A Case of Prolonged Hypoglycemia Post Topiramate Treatment an Anti-convulsant, in a Type 2 Diabetic Patient

Keun-Young Park, Dong-Mee Lim, Byung-Joon Kim, 2009 .

Adrenocortical Insufficiency due to Spontaneous Bilateral Adrenal Hemorrhage Presented as Acute Abdominal Pain

Dong Ho Kim, J. Hong, Keun-Young Park, 2014 .

A Case of Thyroid Storm with Delayed Diagnosis in Old Aged Person with Parkinson's Disease

Mi-Young Lee, W. Hwang, H. Song, 2011 .

A Case of Coexistence of Parathyroid and Papillary Thyroid Carcinoma

Keun-Young Park, Dong-Mee Lim, Byung-Joon Kim, 2010 .

Basal C-peptide Level as a Surrogate Marker of Subclinical Atherosclerosis in Type 2 Diabetic Patients

Gwangpyo Koh, Keun-Young Park, Dong-Mee Lim, 2011, Diabetes & metabolism journal.

Hypothalamic Hypopituitarism Caused by Pituitary Stalk Dysgenesis

Hye-jin Yoon, Y. Um, Keun-Young Park, 2013 .

Effects of Short-Term Exenatide Treatment on Regional Fat Distribution, Glycated Hemoglobin Levels, and Aortic Pulse Wave Velocity of Obese Type 2 Diabetes Mellitus Patients

W. Hwang, Dong Ho Kim, J. Hong, 2016, Endocrinology and metabolism.

Cardiovascular Risk according to the Components of Metabolic Syndrome in Type 2 Diabetes

G. Koh, Keun-Young Park, Dong-Mee Lim, 2009 .

Difference in protective effects of GIP and GLP-1 on endothelial cells according to cyclic adenosine monophosphate response.

Ju-Young Kim, W. Hwang, Keun-Young Park, 2017, Experimental and therapeutic medicine.

Response: Effects of 6 Months of Dapagliflozin Treatment on Metabolic Profile and Endothelial Cell Dysfunction for Obese Type 2 Diabetes Mellitus Patients without Atherosclerotic Cardiovascular Disease (J Obes Metab Syndr 2020;29:215-21)

W. Hwang, J. Hong, Keun-Young Park, 2021, Journal of obesity & metabolic syndrome.

Exendin-4 protects against sulfonylurea-induced β-cell apoptosis.

Ju-Young Kim, H. Baik, S. Lee, 2012, Journal of pharmacological sciences.

Exendin-4 Protects Against Sulfonylurea-Induced β-Cell Apoptosis.

Ju-Young Kim, H. Baik, S. Lee, 2012, Journal of pharmacological sciences.

Clinical Characteristics of Type 2 Diabetes Patients according to Family History of Diabetes

G. Koh, K. Park, Dong-Mee Lim, 2010, Korean diabetes journal.

The Effect of Vildagliptin on Visfatin in Korean Patients with Type 2 Diabetes: A Multicenter, Double-Blind, Randomized, Placebo-Controlled, Prospective Study

Y. Kim, Sang Jin Kim, K. Park, 2015 .

The Biochemical Markers of Coronary Heart Disease Correlates Better to Metabolic Syndrome Defined by WHO than by NCEP-ATP III or IDF in Korean Type 2 Diabetic Patients

G. Koh, Keun-Young Park, Dong-Mee Lim, 2008 .

Relationship between obesity indices and cardiovascular risk score in Korean type 2 diabetes patients

G. Koh, Sang Ah Lee, Keun-Young Park, 2013 .

Basal C-peptide Level as a Surrogate Marker of Subclinical Atherosclerosis in Type 2 Diabetic Patients

Gwangpyo Koh, Keun-Young Park, Dong-Mee Lim, 2011, Diabetes & metabolism journal.

Is Maintaining Thyroid-Stimulating Hormone Effective in Patients Undergoing Thyroid Lobectomy for Low-Risk Differentiated Thyroid Cancer? A Systematic Review and Meta-Analysis

S. Kim, K. Chung, Ho-Ryun Won, 2022, Cancers.

Difference in protective effects of GIP and GLP-1 on endothelial cells according to cyclic adenosine monophosphate response.

Ju-Young Kim, W. Hwang, Keun-Young Park, 2017, Experimental and therapeutic medicine.

A Case of Adrenal Teratoma

Keun-Young Park, Dong-Mee Lim, Byung-Joon Kim, 2011 .

Exendin-4 Protects Against Sulfonylurea-Induced β-Cell Apoptosis.

Ju-Young Kim, H. Baik, S. Lee, 2012, Journal of pharmacological sciences.

Exendin-4 protects against sulfonylurea-induced β-cell apoptosis.

Keun-Young Park, Dong-Mee Lim, K. Choi, 2012, Journal of pharmacological sciences.