R. W. Hipkin

发表

Endocannabinoid 2-arachidonyl glycerol is a full agonist through human type 2 cannabinoid receptor: antagonism by anandamide.

S. Narula, C. Lunn, D. Lundell, 2000, Molecular pharmacology.

Triaryl bis-sulfones as a new class of cannabinoid CB2 receptor inhibitors: identification of a lead and initial SAR studies.

S. Narula, C. Lunn, D. Lundell, 2005, Bioorganic & medicinal chemistry letters.

Immunohistochemical localization of somatostatin receptors sst2A in human tumors.

J. Laissue, A. Kappeler, J. Reubi, 1998, The American journal of pathology.

Murine CXCR1 Is a Functional Receptor for GCP-2/CXCL6 and Interleukin-8/CXCL8*

G. Opdenakker, S. Lira, J. Van Damme, 2007, Journal of Biological Chemistry.

Diaminocyclobutenediones as potent and orally bioavailable CXCR2 receptor antagonists: SAR in the phenolic amide region.

M. Dwyer, D. Rindgen, D. Lundell, 2009, Bioorganic & medicinal chemistry letters.

Fluoroalkyl alpha side chain containing 3,4-diamino-cyclobutenediones as potent and orally bioavailable CXCR2-CXCR1 dual antagonists.

M. Dwyer, D. Rindgen, D. Lundell, 2009, Bioorganic & medicinal chemistry letters.

3,4-Diamino-1,2,5-thiadiazole as potent and selective CXCR2 antagonists.

Junying Zheng, J. Fossetta, D. Lundell, 2009, Bioorganic & medicinal chemistry letters.

Synthesis and structure-activity relationships of heteroaryl substituted-3,4-diamino-3-cyclobut-3-ene-1,2-dione CXCR2/CXCR1 receptor antagonists.

M. Dwyer, D. Rindgen, J. Fossetta, 2008, Bioorganic & medicinal chemistry letters.

3,4-Diamino-2,5-thiadiazole-1-oxides as potent CXCR2/CXCR1 antagonists.

Junying Zheng, J. Baldwin, D. Rindgen, 2008, Bioorganic & medicinal chemistry letters.

Human interferon-inducible 10-kDa protein and human interferon-inducible T cell alpha chemoattractant are allotopic ligands for human CXCR3: differential binding to receptor states.

S. Narula, J. Fine, P. Zavodny, 2001, Molecular pharmacology.

Pituitary Somatostatin Receptor (sst)1-5 Expression during Rat Development: Age-Dependent Expression of sst21.

D. K. Reed, A. Korytko, L. Cuttler, 1999, Endocrinology.

Immunohistochemical Localization of Somatostatin Receptor SST2A in the Rat Pancreas.

É. Mezey, B. Hunyady, A. Schonbrunn, 1997, Endocrinology.

Erratum: Immunohistochemical localization of somatostatin receptor sst2A in the rat pancreas (Endocrinology (1997) 138 (2632-2635))

É. Mezey, B. Hunyady, A. Schonbrunn, 1997 .

Pharmacological characterization of the chemokine receptor, hCCR1 in a stable transfectant and differentiated HL‐60 cells: antagonism of hCCR1 activation by MIP‐1β

Martin A. Schwarz, G. Deno, J. Fine, 2002, British journal of pharmacology.

A Novel, Orally Active CXCR1/2 Receptor Antagonist, Sch527123, Inhibits Neutrophil Recruitment, Mucus Production, and Goblet Cell Hyperplasia in Animal Models of Pulmonary Inflammation

M. Billah, J. Hey, J. Phillips, 2007, Journal of Pharmacology and Experimental Therapeutics.

Opioid Receptor Antagonists for Gastrointestinal Dysfunction

R. Dolle, R. W. Hipkin, R. Hipkin, 2010 .

Non-aromatic A-ring replacement in the triaryl bis-sulfone CB2 receptor inhibitors.

A. Malikzay, L. Favreau, C. Lunn, 2010, Bioorganic & medicinal chemistry letters.

Triaryl bis-sulfones as cannabinoid-2 receptor ligands: SAR studies.

Jie Wu, C. Lunn, N. Shih, 2005, Bioorganic & medicinal chemistry letters.

Follitropin (FSH) and a phorbol ester stimulate the phosphorylation of the FSH receptor in intact cells.

M. Ascoli, J. Sánchez-Yagüe, J. Quintana, 1994, The Journal of biological chemistry.

Pharmacological Characterization of Sch527123, a Potent Allosteric CXCR1/CXCR2 Antagonist

M. Billah, M. Dwyer, J. Fossetta, 2007, Journal of Pharmacology and Experimental Therapeutics.

CXCR2 antagonists for the treatment of pulmonary disease.

J. Phillips, D. Lundell, D. Lundell, 2009, Pharmacology & therapeutics.

Sch35966 is a potent, selective agonist at the peripheral cannabinoid receptor (CB2) in rodents and primates

C. Lunn, G. Deno, J. Kozlowski, 2007, British journal of pharmacology.

Pharmacological Characterization of Sch 527123 , a Potent Allosteric CXCR 1 / CXCR 2 Antagonist

M. Billah, M. Dwyer, J. Fossetta, 2007 .

Characterization of Peripheral Human Cannabinoid Receptor (hCB2) Expression and Pharmacology Using a Novel Radioligand, [35S]Sch225336*

S. Narula, J. Jackson, Shu-Cheng Chen, 2006, Journal of Biological Chemistry.

Pharmacological characterization of human S1P4 using a novel radioligand, [4,5‐3H]‐dihydrosphingosine‐1‐phosphate

J. Fossetta, C. Lunn, D. Lundell, 2004, British journal of pharmacology.

Cloning and Pharmacological Characterization of CXCR1 and CXCR2 from Macaca fascicularis

B. Wilburn, G. Deno, J. Fine, 2004, Journal of Pharmacology and Experimental Therapeutics.

CXCR 1 Rat AATGCTGCCCACTGGAGAGT CAGCCTGCCTGTTGGTCAT CXCR 2 Rat GGGTGGATAATTTCAGCCTTGA AGGGCGGGTCAGAACTGTAA CXCR 1 Rabbit TGGAAGTAAACGTATGGAATATGACTGA CAGGAGGCATACCAGTAGCATTT CXCR 2 Rabbit TTCGGCGATTTCAGCAATTAC GCTGTTGGTTTCCAGAGATTCTG

B. Wilburn, G. Deno, J. Fine, 2004 .

The study of CXCR3 and CCR7 pharmacology using [35S]GTPgammaS exchange assays in cell membranes and permeabilized peripheral blood lymphocytes.

P. Zavodny, W. Gonsiorek, R. W. Hipkin, 2003, Journal of immunological methods.

Human chorionic gonadotropin (CG)- and phorbol ester-stimulated phosphorylation of the luteinizing hormone/CG receptor maps to serines 635, 639, 649, and 652 in the C-terminal cytoplasmic tail.

M. Ascoli, R. W. Hipkin, Z. Wang, 1995, Molecular endocrinology.

Type 1 and 2 isoenzymes of cAMP-dependent protein kinase in Leydig cell steroidogenesis

W. H. Moger, R. W. Hipkin, 1991, Molecular and Cellular Endocrinology.

Immunohistochemical detection of somatostatin sst2a receptors in the lymphatic, smooth muscular, and peripheral nervous systems of the human gastrointestinal tract: facts and artifacts.

J. Laissue, J. Reubi, B. Waser, 1999, The Journal of clinical endocrinology and metabolism.

A novel cannabinoid CB 2 receptor-selective inverse agonist blocks leukocyte recruitment in vivo

S. Narula, J. Jackson, C. Lunn, 2005 .

Homologous and heterologous regulation of somatostatin receptor 2.

G. Elberg, A. Schonbrunn, R. W. Hipkin, 2002, Molecular endocrinology.

Protein Kinase C Activation Stimulates the Phosphorylation and Internalization of the sst2A Somatostatin Receptor*

A. Schonbrunn, R. W. Hipkin, Yining Wang, 2000, The Journal of Biological Chemistry.

Agonist-induced phosphorylation of the luteinizing hormone/chorionic gonadotropin receptor expressed in a stably transfected cell line.

M. Ascoli, J. Sánchez-Yagüe, R. W. Hipkin, 1993, Molecular endocrinology.

Identification and characterization of a luteinizing hormone/chorionic gonadotropin (LH/CG) receptor precursor in a human kidney cell line stably transfected with the rat luteal LH/CG receptor complementary DNA.

M. Ascoli, J. Sánchez-Yagüe, R. W. Hipkin, 1992, Molecular endocrinology.

Biology and therapeutic potential of cannabinoid CB2 receptor inverse agonists

C. Lunn, D. Lundell, Brian J. Lavey, 2008, British journal of pharmacology.

Expansion of SAR studies on triaryl bis sulfone cannabinoid CB2 receptor ligands.

A. Malikzay, C. Lunn, D. Lundell, 2010, Bioorganic & medicinal chemistry letters.

Disruption of CCL21-Induced Chemotaxis In Vitro and In Vivo by M3, a Chemokine-Binding Protein Encoded by Murine Gammaherpesvirus 68

A. Alcamí, K. Jensen, S. Lira, 2003, Journal of Virology.