T. Valente

发表

CD200R1 and CD200 expression are regulated by PPAR‐γ in activated glial cells

J. Serratosa, J. Saura, C. Solà, 2014, Glia.

CCAAT/enhancer binding protein δ regulates glial proinflammatory gene expression

J. Serratosa, J. Saura, C. Solà, 2013, Neurobiology of Aging.

Alterations in CD200-CD200R1 System during EAE Already Manifest at Presymptomatic Stages

J. Serratosa, J. Saura, C. Solà, 2017, Front. Cell. Neurosci..

SSAO and Aβ in the vascular damage of the temporal cortex from Alzheimer and Alzheimer with diabetes patients

N. Durany, M. Unzeta, A. Gella, 2013 .

The Antioxidant Effect of LMN Diet, Rich in Polyphenols and Polyunsaturated Fatty Acids, in Alzheimer’s Disease

M. Portero-Otín, R. Pamplona, Irene Bolea, 2015 .

GCCTGTGAGACCTTTG GCATTGGAAGTGAAGCGTTTC GAATTGAAAGCCCTCT CCCCAAAGATAGCATCTGGA CGCGACGTGGAA ACCGCCTGGAGTTCTGGAA GTGTGACGTTCCCATTA CAGCACGAGGCTTTTTTGTTG TTTGGTAGCATCCATC CCGGAGAGGAGACTTCACAG CAAGAACAGCAACGAGTAC TGCGCAGGCGGTCATT TGAGCGACGAGTACAAGA GTCAGCTCCAGCACCTTGTG CGACTCCTGCCATGT GAAGAGGTCGGCGAAGAGT

J. Serratosa, J. Saura, C. Solà, 2022 .

Passive Experimental Autoimmune Encephalomyelitis in C57BL/6 with MOG: Evidence of Involvement of B Cells

A. Saiz, J. Saura, F. Graus, 2012, PloS one.

SSAO/VAP‐1 protein expression during mouse embryonic development

M. Unzeta, M. Solé, T. Valente, 2008, Developmental dynamics : an official publication of the American Association of Anatomists.

Zac1 is up-regulated in neural cells of the limbic system of mouse brain following seizures that provoke strong cell activation

A. Bellmann, I. Ferrer, L. Journot, 2004, Neuroscience.

Expression pattern of Zac1 mouse gene, a new zinc-finger protein that regulates apoptosis and cellular cycle arrest, in both adult brain and along development

C. Auladell, T. Valente, 2001, Mechanisms of Development.

CCAAT/enhancer binding protein δ is a transcriptional repressor of α-synuclein

M. Marti, O. Bachs, M. Ezquerra, 2019, Cell Death & Differentiation.

Zac1 is expressed in progenitor/stem cells of the neuroectoderm and mesoderm during embryogenesis: Differential phenotype of the Zac1‐expressing cells during development

F. Junyent, C. Auladell, T. Valente, 2005, Developmental dynamics : an official publication of the American Association of Anatomists.

C/EBPβ expression in activated microglia in amyotrophic lateral sclerosis

J. Serratosa, J. Saura, J. Tusell, 2012, Neurobiology of Aging.

Correlates of cerebrospinal fluid levels of oligomeric- and total-α-synuclein in premotor, motor and dementia stages of Parkinson’s disease

J. Molinuevo, E. Tolosa, F. Valldeoriola, 2015, Journal of Neurology.

A diet enriched in polyphenols and polyunsaturated fatty acids, LMN diet, induces neurogenesis in the subventricular zone and hippocampus of adult mouse brain.

M. Boada, Irene Bolea, M. Unzeta, 2009, Journal of Alzheimer's disease : JAD.

LMN diet, rich in polyphenols and polyunsaturated fatty acids, improves mouse cognitive decline associated with aging and Alzheimer's disease

M. Boada, Irene Bolea, R. M. Escorihuela, 2012, Behavioural Brain Research.

Role of the CD200-CD200R Axis During Homeostasis and Neuroinflammation

B. Castellano, B. González, G. Manich, 2019, Neuroscience.

TRPV2: A Key Player in Myelination Disorders of the Central Nervous System

B. Castellano, B. González, A. Perálvarez-Marín, 2022, International journal of molecular sciences.

CCAAT/Enhancer binding protein β regulates prostaglandin E synthase expression and prostaglandin E2 production in activated microglial cells

J. Saura, C. Solà, M. Straccia, 2013, Glia.

Immunohistochemical analysis of human brain suggests pathological synergism of Alzheimer's disease and diabetes mellitus

N. Durany, M. Unzeta, A. Gella, 2010, Neurobiology of Disease.

Immunohistochemical study of semicarbazide‐sensitive amine oxidase/vascular adhesion protein‐1 in the hippocampal vasculature: Pathological synergy of Alzheimer's disease and diabetes mellitus

N. Durany, M. Unzeta, A. Gella, 2012, Journal of neuroscience research.

Myeloid C/EBPβ deficiency reshapes microglial gene expression and is protective in experimental autoimmune encephalomyelitis

A. Valledor, J. Serratosa, J. Saura, 2017, Journal of Neuroinflammation.

CD200 is up-regulated in R6/1 transgenic mouse model of Huntington's disease

C. Solà, J. Canals, A. Miguez, 2019, PloS one.

Modulation of catecholaminergic and cholinergic neurons in mice fed with LMN diet, rich in polyphenols and polyunsaturated fatty acids

M. Boada, Irene Bolea, M. Unzeta, 2009, Alzheimer's & Dementia.

Monoamine oxidase‐B activity is not involved in the neuroinflammatory response elicited by a focal freeze brain injury

A. Quintana, E. Sanz, M. Unzeta, 2009, Journal of neuroscience research.

Postnatal Development of Zinc-Rich Terminal Fields in the Brain of the Rat

C. Auladell, T. Valente, J. Pérez‐clausell, 2002, Experimental Neurology.

Catecholaminergic and cholinergic systems of mouse brain are modulated by LMN diet, rich in theobromine, polyphenols and polyunsaturated fatty acids.

Irene Bolea, P. Sun, G. Esteban, 2015, Food & function.

Myeloid C/EBPβ deficiency reshapes microglial gene expression and is protective in experimental autoimmune encephalomyelitis

A. Valledor, J. Serratosa, J. Saura, 2017, Journal of Neuroinflammation.

LMN diet, rich in polyphenols and polyunsaturated fatty acids, improves mouse cognitive decline associated with aging and Alzheimer's disease

M. Boada, Irene Bolea, R. M. Escorihuela, 2012, Behavioural Brain Research.

A diet enriched in polyphenols and polyunsaturated fatty acids, LMN diet, induces neurogenesis in the subventricular zone and hippocampus of adult mouse brain.

M. Boada, Irene Bolea, M. Unzeta, 2009, Journal of Alzheimer's disease : JAD.

Altered expression of the immunoregulatory ligand-receptor pair CD200-CD200R1 in the brain of Parkinson’s disease patients

M. Marti, M. Ezquerra, Y. Compta, 2022, NPJ Parkinson's disease.

From Mouse to Human: Comparative Analysis between Grey and White Matter by Synchrotron-Fourier Transformed Infrared Microspectroscopy

B. Castellano, B. González, N. Benseny-Cases, 2020, Biomolecules.

Developmental Expression of ZnT3 in Mouse Brain: Correlation between the Vesicular Zinc Transporter Protein and Chelatable Vesicular Zinc (CVZ) Cells. Glial and Neuronal CVZ Cells Interact

C. Auladell, T. Valente, 2002, Molecular and Cellular Neuroscience.