M. Agelidou

发表

A phase II study of paclitaxel (P) and carboplatin (C) as second-line treatment in patients (PTS) with small-cell lung cancer (SCLC)

S. Agelaki, V. Georgoulias, G. Samonis, 1999 .

Cisplatin plus etoposide chemotherapy followed by thoracic irradiation and paclitaxel plus cisplatin consolidation therapy for patients with limited stage small cell lung carcinoma.

V. Georgoulias, E. Tsaroucha, C. Kouroussis, 2006, Lung cancer.

Local peritonitis as the first manifestation of Crohn's disease in a child

G. Vaos, K. Kambouri, S. Gardikis, 2014, Journal of Indian Association of Pediatric Surgeons.

A multicenter randomized clinical trial comparing paclitaxel-cisplatin-etoposide versus cisplatin-etoposide as first-line treatment in patients with small-cell lung cancer.

V. Georgoulias, D. Mavroudis, S. Kakolyris, 2001, Annals of oncology : official journal of the European Society for Medical Oncology.

Phase III study comparing sequential versus alternate administration of cisplatin-etoposide and topotecan as first-line treatment in small cell lung cancer.

S. Agelaki, D. Mavroudis, V. Georgoulias, 2010, Anticancer research.

Sequential versus alternating administration of cisplatin/etoposide and topotecan as first-line treatment in extensive-stage small-cell lung cancer: preliminary results of a Phase III Trial of the Hellenic Oncology Research Group.

D. Mavroudis, V. Georgoulias, M. Ignatiadis, 2005, Clinical lung cancer.

Pemetrexed versus erlotinib in pretreated patients with advanced non–small cell lung cancer: A Hellenic Oncology Research Group (HORG) randomized phase 3 study

D. Mavroudis, V. Georgoulias, G. Samonis, 2013, Cancer.

TCCAAATGAGCTGGCAAGTG TCAGAGCCTGTGTTTCTACCAA TCCCAAACACTCAGTGAAACAAA TGGTCTCACAGGACCACTGATT Exon 19 EGFR AAATAATCAGTGTGATTCGTGGAG GAGGCCAGTGCTGTCTCTAAGG GAGGCCAGTGCTGTCTCTAAGG TGTGGAGATGAGCAGGGTCT Exon 21 EGFR GCAGCGGGTTACATCTTCTTTC GCTCAGAGCCTGGCATGAA CAGCTCTGGCTCACACTACCAG CATCCTCCCCTGCATGTGT Exon

D. Mavroudis, V. Georgoulias, G. Samonis, 2013 .

Docetaxel versus docetaxel plus cisplatin as front-line treatment of patients with advanced non-small-cell lung cancer: a randomized, multicenter phase III trial.

K. Syrigos, V. Georgoulias, A. Alegakis, 2004, Journal of clinical oncology : official journal of the American Society of Clinical Oncology.

Combination of vinorelbine plus gemcitabine in previously treated patients with small cell lung cancer: a multicentre phase II study.

V. Georgoulias, N. Tzanakis, A. Kalykaki, 2005, Lung cancer.

First-line treatment of advanced non-small-cell lung cancer with docetaxel and cisplatin: a multicenter phase II study.

V. Georgoulias, C. Papadimitriou, S. Kakolyris, 1998, Annals of oncology : official journal of the European Society for Medical Oncology.

Cisplatin-etoposide alternating with topotecan in patients with extensive stage small cell lung cancer (SCLC). A multicenter phase II study.

D. Mavroudis, N. Tzanakis, G. Samonis, 2002, Lung cancer.

A multicenter phase II study of sequential vinorelbine and cisplatin followed by docetaxel and gemcitabine in patients with advanced non-small cell lung cancer.

V. Georgoulias, A. Pallis, A. Kotsakis, 2006, Lung cancer.

Docetaxel versus docetaxel/cisplatin in patients with advanced non-small-cell lung cancer: preliminary analysis of a multicenter, randomized phase III study.

V. Georgoulias, N. Samaras, A. Pallis, 2003, Clinical lung cancer.

Docetaxel versus docetaxel plus gemcitabine as front-line treatment of patients with advanced non-small cell lung cancer: a randomized, multicenter phase III trial.

D. Mavroudis, V. Georgoulias, I. Boukovinas, 2008, Lung cancer.

A multicenter randomized phase III study comparing paclitaxel-cisplatin-etoposide (TEP) versus cisplatin-etoposide (EP) as front-line treatment in patients with small cell lung cancer (SCLC)

G. Samonis, N. Ziras, V. Georgoulias, 2000 .

Docetaxel plus cisplatin and bevacizumab for untreated patients with advanced/metastatic non-squamous non-small-cell lung cancer: a multicenter phase II study of the Hellenic Oncology Research Group

S. Agelaki, V. Georgoulias, A. Soultati, 2013, Cancer Chemotherapy and Pharmacology.

Rare benign tumours of the small intestine presened as acute abdomen in childhood

G. Tsikopoulos, M. Agelidou, M. Papoutsakis, 2003 .

Chemotherapy-induced neutropenia as a prognostic factor in patients with advanced non-small cell lung cancer treated with front-line docetaxel-gemcitabine chemotherapy.

S. Agelaki, V. Georgoulias, A. Kalykaki, 2008, Lung cancer.

Second-line treatment with irinotecan plus cisplatin vs cisplatin of patients with advanced non-small-cell lung cancer pretreated with taxanes and gemcitabine: a multicenter randomised phase II study

K. Syrigos, K. Syrigos, G. Samonis, 2005, British Journal of Cancer.

Pooled Analysis of Elderly Patients with Non-small Cell Lung Cancer Treated with Front Line Docetaxel/Gemcitabine Regimen: The Hellenic Oncology Research Group Experience

S. Agelaki, V. Georgoulias, I. Boukovinas, 2008, Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer.

Paclitaxel plus bevacizumab in patients with chemoresistant relapsed small cell lung cancer as salvage treatment: a phase II multicenter study of the Hellenic Oncology Research Group.

V. Georgoulias, G. Mountzios, N. Karachaliou, 2012, Lung cancer.

Docetaxel in combination with gemcitabine (DG) versus docetaxel (D) as front-line treatment in patients with advanced/metastatic NSCLC: A multicentre, randomized, phase III trial

V. Georgoulias, K. Syrigos, G. Samonis, 2005 .