Qian Wang

The connectome from the cerebral cortex to the viscera using viral transneuronal tracers

A. Manyande, Zhixiao Li, Yujuan Li, 2021 .

Altered Expression of Differential Genes in Thoracic Spinal Cord Involved in Experimental Cholestatic Itch Mouse Model

H. Xiang, Zhi-xiao Li, Ming Chen, 2018, Current Medical Science.

Proliferation and differentiation of neural stem cells co-cultured with cerebral microvascular endothelial cells after oxygen-glucose deprivation

Su-ming Zhang, L. Gan, Yongjie Xiong, 2013, Journal of Huazhong University of Science and Technology. Medical sciences = Hua zhong ke ji da xue xue bao. Yi xue Ying De wen ban = Huazhong keji daxue xuebao. Yixue Yingdewen ban.

Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time-points following cardiac ischemia/reperfusion

Zhi-gang He, H. Xiang, Yingle Chen, 2019, International journal of molecular medicine.

Quantitative proteomics reveal the alterations in the spinal cord after myocardial ischemia-reperfusion injury in rats

Q. Wang, Zhi-gang He, Hao-Long Zeng, 2019, International journal of molecular medicine.

Gene Forward ( 5 ' ‐ 3 ' ) Reverse ( 5 ' ‐ 3 ' ) SOS 1 GCTCGCCATTACATCTCCAACCTC CTTCCTGTGTCAGTGGTGGTGATG

Zhi-gang He, Hao-Long Zeng, H. Xiang, 2019 .

Interrogating autonomic peripheral nervous system neurons with viruses – A literature review

Boqi Xiang, Weiguo Xu, Maohui Feng, 2020, Journal of Neuroscience Methods.

Altered expression of itch-related mediators in the lower cervical spinal cord in mouse models of two types of chronic itch

C. Liu, Zhi-gang He, H. Xiang, 2019, International journal of molecular medicine.

Specific Patterns of Spinal Metabolite Ratio Underlying α-Me-5-HT-evoked Pruritus Compared with Compound 48/80 Based on Proton Nuclear Magnetic Resonance Spectroscopy

Q. Wang, Zhi-gang He, H. Xiang, 2020, Current Medical Science.

Alterations in amino acid levels and metabolite ratio of spinal cord in rat with myocardial ischemia-reperfusion injury by proton magnetic resonance spectroscopy.

A. Manyande, Q. Wang, H. Xiang, 2019, American journal of translational research.

Altered expression of differential gene and lncRNA in the lower thoracic spinal cord on different time courses of experimental obstructive jaundice model accompanied with altered peripheral nociception in rats

Zhi-gang He, H. Xiang, Bao-Wen Liu, 2017, Oncotarget.

Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia-reperfusion injuries

Zhi-gang He, H. Xiang, Zhi-xiao Li, 2021, Experimental and therapeutic medicine.

Neurochemical alterations of different cerebral regions in rats with myocardial ischemia-reperfusion injury based on proton nuclear magnetic spectroscopy analysis

A. Manyande, H. Xiang, Zhi-xiao Li, 2020, Aging.

Mapping the Brain-Wide Cholinergic Neurons Projecting to Skeletal Muscle in Mice by High-Throughput Light Sheet Tomography

S. Zeng, Q. Wang, Xiaofeng Cheng, 2020, Neuroscience Bulletin.

Mapping the Brain-Wide Cholinergic Neurons Projecting to Skeletal Muscle in Mice by High-Throughput Light Sheet Tomography

Shaoqun Zeng, Xiaofeng Cheng, Xiuli Liu, 2020, Neuroscience Bulletin.