R. Hipkin

发表

Expansion of SAR studies on triaryl bis sulfone cannabinoid CB2 receptor ligands.

A. Malikzay, C. Lunn, D. Lundell, 2010, Bioorganic & medicinal chemistry letters.

Triaryl bis-sulfones as cannabinoid-2 receptor ligands: SAR studies.

Jie Wu, C. Lunn, N. Shih, 2005, Bioorganic & medicinal chemistry letters.

Discovery and Characterization of Vicriviroc (SCH 417690), a CCR5 Antagonist with Potent Activity against Human Immunodeficiency Virus Type 1

M. Hirsch, C. Tremblay, G. Reyes, 2005, Antimicrobial Agents and Chemotherapy.

Pharmacological characterization of the chemokine receptor, hCCR1 in a stable transfectant and differentiated HL‐60 cells: antagonism of hCCR1 activation by MIP‐1β

Martin A. Schwarz, G. Deno, J. Fine, 2002, British journal of pharmacology.

Cloning and characterization of a novel human histamine receptor.

F. Monsma, Y. Wan, S. Umland, 2001, The Journal of pharmacology and experimental therapeutics.

Endocannabinoid 2-arachidonyl glycerol is a full agonist through human type 2 cannabinoid receptor: antagonism by anandamide.

S. Narula, C. Lunn, D. Lundell, 2000, Molecular pharmacology.

Identification and characterization of a luteinizing hormone/chorionic gonadotropin (LH/CG) receptor precursor in a human kidney cell line stably transfected with the rat luteal LH/CG receptor complementary DNA.

M. Ascoli, J. Sánchez-Yagüe, R. W. Hipkin, 1992, Molecular endocrinology.

Discovery of 2-hydroxy-N,N-dimethyl-3-{2-[[(R)-1-(5- methylfuran-2-yl)propyl]amino]-3,4-dioxocyclobut-1-enylamino}benzamide (SCH 527123): a potent, orally bioavailable CXCR2/CXCR1 receptor antagonist.

M. Dwyer, J. Baldwin, L. Ozgur, 2006, Journal of medicinal chemistry.

Immunohistochemical detection of somatostatin sst2a receptors in the lymphatic, smooth muscular, and peripheral nervous systems of the human gastrointestinal tract: facts and artifacts.

J. Laissue, J. Reubi, B. Waser, 1999, The Journal of clinical endocrinology and metabolism.

CXCR2 antagonists for the treatment of pulmonary disease.

J. Phillips, D. Lundell, D. Lundell, 2009, Pharmacology & therapeutics.

A Novel, Orally Active CXCR1/2 Receptor Antagonist, Sch527123, Inhibits Neutrophil Recruitment, Mucus Production, and Goblet Cell Hyperplasia in Animal Models of Pulmonary Inflammation

M. Billah, J. Hey, J. Phillips, 2007, Journal of Pharmacology and Experimental Therapeutics.

Follitropin (FSH) and a phorbol ester stimulate the phosphorylation of the FSH receptor in intact cells.

M. Ascoli, J. Sánchez-Yagüe, J. Quintana, 1994, The Journal of biological chemistry.

Murine CXCR1 Is a Functional Receptor for GCP-2/CXCL6 and Interleukin-8/CXCL8*

G. Opdenakker, S. Lira, J. Van Damme, 2007, Journal of Biological Chemistry.

Biochemical properties of the agonist-induced desensitization of the follicle-stimulating hormone and luteinizing hormone/chorionic gonadotropin-responsive adenylyl cyclase in cells expressing the recombinant gonadotropin receptors.

M. Ascoli, J. Sánchez-Yagüe, R. Hipkin, 1993, Endocrinology.

Interaction between cyclic nucleotide second messenger systems in murine Leydig cells

W. H. Moger, R. Hipkin, 1991, Molecular and Cellular Endocrinology.

Protein Kinase C Activation Stimulates the Phosphorylation and Internalization of the sst2A Somatostatin Receptor*

A. Schonbrunn, R. W. Hipkin, Yining Wang, 2000, The Journal of Biological Chemistry.

Agonist-induced Desensitization, Internalization, and Phosphorylation of the sst2A Somatostatin Receptor*

J. Friedman, A. Schonbrunn, C. Eppler, 1997, The Journal of Biological Chemistry.

Disruption of CCL21-Induced Chemotaxis In Vitro and In Vivo by M3, a Chemokine-Binding Protein Encoded by Murine Gammaherpesvirus 68

A. Alcamí, K. Jensen, S. Lira, 2003, Journal of Virology.

Evaluation of Signal Transduction Pathways in Chemoattractant-Induced Human Monocyte Chemotaxis

H. Byrnes, J. Fine, P. Zavodny, 2001, Inflammation.

The agonist-induced phosphorylation of the rat follitropin receptor maps to the first and third intracellular loops.

M. Ascoli, K. Nakamura, R. Hipkin, 1998, Molecular endocrinology.

Homologous and heterologous regulation of somatostatin receptor 2.

G. Elberg, A. Schonbrunn, R. W. Hipkin, 2002, Molecular endocrinology.

Biology and therapeutic potential of cannabinoid CB2 receptor inverse agonists

C. Lunn, D. Lundell, Brian J. Lavey, 2008, British journal of pharmacology.

Truncation of the C-terminal Tail of the Follitropin Receptor Does Not Impair the Agonist- or Phorbol Ester-induced Receptor Phosphorylation and Uncoupling (*)

Xuebo Liu, M. Ascoli, R. Hipkin, 1995, The Journal of Biological Chemistry.

Synthesis and structure-activity relationships of heteroaryl substituted-3,4-diamino-3-cyclobut-3-ene-1,2-dione CXCR2/CXCR1 receptor antagonists.

M. Dwyer, D. Rindgen, J. Fossetta, 2008, Bioorganic & medicinal chemistry letters.

Human chorionic gonadotropin (CG)- and phorbol ester-stimulated phosphorylation of the luteinizing hormone/CG receptor maps to serines 635, 639, 649, and 652 in the C-terminal cytoplasmic tail.

M. Ascoli, R. W. Hipkin, Z. Wang, 1995, Molecular endocrinology.

Agonist-induced phosphorylation of the luteinizing hormone/chorionic gonadotropin receptor expressed in a stably transfected cell line.

M. Ascoli, J. Sánchez-Yagüe, R. W. Hipkin, 1993, Molecular endocrinology.

Pharmacological characterization of human S1P4 using a novel radioligand, [4,5‐3H]‐dihydrosphingosine‐1‐phosphate

J. Fossetta, C. Lunn, D. Lundell, 2004, British journal of pharmacology.

β2-Adrenergic Receptor Desensitization, Internalization, and Phosphorylation in Response to Full and Partial Agonists*

A. Seibold, R Barber, A. Schonbrunn, 1997, The Journal of Biological Chemistry.

Pituitary Somatostatin Receptor (sst)1-5 Expression during Rat Development: Age-Dependent Expression of sst21.

D. K. Reed, A. Korytko, L. Cuttler, 1999, Endocrinology.

Pituitary somatostatin receptor (sst)1-5 expression during rat development: age-dependent expression of sst2.

D. K. Reed, A. Korytko, L. Cuttler, 1999, Endocrinology.

Immunohistochemical localization of somatostatin receptors sst2A in human tumors.

J. Laissue, A. Kappeler, J. Reubi, 1998, The American journal of pathology.

Immunohistochemical Localization of Somatostatin Receptor SST2A in the Rat Pancreas.

É. Mezey, B. Hunyady, A. Schonbrunn, 1997, Endocrinology.

Desensitization of β2-Adrenergic Receptors with Mutations of the Proposed G Protein-coupled Receptor Kinase Phosphorylation Sites*

J. Friedman, A Seibold, B G January, 1998, The Journal of Biological Chemistry.

A Novel Cannabinoid Peripheral Cannabinoid Receptor-Selective Inverse Agonist Blocks Leukocyte Recruitment in Vivo

Jay S. Fine, S. Narula, J. Jackson, 2006, Journal of Pharmacology and Experimental Therapeutics.

Non-aromatic A-ring replacement in the triaryl bis-sulfone CB2 receptor inhibitors.

A. Malikzay, L. Favreau, C. Lunn, 2010, Bioorganic & medicinal chemistry letters.

Triaryl bis-sulfones as a new class of cannabinoid CB2 receptor inhibitors: identification of a lead and initial SAR studies.

S. Narula, C. Lunn, D. Lundell, 2005, Bioorganic & medicinal chemistry letters.

Pharmacological Characterization of Sch527123, a Potent Allosteric CXCR1/CXCR2 Antagonist

M. Billah, M. Dwyer, J. Fossetta, 2007, Journal of Pharmacology and Experimental Therapeutics.

Pharmacological Characterization of Sch 527123 , a Potent Allosteric CXCR 1 / CXCR 2 Antagonist

M. Billah, M. Dwyer, J. Fossetta, 2007 .

Human interferon-inducible 10-kDa protein and human interferon-inducible T cell alpha chemoattractant are allotopic ligands for human CXCR3: differential binding to receptor states.

S. Narula, J. Fine, P. Zavodny, 2001, Molecular pharmacology.

Progressive cytoplasmic tail truncations of the lutropin-choriogonadotropin receptor prevent agonist- or phorbol ester-induced phosphorylation, impair agonist- or phorbol ester-induced desensitization, and enhance agonist-induced receptor down-regulation.

M. Ascoli, Z. Wang, R. Hipkin, 1996, Molecular endocrinology.

The study of CXCR3 and CCR7 pharmacology using [35S]GTPgammaS exchange assays in cell membranes and permeabilized peripheral blood lymphocytes.

P. Zavodny, W. Gonsiorek, R. W. Hipkin, 2003, Journal of immunological methods.

Fluoroalkyl alpha side chain containing 3,4-diamino-cyclobutenediones as potent and orally bioavailable CXCR2-CXCR1 dual antagonists.

M. Dwyer, D. Rindgen, D. Lundell, 2009, Bioorganic & medicinal chemistry letters.

A polyclonal antibody to a synthetic peptide derived from the rat follicle-stimulating hormone receptor reveals the recombinant receptor as a 74-kilodalton protein.

M. Ascoli, J. Quintana, R. Hipkin, 1993, Endocrinology.

A novel cannabinoid CB 2 receptor-selective inverse agonist blocks leukocyte recruitment in vivo

S. Narula, J. Jackson, C. Lunn, 2005 .

Opioid Receptor Antagonists for Gastrointestinal Dysfunction

R. Dolle, R. W. Hipkin, R. Hipkin, 2010 .

Sch35966 is a potent, selective agonist at the peripheral cannabinoid receptor (CB2) in rodents and primates

C. Lunn, G. Deno, J. Kozlowski, 2007, British journal of pharmacology.

Characterization of Peripheral Human Cannabinoid Receptor (hCB2) Expression and Pharmacology Using a Novel Radioligand, [35S]Sch225336*

S. Narula, J. Jackson, Shu-Cheng Chen, 2006, Journal of Biological Chemistry.

CXCR2 antagonists for the treatment of pulmonary disease.

J. Phillips, D. Lundell, J. Fine, 2009, Pharmacology & therapeutics.

Cloning and Pharmacological Characterization of CXCR1 and CXCR2 from Macaca fascicularis

B. Wilburn, G. Deno, J. Fine, 2004, Journal of Pharmacology and Experimental Therapeutics.

CXCR 1 Rat AATGCTGCCCACTGGAGAGT CAGCCTGCCTGTTGGTCAT CXCR 2 Rat GGGTGGATAATTTCAGCCTTGA AGGGCGGGTCAGAACTGTAA CXCR 1 Rabbit TGGAAGTAAACGTATGGAATATGACTGA CAGGAGGCATACCAGTAGCATTT CXCR 2 Rabbit TTCGGCGATTTCAGCAATTAC GCTGTTGGTTTCCAGAGATTCTG

B. Wilburn, G. Deno, J. Fine, 2004 .

Cannabinoid CB(2)-selective inverse agonist protects against antigen-induced bone loss.

J. Jackson, C. Lunn, D. Lundell, 2007, Immunopharmacology and immunotoxicology.

Cannabinoid CB2-Selective Inverse Agonist Protects Against Antigen-Induced Bone Loss

C. Lunn, J. Fine, Brian J. Lavey, 2007 .

Erratum: Immunohistochemical localization of somatostatin receptor sst2A in the rat pancreas (Endocrinology (1997) 138 (2632-2635))

É. Mezey, B. Hunyady, A. Schonbrunn, 1997 .