Kazunari Tanigawa

发表

Koichi Suzuki, Yuqian Luo, N. Ishii, 2021, Frontiers in Medicine.

Tryptophan aspartate‐containing coat protein (CORO1A) suppresses Toll‐like receptor signalling in Mycobacterium leprae infection

Hiroaki Kimura, F. Takeshita, Koichi Suzuki, 2009, Clinical and experimental immunology.

Demonstration of innate immune responses in the thyroid gland: potential to sense danger and a possible trigger for autoimmune reactions.

Koichi Suzuki, F. Takeshita, K. Yamazaki, 2013, Thyroid : official journal of the American Thyroid Association.

Thyroglobulin regulates the expression and localization of the novel iodide transporter solute carrier family 26 member 7 (SLC26A7) in thyrocytes.

T. Kondo, Koichi Suzuki, A. Kawashima, 2022, Endocrine journal.

Detection of RNA expression from pseudogenes and non-coding genomic regions of Mycobacterium leprae.

Kazuaki Nakamura, Koichi Suzuki, N. Ishii, 2009, Microbial pathogenesis.

Whole-Genome Tiling Array Analysis of Mycobacterium leprae RNA Reveals High Expression of Pseudogenes and Noncoding Regions

Y. Sakakibara, Yasunori Osana, Koichi Suzuki, 2009, Journal of bacteriology.

[Detection of RNA expression on whole genome analysis of Mycobacterium leprae by tiling array].

Kazuaki Nakamura, Koichi Suzuki, N. Ishii, 2009, Nihon Hansenbyo Gakkai zasshi = Japanese journal of leprosy : official organ of the Japanese Leprosy Association.

CTGATCAGGACGGTCGGTAT TCTGGCTTCGGTCTCAGTCT CAGATTGGAGCGCATTACCT ATAATCACCTGCGGCATCTT TGGCGTCTGGTGTCAATATC CCAGCATAGTCGAGTCACAGG GACCTTCGAGGATCTGTTCG ATAGACGTCATCGAGCGACA GAACTGTGAAGTGGTTCAACG AGCGAACTCCAGTGGCTTG TTGCTAGTACGGCAACCAGA TGTTGAACAGGACGGTATGG AAGAACACCGCTTGAGTTGG ATGTTCGAGGAACGGTTACG CATCA

Kazuaki Nakamura, Koichi Suzuki, N. Ishii, 2009 .

Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells

M. Goto, Junichiro En, Koichi Suzuki, 2022, PLoS neglected tropical diseases.

Essential Roles of PPARs in Lipid Metabolism during Mycobacterial Infection

Koichi Suzuki, Yuqian Luo, A. Kawashima, 2021, International journal of molecular sciences.

The function of peroxisome proliferator-activated receptors PPAR-γ and PPAR-δ in Mycobacterium leprae-induced foam cell formation in host macrophages

Koichi Suzuki, Yuqian Luo, N. Ishii, 2020, PLoS neglected tropical diseases.

Innate immune activation and thyroid autoimmunity.

Koichi Suzuki, N. Ishii, A. Kawashima, 2011, The Journal of clinical endocrinology and metabolism.

Propylthiouracil increases sodium/iodide symporter gene expression and iodide uptake in rat thyroid cells in the absence of TSH.

G. Yoshino, Koichi Suzuki, N. Ishii, 2012, Thyroid : official journal of the American Thyroid Association.

Pathogenicity and virulence of Mycobacterium leprae

Koichi Suzuki, A. Kawashima, K. Tanigawa, 2022, Virulence.

Clofazimine Modulates the Expression of Lipid Metabolism Proteins in Mycobacterium leprae-Infected Macrophages

Koichi Suzuki, Yang Degang, N. Ishii, 2012, PLoS neglected tropical diseases.

Thyroglobulin (Tg) activates MAPK pathway to induce thyroid cell growth in the absence of TSH, insulin and serum.

Shin-ichiro Takahashi, Tetsuhide Ito, Koichi Suzuki, 2012, Biochemical and biophysical research communications.

Identification of microRNAs that mediate thyroid cell growth induced by TSH.

Koichi Suzuki, N. Ishii, A. Kawashima, 2012, Molecular endocrinology.

Fragments of genomic DNA released by injured cells activate innate immunity and suppress endocrine function in the thyroid.

K. Ishii, H. Hirano, T. Sakai, 2011, Endocrinology.

Thyroglobulin increases thyroid cell proliferation via the suppression of specific microRNAs.

A. Tanoue, Kazuaki Nakamura, Koichi Suzuki, 2014, Molecular endocrinology.

Regulation of dual oxidase expression and H2O2 production by thyroglobulin.

G. Yoshino, Koichi Suzuki, N. Ishii, 2012, Thyroid : official journal of the American Thyroid Association.

Comprehensive Analysis of Prokaryotes in Environmental Water Using DNA Microarray Analysis and Whole Genome Amplification

Koichi Suzuki, Koichi Suzuki, Yuqian Luo, 2013, Pathogens.

Chimpanzees used for medical research shed light on the pathoetiology of leprosy.

T. Miyamura, Koichi Suzuki, N. Ishii, 2011, Future microbiology.

Transcriptional Regulation of Acyl-CoA:Glycerol-sn-3-Phosphate Acyltransferases

A. Yamashita, K. Karasawa, K. Tanigawa, 2019, International journal of molecular sciences.

Paleopathological Evidence and Detection of Mycobacterium leprae DNA from Archaeological Skeletal Remains of Nabe-kaburi (Head-Covered with Iron Pots) Burials in Japan

K. Hirata, Junya Sakurai, Koichi Suzuki, 2014, PloS one.

[Leprosy in a chimpanzee].

T. Miyamura, T. Udono, Koichi Suzuki, 2011, Nihon Hansenbyo Gakkai zasshi = Japanese journal of leprosy : official organ of the Japanese Leprosy Association.

Analysis of Mycobacterium leprae gene expression using DNA microarray.

Koichi Suzuki, N. Ishii, A. Kawashima, 2010, Microbial pathogenesis.

Detection of Mycobacterium leprae DNA from Archaeological Skeletal Remains in Japan Using Whole Genome Amplification and Polymerase Chain Reaction

Kazuaki Nakamura, Koichi Suzuki, N. Ishii, 2010, PloS one.

Infection during Infancy and Long Incubation Period of Leprosy Suggested in a Case of a Chimpanzee Used for Medical Research

T. Udono, Koichi Suzuki, N. Ishii, 2010, Journal of Clinical Microbiology.

N-(4-Hydroxyphenyl) Retinamide Suppresses SARS-CoV-2 Spike Protein-Mediated Cell-Cell Fusion by a Dihydroceramide Δ4-Desaturase 1-Independent Mechanism

J. Gohda, K. Maeda, A. Yamashita, 2021, Journal of virology.

Cathepsin G-induced malignant progression of MCF-7 cells involves suppression of PAF signaling through induced expression of PAFAH1B2.

S. Natsugoe, K. Hama, Keizō Inoue, 2022, Biochimica et biophysica acta. Molecular and cell biology of lipids.

N-(4-Hydroxyphenyl)retinamide suppresses SARS-CoV-2 spike protein-mediated cell-cell fusion and viral infection in vitro

J. Gohda, K. Maeda, A. Yamashita, 2021 .

Iodide-induced chemokines and genes related to immunological function in cultured human thyroid follicles in the presence of thyrotropin.

Koichi Suzuki, K. Takano, K. Yamazaki, 2010, Thyroid : official journal of the American Thyroid Association.

Naturally occurring a loss of a giant plasmid from Mycobacterium ulcerans subsp. shinshuense makes it non-pathogenic

Tetsuya Hayashi, A. Toyoda, M. Goto, 2018, Scientific Reports.

“Mycobacterium ulcerans subsp. shinshuense” Isolated from a Skin Ulcer Lesion: Identification Based on 16S rRNA Gene Sequencing

M. Goto, T. Iwamoto, Koichi Suzuki, 2007, Journal of Clinical Microbiology.