论文信息 - Linkage mapping of chicken ovoinhibitor and ovomucoid genes to chromosome 13.

Linkage mapping of chicken ovoinhibitor and ovomucoid genes to chromosome 13.

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone (DogBAC library ID S050P24H09) was verified by PCR and sequencing.

[1] G. Acland,et al. Cloning and mapping of canine KIAA1753. , 2004, Animal genetics.

[2] M. Groenen,et al. Improvement of the comparative map of chicken chromosome 13. , 2002, Animal genetics.

[3] T. Kikuchi,et al. Localization of the muscular dystrophy AM locus using a chicken linkage map constructed with the Kobe University resource family. , 2002, Animal genetics.

[4] J. Dodgson,et al. Characterization of a Red Jungle Fowl by White Leghorn Backcross Reference Population for Molecular Mapping of the Chicken Genome , 1993 .

[5] I. Kato,et al. Ovoinhibitor introns specify functional domains as in the related and linked ovomucoid gene. , 1987, The Journal of biological chemistry.

[6] I. Kato,et al. Protein inhibitors of proteinases. , 1980, Annual review of biochemistry.

[7] J. D. Engel,et al. Gene localization by chromosome fractionation: globin genes are on at least two chromosomes and three estrogen-inducible genes are on three chromosomes. , 1979, Proceedings of the National Academy of Sciences of the United States of America.