Members of the cell division cycle 2 (CDC2) family of kinases play a pivotal role in the regulation of the eukaryotic cell cyde. In this communication, we report the isolation of a cDNA that encodes a CDC2-related human protein kinase temporarily designated PITALRE for the characteristic Pro-Ile-Thr-Ala-Leu-Arg-Glu motif. Its deduced amino acid sequence is 47% identical to that of the human cholinesterase-related cell division controller (CHED) kinase, which is required during hematopoiesis, and 42% identical to the Saccharomyces cerewasle SGV1 gene product, a putative kinase involved in the response to pheromone via its guanine nucleotide-binding protein a subunit. PITALRE expression is ubiquitous, but its expression levels are different in various human tissues. PITALRE is an =43-kDa protein that associates with three cellular polypeptides of 80, 95, and 155 kDa. PITALRE islad primarily to the nucleus. In addition, we have identified a retinoblastoma protein kinase activity associated with PITALRE Immunocomplexes that cannot phosphorylate histone Hi, suggesting that the target phosphorylation site of PITALRE differs from that of CDC2 kinase. Interestingly, the retinoblastoma kinase activity associated with PITALRE does not oscillate during the cell cycle. The cell cycle in eukaryotes is regulated by a sequence of restriction points. In yeast, the first restriction point occurs during the G1 phase prior to the DNA synthesis and the second occurs before the initiation of mitosis. In Saccharomyces cerevisiae, the cell division cycle 28 (CDC28) kinase controls both restriction points through association with the CLN cyclins in G1 and with CLB cyclins in G2/M (1). In vertebrate cells, the regulatory mechanisms involved in cell cycle progression are more complex. CDC2 kinase, in association with cyclin B, appears to be a universal regulator of the eukaryotic entry into mitosis. However, in G1, just before the onset of DNA synthesis, cyclin-dependent kinase 2 (CDK2), but not CDC2, is required (2, 3). Additional mammalian CDC2-related kinases have been isolated that share >40% identity at the amino acid level (4-11). At least two of them, CDK4 (previously named PSK-J3; ref. 5) and CDK5 (also called PSSALRE for its Pro-Ser-Ser-Ala-Leu-Arg-Glu motif; ref. 9), have been shown to associate with D-type cyclins. In vitro assembled CDK4-cyclin D complexes are capable ofphosphorylating the retinoblastoma protein. However, the same complexes cannot phosphorylate histone Hi. This indicates that CDK4-cyclin D complexes possess a different phosphorylation specificity than the CDC2 kinase. Nevertheless, no kinase activity has been detected in CDK4 immunocomplexes (12). The association of CDK5 with cyclins D1/D3 and with proliferating cell nuclear antigen (PCNA) suggests a role for this kinase in the cell cycle (13). However, the high levels of expression of cdk5 found in neurons, cells no longer dividing, indicate a role for CDK5 in terminally differentiated cells (11). The study of CDC2 and CDC2-related kinases over the past few years has revealed a key role for these kinases in the regulation of the cell cycle. Most recently, an involvement in differentiation processes has also been proposed (8, 11). With the aim of isolating additional putative controllers of the mammalian cell cycle, we performed a combination of PCR amplification and low-stringency screening of a human cDNA library. By using this strategy, we have isolated and characterized a CDC2-related protein kinase,§ temporarily named PITALRE for the characteristic motif Pro-Ile-ThrAla-Leu-Arg-Glu. We have determined its subcellular localization, identified several associated proteins, and demonstrated kinase activity in its immunocomplexes. We have also studied the regulation of this kinase activity during the cell division cycle. These studies define an additional protein kinase that may be involved in cell cycle control or in differentiation of specific cell types. MATERIALS AND METHODS cDNA Cloning. Two degenerate oligonucleotides were used in the polymerase chain reaction (PCR) to amplify =500-bp fragments related to the cdc2 family of genes. A mouse embryonic cDNA library was used as a source of cDNA. The 5' oligonucleotide (5'-GCAGGATCCGARAARATYGGNGARGGNACNTA-3') corresponds to the CDC2 region of amino acid sequence Glu-Lys-Ile-Gly-GluGly-Thr-Tyr and the 3' oligonucleotide (5'-CGGCTGCAGARNAYYTCNGGNGMNCKRTACCA-3') corresponds to the CDC2 region of amino acid sequence Trp-Tyr-Arg-Ser-ProGlu-Val-Leu (R= G or A, Y= T or C, N= G, A, T, or C, M= A or C, and K= G or T). PCR was carried out for 25 cycles (1 min at 940C, 2 min at 550C, and 3 min at 720C, followed by a final 8-min incubation at 720C) following manufacturer directions (Perkin-Elmer/Cetus). The nucleotide sequence of several fragments was determined. With one ofthese cdc2-related PCR-amplified fragments as a probe, a human CEM cDNA library (in Lambda ZAP II; Stratagene) was screened at low stringency (38% formamide containing 0.1% SDS, 150 Pg of herring sperm DNA per ml, 5x Denhardt's solution (lx = 0.02% polyvinylpyrrolidone/0.02% Ficoll/0.02% bovine serum albumin), and 5x SSPE (lx = 0.18 M NaCl/10 mM Abbreviations: PITALRE, kinase with Pro-Ile-Thr-Ala-Leu-Arg-Glu motif; CDC, cell division cycle; CDK, cyclin-dependent kinase; CHED, cholinesterase-related cell division controller; GST, gluthathione S-transferase; MBP, myelin basic protein; PSTAIRE, kinase with Pro-Ser-Thr-Ala-Ile-Arg-Glu motif; RB, retinoblastoma. tTo whom reprint requests should be addressed. §The sequence reported in this paper has been deposited in the GenBank data base (accession no. L25676). 3834 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Proc. Natd. Acad. Sci. USA 91 (1994) 3835 phosphate, pH 7.4/1 mM EDTA). Hybridization was performed at 370C for 16 h, and low-stringency washes were carried out at 370C for 20 min in 0.30 M NaCl/0.030M sodium citrate, pH 7/0.1% SDS. Two positives contained %1.4-kb (PK10) and -1.5-kb (PK14) inserts. Double-stranded DNA sequence determination was performed by using Sequenase 2.0 (United States Biochemical) and oligonucleotide primers. Comparison of the sequences with the major data bases showed that the clone of 1.4 kb corresponded to the PSK-J3/ CDK4 (5) and the clone of 1.5 kb encoded a previously unknown CDC2-related putative kinase. Biological Reagents. The coding region of clone PK14 starting at nucleotide 65 was PCR-amplified and subcloned in pGEX-2T (Pharmacia) linearized with BamHI/Sma I. Expression of the fusion protein was performed as described (14, 15). Bacterially expressed glutathione S-transferase (GST)-PITALRE fusion protein was used to immunize rabbits. Positive rabbit serum was affinity-purified essentially as described by Koff et al. (16) with GST and GST-PITALRE columns. Preparation ofanti-C-terminal peptide antibodies to CDC2 (G6) and CDK2 has been described (17, 18). Cell Culture and Biological Assays. Cells were obtained from the American Type Culture Collection. Cell culture, cell labeling, and centrifugal elutriation were performed as described by Giordano et al. (17, 19). HeLa cells were synchronized by serum deprivation and hydroxyurea treatment essentially as described by Ashihara and Baserga (20). Flow cytometric analysis was performed with an Epics Elite system (Coulter). Nuclei from HeLa cells were obtained essentially as described by Li et al. (21). Immunoprecipitations were performed as described by Harlow and Lane (22). Immunoprecipitation-reprecipitation experiments were done as described (3). V8 partial digestion mapping was performed as described by Cleveland et al. (23). Enhanced chemiluminescence (ECL; Amersham) was used in immunoblot experiments. Kinase assays from immunoprecipitated complexes were performed at 30°C for 20-30 min in 20 mM Hepes/10 mM magnesium acetate/1 mM dithiothreitol/10-100 ,pM ATP/5 pCi (1 ,uCi = 37 kBq) of [y-32P]ATP (DuPont) containing 1-5 jg of the following substrates: myelin basic protein (MBP) and casein (Sigma), histone H1 (Boehringer Mannheim), p56 retinoblastoma (RB) bacterially expressed protein, and several GST fusion proteins (total volume, 25 Al). RESULTS AND DISCUSSION Isolation of a HumancDNAE ing an Additional Member of the CDC2 Family of Protein Kinases. With the aim of isolating new members of the CDC2 family of serine/ threonine protein kinases, cDNA from a mouse embryonic library was PCR-amplified by using degenerate oligonucleotides. Next we used a unique PCR clone as a probe to isolate two human cDNAs (see Materials and Methods). One of them was PSK-J3, previously isolated by Hanks (5), which recently has been renamed CDK4 because of its association with the D-type cyclins (12). The second cDNA was found to be 1461 bp long and contained an open reading frame of 1181 bp (Fig. 1). A putative start site for translation was found at nucleotides 65-67 (24). Starting at this methionine, the predicted translation product is a 372-amino acid protein with an expected relative molecular mass of =43 kDa (Fig. 1). The 3' noncoding region does not contain a poly(A) tail. The deduced amino acid sequence contains the 11 conserved regions characteristic of the protein kinase catalytic domain (25), and the putative ATP-binding site is identical to that of SGV1 (Fig. 2), a putative kinase required for a guanine nucleotidebinding protein a subunit-mediated adaptive response to pheromone in S. cerevisiae (26). A PSTAIRE (Pro-Ser-ThrAla-Ile-Arg-Glu)-like motif, PITALRE, is found at residues 60-66 that is also closely related to the motifs of SGV1 and cgggacccgagcaggagcggcggcacgagcagctgggggcggcggcggcgcgttggaggc ggccatggcaaagcagtacgactcggtggagtgccctttttgtgatgaagtttccaaata M A K Q Y D S V E C P F C D E V S K Y cgagaagctcgccaagatcggccaaggcaccttcggggaggtgttcaaggccaggcaccg E K L A K