A new peculiar DNA structure: NMR solution structure of a DNA kissing complex

Abstract The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV-1Lai RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 °C) was found slightly higher than the one of the corresponding RNA dimer (32 °C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100° with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5Å. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20° between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.

[1]  J. Tomizawa.  Control of ColE1 plasmid replication: Binding of RNA I to RNA II and inhibition of primer formation , 1986, Cell.

[2]  C. McMurray,et al.  DNA secondary structure: a common and causative factor for expansion in human disease. , 1999, Proceedings of the National Academy of Sciences of the United States of America.

[3]  D. Muriaux,et al.  A kissing complex together with a stable dimer is involved in the HIV-1Lai RNA dimerization process in vitro. , 1996, Biochemistry.

[4]  A. Skalka,et al.  A Preferred Target DNA Structure for Retroviral Integrasein Vitro * , 1998, The Journal of Biological Chemistry.

[5]  V. Saudek,et al.  Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions , 1992, Journal of biomolecular NMR.

[6]  S. Wijmenga,et al.  Analysis of 1H chemical shifts in DNA: Assessment of the reliability of 1H chemical shift calculations for use in structure refinement , 1997, Journal of biomolecular NMR.

[7]  T. Huynh-Dinh,et al.  Dimer initiation sequence of HIV-1Lai genomic RNA: NMR solution structure of the extended duplex. , 1999, Journal of biomolecular structure & dynamics.

[8]  J. Tomizawa.  Control of cole1 plasmid replication: Initial interaction of RNA I and the primer transcript is reversible , 1985, Cell.

[9]  C. El Amri,et al.  A DNA hairpin with a single residue loop closed by a strongly distorted Watson-Crick G x C base-pair. , 1999, Journal of molecular biology.

[10]  B. Roques,et al.  NCp7 Activates HIV-1Lai RNA Dimerization by Converting a Transient Loop-Loop Complex into a Stable Dimer* , 1996, The Journal of Biological Chemistry.

[11]  M. J. D. Powell,et al.  Restart procedures for the conjugate gradient method , 1977, Math. Program..

[12]  A T Brünger,et al.  Torsion-angle molecular dynamics as a new efficient tool for NMR structure calculation. , 1997, Journal of magnetic resonance.

[13]  L. Kirkham,et al.  The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. , 1998, Proceedings of the National Academy of Sciences of the United States of America.

[14]  A. Marquis Gacy,et al.  Trinucleotide repeats that expand in human disease form hairpin structures in vitro , 1995, Cell.

[15]  R J Read,et al.  Crystallography & NMR system: A new software suite for macromolecular structure determination. , 1998, Acta crystallographica. Section D, Biological crystallography.

[16]  T. Huynh-Dinh,et al.  The HIV‐1Lai RNA dimerization , 2000 .

[17]  H. Temin,et al.  Retrovirus variation and reverse transcription: abnormal strand transfers result in retrovirus genetic variation. , 1993, Proceedings of the National Academy of Sciences of the United States of America.

[18]  M. Laughrea,et al.  HIV-1 genome dimerization: formation kinetics and thermal stability of dimeric HIV-1Lai RNAs are not improved by the 1-232 and 296-790 regions flanking the kissing-loop domain. , 1996, Biochemistry.

[19]  J. Tomizawa.  Control of cole 1 plasmid replication: The process of binding of RNA I to the primer transcript , 1984, Cell.

[20]  P. Bittoun,et al.  Hairpins in a DNA site for topoisomerase II studied by 1H- and 31P-NMR. , 1995, Nucleic acids research.

[21]  Solution studies of the dimerization initiation site of HIV-1 genomic RNA. , 1998, Nucleic acids research.

[22]  E. Westhof,et al.  Non-canonical interactions in a kissing loop complex: the dimerization initiation site of HIV-1 genomic RNA. , 1997, Journal of molecular biology.

[23]  J. Tomizawa,et al.  Control of cole 1 plasmid replication: Enhancement of binding of RNA I to the primer transcript by the rom protein , 1984, Cell.

[24]  J. Tomizawa.  Control of ColE1 plasmid replication. Intermediates in the binding of RNA I and RNA II. , 1990, Journal of molecular biology.

[25]  L. Gold,et al.  From oligonucleotide shapes to genomic SELEX: novel biological regulatory loops. , 1997, Proceedings of the National Academy of Sciences of the United States of America.

[26]  Thomas L. James,et al.  Structure of the dimer a initiation complex of HIV-1 genomic RNA , 1998, Nature Structural Biology.

[27]  C. Ehresmann,et al.  Mutational analysis of the bipartite dimer linkage structure of human immunodeficiency virus type 1 genomic RNA. , 1994, The Journal of biological chemistry.

[28]  B. Roques,et al.  First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses. , 1995, Journal of molecular biology.

[29]  Eric Bieth,et al.  A study of the dimer formation of Rous sarcoma virus RNA and of its effect on viral protein synthesis in vitro , 1990, Nucleic Acids Res..

[30]  W. Bender,et al.  Mapping of poly(A) sequences in the electron microscope reveals unusual structure of type C oncornavirus RNA molecules , 1976, Cell.

[31]  D. Muriaux,et al.  Dimerization of HIV-1Lai RNA at Low Ionic Strength , 1995, The Journal of Biological Chemistry.

[32]  M. Laughrea,et al.  Kissing-loop model of HIV-1 genome dimerization: HIV-1 RNAs can assume alternative dimeric forms, and all sequences upstream or downstream of hairpin 248-271 are dispensable for dimer formation. , 1996, Biochemistry.