Autoimmune Disease and Impaired Uptake of Apoptotic Cells in Germinal Centers of MFG-E 8 – Deficient Mice

Materials and Methods Targeted disruption of the MFG-E8 gene The MFG-E8 chromosomal gene was isolated from a 129/sv mouse λ gene library. Exons 4–6 were replaced by a neo gene and a DNA fragment coding for the diphtheria toxin A fragment was inserted downstream of the MFG-E8 gene to produce the targeting vector. To produce MFG-E8 null mice, R1 ES cells were transfected with the targeting vector as described (S1), and G-418–resistant clones were screened for homologous recombination by PCR. The ES clones carrying the MFG-E8–deficient allele were introduced into the host embryos and used to produce chimeric mice. Chimeric mice with a high ES cell contribution were crossed with C57BL/6 mice to produce MFG-E8 mice. MFG-E8 mice were generated by crossing MFG-E8 parents, and the phenotypes of the MFG-E8 and MFG-E8 littermates were analyzed. All mice were housed in a specific pathogen-free facility. PCR, Southern and Northern blot analyses Genomic DNA was prepared as described (S2) and the genotype of the MFG-E8 gene was determined by PCR. A sense primer specific for the wild-type (5′GTGAACCTTCTGCGGAAGAT) or mutant allele (5′-CGTGGGATCATTGTTTTTCT) was used with a common antisense primer (5′-GGGCATAAACTCCAGCTCAC). For Southern hybridization, genomic DNA was digested with Eco RV and Kpn I, separated by electrophoresis on an 0.8% agarose gel and transferred to a Hybond N membrane (Amersham Biosciences). Hybridization was carried out with a 540-bp DNA fragment located outside the targeting vector. For Northern hybridization, total RNA was separated on a 1.5% agarose gel containing 2.2 M formaldehyde, transferred to a Hybond N membrane, and then hybridized with P-labeled DNA fragment as a probe.