„Distinct roles of XRCC4 and Ku80 in non-homologous end-joining of endonuclease- and ionizing radiation-induced DNA double-strand breaks“

Non-homologous end-joining (NHEJ) of DNA doublestrand breaks (DSBs) is mediated by two protein complexes comprising Ku80/Ku70/DNA-PKcs/ Artemis and XRCC4/LigaseIV/XLF. Loss of Ku or XRCC4/LigaseIV function compromises the rejoining of radiation-induced DSBs and leads to defective V(D)J recombination. In this study, we sought to define how XRCC4 and Ku80 affect NHEJ of sitedirected chromosomal DSBs in murine fibroblasts. We employed a recently developed reporter system based on the rejoining of I-SceI endonucleaseinduced DSBs. We found that the frequency of NHEJ was reduced by more than 20-fold in XRCC4!/! compared to XRCC4+/+ cells, while a Ku80 knock-out reduced the rejoining efficiency by only 1.4-fold. In contrast, lack of either XRCC4 or Ku80 increased end degradation and shifted repair towards a mode that used longer terminal microhomologies for rejoining. However, both proteins proved to be essential for the repair of radiationinduced DSBs. The remarkably different phenotype of XRCC4and Ku80-deficient cells with regard to the repair of enzyme-induced DSBs mirrors the embryonic lethality of XRCC4 knock-out mice as opposed to the viability of the Ku80 knock-out. Thus, I-SceI-induced breaks may resemble DSBs arising during normal DNA metabolism and mouse development. The removal of these breaks likely has different genetic requirements than the repair of radiation-induced DSBs. INTRODUCTION DNA double-strand breaks (DSBs) represent the most serious DNA lesion, which, if not adequately repaired, can lead to cell death through the generation of lethal chromosomal aberrations. Alternatively, inadequately repaired DSBs may give rise to potentially carcinogenic mutations or chromosomal rearrangements. In mammalian cells, non-homologous end-joining (NHEJ) is the principal pathway for the removal of DSBs throughout the entire cell cycle. NHEJ relies on a limited number of core proteins that are sufficient to execute DSB repair in vitro (1,2). The heterodimer of Ku70 and Ku80 recognizes and binds DNA ends and recruits the catalytic subunit of the DNA-dependent kinase (DNA-PKcs), together forming the DNA-PK holoenzyme. Ku proteins and DNA-PKcs are both capable of tethering DNA ends (3–5), with Ku translocating internally upon binding of DNA-PKcs to the DNA end (6). Prior to ligation, the DNA ends need to be trimmed for proper annealing. At least a fraction of DSB ends is tailored by the Artemis The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors *To whom correspondence should be addressed. Tel: +49 40 42803 3930; Fax: +49 40 42803 5139; Email: dahm@uke.uni-hamburg.de ! 2008 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. nuclease in concert with DNA-PKcs (7). Other exoand endonucleases are not yet defined. The polymerases Pol m and Pol ! likely replenish small sequence gaps (8,9). The fill-in synthesis appears to be tightly coupled to the ligation of DNA ends (2,8). The latter step is performed by DNA ligase IV (LigIV) together with its obligatory cofactor XRCC4 (10,11). Another partner involved in the ligation step in vivo has been recently identified as the XRCC4-like factor (= XLF, Cernunnos) (12,13). The ligation complex is recruited by and interacts with Ku and DNA-PKcs (14–16). Cells deficient in any of the NHEJ core proteins display pronounced hypersensitivity to ionizing radiation (IR) and a reduced ability to rejoin IR-induced DSBs (17). The NHEJ core proteins are also required for V(D)J recombination and class-switch recombination (18–20). Deficiency of either of these proteins leads to severe clinical immunodeficiency in mice and humans (21–25). Further, NHEJ deficiencies in mice are associated with impaired neurogenesis and growth delay (25–27). Defective NHEJ also causes gross chromosomal aberrations, genomic instability and lymphomagenesis (28,23). In humans, however, defective NHEJ has not yet been extensively linked to malignancy (29–32). Genetic knock-out of XRCC4 but not of Ku80 in mice leads to embryonic death, suggesting that XRCC4 function is critical for the removal of DSBs that arise during development (22,23). Interestingly, this differential importance of XRCC4 and Ku80 for the DSB repair efficiency is generally not well reflected in biochemical and extrachromosomal end-joining assays (33–36). Furthermore, loss of XRCC4 or Ku80 causes IR hypersensitivity that is of similar severity. Chromosomal plasmid assays that employ the rarecutting I-SceI endonuclease have been employed successfully to elucidate the genetic determinants and molecular mechanisms of homologous recombination (37,38). Recently, others and we have applied these assays to NHEJ as well (39–41). In a report by Lopez and colleagues (39), mutation of Ku80 had surprisingly little if any effect on the rejoining of non-complementary ends generated by cleavage of two inverted I-SceI recognition sites spaced some kb apart. However, it cannot be excluded that residual Ku80 activity in the xrs6 CHO cells was sufficient for DSB rejoining in that assay. The importance of XRCC4/LigIV for the rejoining of sitedirected chromosomal breaks was not studied and has remained unknown. In the present study, we therefore investigated the roles of XRCC4 and Ku80, as the respective representatives of the XRCC4/XLF/LigIV and Ku/DNA–PKcs/Artemis complex, in the rejoining of I-SceI endonuclease-induced DSBs. We report the chromosomal repair phenotype of XRCC4 null mouse cells, which is characterized by a more than 20-fold reduction of NHEJ proficiency, increased end-degradation, and an increase in microhomology length used for joining of ends. Strikingly, knock-out of Ku80 resulted only in a mild I-SceI end-joining defect (1.4-fold), while having an impact on repair fidelity that was similar to the loss of XRCC4. MATERIALS AND METHODS Cells Mouse embryonic fibroblasts (MEFs) lacking either Ku80 or the XRCC4 (28, 23, kindly gifted by A. Nussenzweig and F. Alt) and the respective parental strains (all strains were p53!/!) were cultured in DMEM medium supplemented with 15% FCS, 1% penicillin/streptomycin at 378C in an atmosphere of 5% CO2. The presence or absence of XRCC4 and Ku80 was verified by Western blotting (Supplementary Figure S1). To harvest clones grown in selection medium (either Puromycin or XHATM, see below) in T-175 plastic culture flasks (Greiner, Germany), a 75W soldering iron (ERSA Multisprint, ERSA, Germany) was used to melt a 1 cm hole directly above each individual colony through which careful micro-trypsinization (10 ml Trypsin-EDTA, GIBCO-Invitrogen) was possible. Only those clones were chosen that grew in sufficient distance (> 1cm) to its proximate neighbor colony to avoid cross contamination. The individual clones were transferred to microwell plates and further expanded. NHEJ reporter substrate The generation of the pPHW2 plasmid was described previously (40). Induction of DSBs by the I-SceI endonuclease and rejoining by NHEJ lead to gpt translation and resistance to XHATM-containing selection medium (Figure 1). Here, 0.5mg of the pPHW2 was linearized with PvuI and electroporated into 10 cells. Cells were grown for 2–3 weeks in selection medium (0.5 mg/ml puromycin, Sigma) to obtain clones with stable integration of pPHW2. This was verified by PCR using the primer pair ATGTTGCAGATCCATGCACG and B TGCGCCTAGGGATAA CAGGGTAATCTCGAGCCATGGATTACCCTGTTAT CCCTAGATCTGGCTG ACGCGGATCCC TATTGTCCCATTAGAGGTCGGTACCTAATGGGAC AATAGGGATCTACACCGAC I-SceI I-SceI I-SceI I-SceI artificial ORF polyA puromycin-R ATG Repair by NHEJ I-SceI break induction gpt XHATM resistance ATG