Triplex formation of an oligonucleotide containing 2'-O-methylpseudoisocytidine with a DNA duplex at neutral pH

The synthesis of the hexadecanucleotide 5TTTT1TTTT111111T3' (1-16mer) containing 2-amino-5-(2-O-methyl-β-D-ribofuranosyl)-4(1H)-pyrimidinone (2'-O-methylpseudoisocytidine or 1) is described. Triplex formation of 1-16mer with a deoxyribonucleotide duplex 5' d(ACCAAAAGAAAAGGGGGGACCA)3'-5' d- of human T-cell leukemia (lymphotropic) virus (HTLV-III) was studied by thermal denaturation andc circular dichroism (CD) spectra in aqueous solution at neutral pH