Characterization of the Pseudomonas putida Mobile Genetic Element ISPpu10: an Occupant of Repetitive Extragenic Palindromic Sequences

ABSTRACT We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

[1]  S. Chin,et al.  Human and mouse oligonucleotide-based array CGH , 2005, Nucleic acids research.

[2]  A. Robertson,et al.  Piv Site-Specific Invertase Requires a DEDD Motif Analogous to the Catalytic Center of the RuvC Holliday Junction Resolvases , 2005, Journal of bacteriology.

[3]  E. Pareja,et al.  Repetitive extragenic palindromic sequences in the Pseudomonas syringae pv. tomato DC3000 genome: extragenic signals for genome reannotation. , 2005, Research in microbiology.

[4]  J. Ramos,et al.  REP code: defining bacterial identity in extragenic space. , 2005, Environmental microbiology.

[5]  John B. Anderson,et al.  CDD: a Conserved Domain Database for protein classification , 2004, Nucleic Acids Res..

[6]  M. Espinosa-Urgel.  Plant-associated Pseudomonas populations: molecular biology, DNA dynamics, and gene transfer. , 2004, Plasmid.

[7]  U. Römling,et al.  GGDEF and EAL domains inversely regulate cyclic di‐GMP levels and transition from sessility to motility , 2004, Molecular microbiology.

[8]  R. Lenski,et al.  Dynamics of insertion sequence elements during experimental evolution of bacteria. , 2004, Research in microbiology.

[9]  A. J. Carpousis,et al.  The RNA degradosome and poly(A) polymerase of Escherichia coli are required in vivo for the degradation of small mRNA decay intermediates containing REP‐stabilizers , 2003, Molecular microbiology.

[10]  E. Ohtsubo,et al.  A Novel IS Element, IS621, of the IS110/IS492 Family Transposes to a Specific Site in Repetitive Extragenic Palindromic Sequences in Escherichia coli , 2003, Journal of bacteriology.

[11]  J. Clément,et al.  Transposases are responsible for the target specificity of IS1397 and ISKpn1 for two different types of palindromic units (PUs). , 2003, Nucleic acids research.

[12]  O. White,et al.  Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. , 2002, Environmental microbiology.

[13]  T. Nakazawa.  Travels of a Pseudomonas, from Japan around the world. , 2002, Environmental microbiology.

[14]  J. Ramos,et al.  Species-specific repetitive extragenic palindromic (REP) sequences in Pseudomonas putida. , 2002, Nucleic acids research.

[15]  F. O'Gara,et al.  Phenotypic Selection and Phase Variation Occur during Alfalfa Root Colonization by Pseudomonas fluorescens F113 , 2002, Journal of bacteriology.

[16]  S. Bachellier,et al.  Transposition of IS1397 in the FamilyEnterobacteriaceae and First Characterization of ISKpn1, a New Insertion Sequence Associated withKlebsiella pneumoniae Palindromic Units , 2001, Journal of bacteriology.

[17]  William H. Thiel,et al.  Conserved amino acid motifs from the novel Piv/MooV family of transposases and site‐specific recombinases are required for catalysis of DNA inversion by Piv , 2001, Molecular microbiology.

[18]  J. Sambrook,et al.  Molecular Cloning: A Laboratory Manual , 2001 .

[19]  T. Chin-A-Woeng,et al.  Root colonization by phenazine-1-carboxamide-producing bacterium Pseudomonas chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot. , 2000, Molecular plant-microbe interactions : MPMI.

[20]  Y. Gray,et al.  It takes two transposons to tango: transposable-element-mediated chromosomal rearrangements. , 2000, Trends in genetics : TIG.

[21]  J. Ramos,et al.  Tolerance to sudden organic solvent shocks by soil bacteria and characterization of Pseudomonas putida strains isolated from toluene polluted sites , 2000 .

[22]  J. Ramos,et al.  Genetic Analysis of Functions Involved in Adhesion of Pseudomonas putida to Seeds , 2000, Journal of bacteriology.

[23]  S. Bachellier,et al.  IS1397 Is Active for Transposition into the Chromosome of Escherichia coli K-12 and Inserts Specifically into Palindromic Units of Bacterial Interspersed Mosaic Elements , 1999, Journal of bacteriology.

[24]  R. Kolter,et al.  Evolution of microbial diversity during prolonged starvation. , 1999, Proceedings of the National Academy of Sciences of the United States of America.

[25]  M. Farwell,et al.  Electroporation of freshly plated Escherichia coli and Pseudomonas aeruginosa cells. , 1998, BioTechniques.

[26]  J. Ramos,et al.  Metabolism of 2,4,6-Trinitrotoluene by Pseudomonas sp. JLR11 , 1998 .

[27]  L. van der Fits,et al.  A site-specific recombinase is required for competitive root colonization by Pseudomonas fluorescens WCS365. , 1998, Proceedings of the National Academy of Sciences of the United States of America.

[28]  K. Timmis,et al.  Activation and Repression of Transcription at the Double Tandem Divergent Promoters for the xylR and xylS Genes of the TOL Plasmid of Pseudomonas putida , 1998, Journal of bacteriology.

[29]  Thomas L. Madden,et al.  Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. , 1997, Nucleic acids research.

[30]  D. Roop,et al.  Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. , 1995, Gene.

[31]  J. Ramos,et al.  Isolation and expansion of the catabolic potential of a Pseudomonas putida strain able to grow in the presence of high concentrations of aromatic hydrocarbons , 1995, Journal of bacteriology.

[32]  E. Gilson,et al.  Structural and functional diversity among bacterial interspersed mosaic elements (BIMEs) , 1994, Molecular microbiology.

[33]  V. de Lorenzo,et al.  Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and transposons that confer conditional phenotypes. , 1993, Gene.

[34]  K. Timmis,et al.  Regulator and enzyme specificities of the TOL plasmid-encoded upper pathway for degradation of aromatic hydrocarbons and expansion of the substrate range of the pathway , 1989, Journal of bacteriology.

[35]  Sarah F. Newbury,et al.  Stabilization of translationally active mRNA by prokaryotic REP sequences , 1987, Cell.

[36]  T. Finan,et al.  Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes , 1986, Journal of bacteriology.

[37]  V. Subramanian,et al.  Isolation and characterization of Pseudomonas putida PpF1 mutants defective in the toluene dioxygenase enzyme system , 1984, Journal of bacteriology.

[38]  G. Ames,et al.  Repetitive extragenic palindromic sequences: A major component of the bacterial genome , 1984, Cell.

[39]  D. Hanahan.  Studies on transformation of Escherichia coli with plasmids. , 1983, Journal of molecular biology.

[40]  J. Vieira,et al.  The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. , 1982, Gene.

[41]  S. Howorka,et al.  Improved Antibiotic-Resistance Cassettes Through Restriction Site Elimination Using Pfu DNA Polymerase PCR , 1999 .