Human Werner Syndrome DNA Helicase Unwinds Tetrahelical Structures of the Fragile X Syndrome Repeat Sequence d(CGG) n *

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G′2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G′2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3′ or 5′ ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7tetraplex, bimolecular tetraplex structures of a telomeric sequence 5′-d(TAGACATG(TTAGGG)2TTA)-3′, or tetramolecular quadruplex forms of an IgG switch region sequence 5′-d(TACAGGGGAGCTGGGGTAGA)-3′. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

[1]  J. Sambrook,et al.  Molecular Cloning: A Laboratory Manual , 2001 .

[2]  L. Loeb,et al.  Werner Syndrome Protein , 1998, The Journal of Biological Chemistry.

[3]  M. Gray,et al.  Werner Syndrome Protein , 1998, The Journal of Biological Chemistry.

[4]  W. Doerfler,et al.  New 5′-(CGG) n -3′ Repeats in the Human Genome* , 1998, The Journal of Biological Chemistry.

[5]  N. Maizels,et al.  The Bloom’s Syndrome Helicase Unwinds G4 DNA* , 1998, The Journal of Biological Chemistry.

[6]  I. Saira Mian,et al.  The premature ageing syndrome protein, WRN, is a 3′→5′ exonuclease , 1998, Nature Genetics.

[7]  F. Harmon,et al.  RecQ helicase, in concert with RecA and SSB proteins, initiates and disrupts DNA recombination. , 1998, Genes & development.

[8]  I. Hickson,et al.  The Bloom’s Syndrome Gene Product Is a 3′-5′ DNA Helicase* , 1997, The Journal of Biological Chemistry.

[9]  K. E. Hunt,et al.  An apoptosis-inducing genotoxin differentiates heterozygotic carriers for Werner helicase mutations from wild-type and homozygous mutants , 1997, Human Genetics.

[10]  M. Gray,et al.  The Werner syndrome protein is a DNA helicase , 1997, Nature Genetics.

[11]  N. Ellis.  DNA helicases in inherited human disorders. , 1997, Current opinion in genetics & development.

[12]  J. Courcelle,et al.  recF and recR are required for the resumption of replication at DNA replication forks in Escherichia coli. , 1997, Proceedings of the National Academy of Sciences of the United States of America.

[13]  K. Hanada,et al.  RecQ DNA helicase is a suppressor of illegitimate recombination in Escherichia coli. , 1997, Proceedings of the National Academy of Sciences of the United States of America.

[14]  Y. Ishikawa,et al.  Excess of rare cancers in Werner syndrome (adult progeria). , 1996, Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology.

[15]  D. Patel,et al.  Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat. , 1995, Journal of molecular biology.

[16]  M. Fry,et al.  The Fragile X Syndrome Single Strand d(CGG)n Nucleotide Repeats Readily Fold Back to Form Unimolecular Hairpin Structures * , 1995, The Journal of Biological Chemistry.

[17]  N. Ellis,et al.  The Bloom's syndrome gene product is homologous to RecQ helicases , 1995, Cell.

[18]  I. Haworth,et al.  The trinucleotide repeat sequence d(CGG)15 forms a heat-stable hairpin containing Gsyn. Ganti base pairs. , 1995, Biochemistry.

[19]  Fu‐ming Chen.  Acid-facilitated Supramolecular Assembly of G-quadruplexes in d(CGG)β4(*) , 1995, The Journal of Biological Chemistry.

[20]  S. S. Smith,et al.  Hairpins are formed by the single DNA strands of the fragile X triplet repeats: structure and biological implications. , 1995, Proceedings of the National Academy of Sciences of the United States of America.

[21]  A. Marquis Gacy,et al.  Trinucleotide repeats that expand in human disease form hairpin structures in vitro , 1995, Cell.

[22]  T. Eki,et al.  Characterization of DNA synthesis and DNA-dependent ATPase activity at a restrictive temperature in temperature-sensitive tsFT848 cells with thermolabile DNA helicase B , 1995, Molecular and cellular biology.

[23]  L. Loeb,et al.  The fragile X syndrome d(CGG)n nucleotide repeats form a stable tetrahelical structure. , 1994, Proceedings of the National Academy of Sciences of the United States of America.

[24]  J. Longshore,et al.  Over-representation of the disease associated (CAG) and (CGG) repeats in the human genome. , 1994, Nucleic acids research.

[25]  J. German.  Bloom Syndrome: A Mendelian Prototype of Somatic Mutational Disease , 1993, Medicine.

[26]  M. Poot,et al.  Impaired S-phase transit of Werner syndrome cells expressed in lymphoblastoid cell lines. , 1992, Experimental cell research.

[27]  J. Sutcliffe,et al.  Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox , 1991, Cell.

[28]  J. Sutcliffe,et al.  Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome , 1991, Cell.

[29]  J. Mandel,et al.  Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome , 1991, Science.

[30]  Dipankar Sen,et al.  A sodium-potassium switch in the formation of four-stranded G4-DNA , 1990, Nature.

[31]  T. Cech,et al.  Monovalent cation-induced structure of telomeric DNA: The G-quartet model , 1989, Cell.

[32]  R. Monnat,et al.  Mutator phenotype of Werner syndrome is characterized by extensive deletions. , 1989, Proceedings of the National Academy of Sciences of the United States of America.

[33]  W. Gilbert,et al.  Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis , 1988, Nature.

[34]  M. Fry,et al.  Factor D is a selective single-stranded oligodeoxythymidine binding protein , 1988, Nucleic Acids Res..

[35]  T. Honjo,et al.  Immunoglobulin class switching , 1984, Cell.

[36]  Vijayalaxmi,et al.  Bloom's syndrome: evidence for an increased mutation frequency in vivo. , 1983, Science.

[37]  H. Manor,et al.  The SV40 large T-antigen helicase can unwind four stranded DNA structures linked by G-quartets. , 1997, Nucleic acids research.

[38]  H. Hoehn,et al.  Cytogenetics of Werner's syndrome cultured skin fibroblasts: variegated translocation mosaicism. , 1981, Cytogenetics and cell genetics.

[39]  C. A. Thomas,et al.  Molecular cloning. , 1977, Advances in pathobiology.