Identification and Characterization of an Essential Family of Inositol Polyphosphate 5-Phosphatases ( INP 51 , INP 52 and INP 53 Gene Products ) in the Yeast Saccharomyces cerevisiae

We recently demonstrated that the S. cerevisiae INP51 locus (YIL002c) encodes an inositol polyphosphate 5-phosphatase. Here we describe two related yeast loci, INP52 (YNL106c) and INP53 (YOR109w). Like Inp51p, the primary structures of Inp52p and Inp53p resemble the mammalian synaptic vesicle-associated protein, synaptojanin, and contain a carboxy-terminal catalytic domain and an amino-terminal SAC1-like segment. Inp51p (108 kD), Inp52p (136 kD) and Inp53p (124 kD) are membrane-associated. Single null mutants (inp51, inp52, or inp53) are viable. Both inp51 inp52 and inp52 inp53 double mutants display compromised cell growth, whereas an inp51 inp53 double mutant does not. An inp51 inp52 inp53 triple mutant is inviable on standard medium, but can grow weakly on media supplemented with an osmotic stabilizer (1 M sorbitol). An inp51 mutation, and to a lesser degree an inp52 mutation, confers coldresistant growth in a strain background that cannot grow at temperatures below 158. Analysis of inositol metabolites in vivo showed measurable accumulation of phosphatidylinositol 4,5-bisphosphate in the inp51 mutant. Electron microscopy revealed plasma membrane invaginations and cell wall thickening in double mutants and the triple mutant grown in sorbitol-containing medium. A fluorescent dye that detects endocytic and vacuolar membranes suggests that the vacuole is highly fragmented in inp51 inp52 double mutants. Our observations indicate that Inp51p, Inp52p, and Inp53p have distinct functions and that substrates and/or products of inositol polyphosphate 5-phosphatases may have roles in vesicle trafficking, membrane structure, and/or cell wall formation. UPON agonist stimulation of mammalian cells, 1994; Rameh et al. 1995; Zhou et al. 1995). Hence, the physiological effects of these compounds may be phospholipase C hydrolyzes phosphatidylinositol mediated by direct association with certain target pro4,5-bisphosphate (PtdIns[4,5]P2) to produce the second teins rather than by indirect effects on the biophysical messengers, inositol 1,4,5-trisphosphate (Ins[1,4,5]P3) properties of membranes. and diacylglycerol. Diacylglycerol activates protein kiA balance of kinase, phosphatase, and phospholipase nase C, while Ins[1,4,5]P3 mobilizes intracellular Ca21 activities regulates the cellular level of these soluble and (reviewed in Bansal and Majerus 1990; Berridge lipid-linked inositol phosphates. These activities include 1993; Hokin 1985; Majerus 1992; Majerus et al. 1990). the inositol polyphosphate 5-phosphatase (hereafter Inositol polyphosphate 3-kinases can convert Ins[1,4,5]P3 5-Ptase) family (reviewed in Drayer et al. 1996; Irvine to Ins[1,3,4,5]P4 (Irvine et al. 1988) and phosphatidyl1992; Majerus 1996; Mitchell et al. 1996). The 5-Ptases inositol 3-kinases can convert PtdIns[4,5]P2 to PtdInsare Mg21-dependent enzymes that remove the phospho[3,4,5]P3 (Hawkins et al. 1992; Irvine et al. 1988). Eviryl moiety from the C5 position of the inositol ring dence indicates that PtdIns[4,5]P2 and PtdIns[3,4,5]P3, in inositol polyphosphate compounds. These enzymes and their derivatives, play roles in numerous cellular were first identified based on their ability to terminate processes, including secretion regulation (Hay et al. Ins[1,4,5]P3-mediated Ca21 release, since the product, 1995) and modulation of the actin cytoskeleton (HartIns[1,4]P2, is unable to mobilize Ca21 (Connolly et al. wig et al. 1995; Janmey et al. 1992). Additionally, certain 1985). To date, at least ten mammalian 5-Ptases have protein structural elements, including Src-homology-2 been identified. One hallmark of a 5-Ptase is the pres(SH2), pleckstrin homology (PH), and phosphotyroence of two consensus sequences, WXGDXN(Y/F)R and sine-binding (PTB) motifs, can bind both soluble and P(A/S)W(C/T)DRIL (Jefferson and Majerus 1995). lipid-linked inositol polyphosphates (Harlan et al. Mutational analysis demonstrates that these residues participate in substrate binding and/or catalysis (Communi and Erneux 1996; Communi et al. 1996; Jefferson Corresponding author: John D. York, Department of Pharmacology and Majerus 1996). and Cancer Biology, Duke University Medical Center, DUMC 3813, Durham, NC 27710. E-mail: yorkj@acpub.duke.edu The 5-Ptases are classified into four groups, based Genetics 148: 1715–1729 (April, 1998) 1716 L. E. Stolz et al. mainly on substrate specificity ( Jefferson et al. 1997). genes comprise an essential gene family and provide additional insights about the potential cellular functions Type I enzymes act only on the soluble inositol polyphosof these enzymes. phates Ins[1,4,5]P3 and Ins[1,3,4,5]P4. Type I 5-Ptases have been cloned and characterized from a number of tissues (Connolly et al. 1985; De Smedt et al. 1994; De MATERIALS AND METHODS Smedt et al. 1996; Laxminarayan et al. 1993; LaxmiStrains, media, and genetic methods: Yeast strains used in narayan et al. 1994; Verjans et al. 1994). These enzymes this study are listed in Table 1. The cells were propagated in are thought to be responsible for termination of standard rich (YPD) medium, or in complete minimal meIns[1,4,5]P3-induced Ca21 mobilization. dium (CM) lacking the appropriate nutrient(s) to maintain Type II enzymes can hydrolyze both Ins[1,4,5]P3 and selection for plasmids or markers. Standard procedures for yeast genetic manipulations were used (Ausubel et al. 1995; Ins[1,3,4,5]P4, as well as PtdIns[4,5]P2 and PtdIns[3,4,5]P3 Guthrie and Fink 1991). The ability of a given yeast strain (Jackson et al. 1995; Matzaris et al. 1994). The first to propagate at 128 was assessed by dispersing single cells on member of this class was identified in platelets ( Jeffera YPD plate using a micromanipulator and, after incubation son and Majerus 1995; Mitchell et al. 1989); however, for an appropriate amount of time, observing the growth other isoforms have been identified in other tissues under a microscope. Gene disruption and strain construction: INP51 was dis(Palmer et al. 1994; Woscholski et al. 1995). This subrupted and replaced with the LEU2 gene as described elsefamily contains the Golgi-asssociated 5-Ptase OCRL-1 where (L. E. Stolz, W. J. Kuo, J. Longchamps, M. K. Sekhon, (Olivos-Glander et al. 1995), which is defective in and J. D. York, unpublished results). The entire open reading patients with oculocerebrorenal, or Lowe’s, syndrome frame of INP52 was disrupted and replaced with HIS3 as fol(Attree et al. 1992). Another type II enzyme is the lows. HIS3 was amplified from pRS303 (Sikorski and Heiter 1989) by PCR with the sense primer 59-CGAAACAGCAAAC neuronal protein, synaptojanin, which is involved in TAGAAAGATAGCAATAGTTTCAGAAACACATGGCAGATT synaptic vesicle recycling (McPherson et al. 1994a,b; GTACTGAGAGTGC-39 and the antisense primer 59-GTGGA McPherson et al. 1996). The N terminus of synaptoGGCCTTTGCTGGCTCAGGATCTTCTGTAGTGGACACAC janin is homologous to S. cerevisiae Sac1p. The SAC1 CTCCTTACGCATCTGTGCGG-39 (where the underlined bases correspond to the INP52 coding sequence and the remainder gene was first identified as a suppressor of certain temof the primer is common to the pRS series of plasmids) under perature-sensitive actin alleles (Novick et al. 1989). reaction conditions recommended by the Taq polymerase Since then, Sac1p has been implicated in phospholipid manufacturer (Boehringer Mannheim Corp., Indianapolis). metabolism, vesicle-actin cytoskeleton interaction, and The resulting inp52::HIS3 PCR product was used for DNAsecretory transport (Cleves et al. 1989; Kearns et al. mediated transformation of strain W303 (MATa/MATa) using the standard lithium acetate protocol (Ausubel et al. 1995). 1997; Mayinger et al. 1995; Whitters et al. 1993). Stable His1 transformants were selected on 2His plates and Type III 5-Ptases only hydrolyze PtdIns[3,4,5]P3 and verified by PCR of the genomic DNA using a sense primer are associated with PtdIns 3-kinase ( Jackson et al. 1995). complementary to the chromosomal region 59 of the INP52 Finally, type IV 5-Ptases, which include the protein SHIP locus (59-GGTCGAAGGTAAGAATGCTGCGGC-39) and an antisense primer corresponding to a sequence in HIS3 (59and its alternative splice variants, SIP-110, SIP-130, and GCCTCATCCAAAGGCGC-39). Heterozygous inp52::HIS3/ SIP-145 (Damen et al. 1996; Lioubin et al. 1996) are INP52 transformants were sporulated on 0.3% potassium aceassociated with tyrosine-phosphorylated growth factor tate plates (Guthrie and Fink 1991). The resulting tetrads receptors ( Jefferson et al. 1997). These enzymes can were dissected onto YPD plates, then replica-plated onto 2His hydrolyze both PtdIns[3,4,5]P3 and Ins[1,3,4,5]P4. plates to identify haploid spores carrying the inp52::HIS3 allele. These inp52::HIS3 spores were again verified by both It remains unclear why so many different 5-Ptases exist. PCR, as above, and immunoblotting cell extracts (see below) However, the importance of these enzymes is demonto confirm the absence of the INP52-encoded polypeptide. strated by examination of the S. cerevisiae genome seThe entire INP53 open reading frame was also disrupted quence which revealed the presence of an open reading and replaced with the HIS3 gene as described above, except that the template providing HIS3 was plasmid pJJ217 ( Jones frame, which we designated INP51, that bears striking and Prakash 1990), the sense primer was 59-AGAAAATAAC similarity to the synaptojanin subclass of 5-Ptases. DeTGGGGCGAAGAATATCTAGTTATCCACTCCTTCATAGAG tailed characterization of INP51 is presented elsewhere CCTCCTCTAGTACACTC-39, and the antisense primer was (L. E. Stolz, W. J. Kuo, J. Longchamps, M. K. Sekhon, 59 -AAAGGGATACAAACGGAACAACAACCACACTTCAAAG and J. D. York, unpublished results). With the compleATAACATATTCGCGCGCCTCGTTCAGAAT-39 (where the underlined bases correspond to the INP53 coding sequence tion of the entire S. cerevisiae genome, however, we and the remainder correspond to sequences in pJJ217). The found two additional open reading frames, designat